Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.

Size: px
Start display at page:

Download "Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation."

Transcription

1 Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting

2 Chapter 7: Gene control Control of gene expression is critical in mediating cellular changes: Executing developmental programs Controlling cell cycle Responsiveness to regulators There are many examples of evolutionary variation in promoters and transcriptional regulators

3 Since all cells in an organism have the same DNA, how do the cells become different? (1) Some genes are expressed only in specific tissues (e.g., hemoglobin)

4 Since all cells in an organism have the same DNA, how do the cells become different? (2) Genes expressed in all cells are termed housekeeping genes: cytoskeleton building blocks metabolism histones, polymerases

5 Since all cells in an organism have the same DNA, how do the cells become different? (3) Even housekeeping genes are expressed at different levels -metabolic profiles of red and white muscle

6 Since all cells in an organism have the same DNA, how do the cells become different? (4) Post-transcriptional processes (Fig 7-5) also critical in regulating function: -mrna processing -mrna transport and localization -mrna degradation -translation -post-translational modification -3-dimensional organization -compartmentation -protein degradation

7 Fig 7-5. Gene expression is controlled at many levels

8 Cells can change expression in response to external signals Many cells use hormonal signals to trigger changes in gene expression: e.g., glucocorticoids induce changes in metabolic enzyme expression in liver

9 Cells can change expression in response to external signals Different cells respond differently to the same hormones: e.g., glucocorticoids in liver: induction of genes that enhance conversion of amino acids to glucose. -in adipocytes, glucocorticoids repress the same gene

10 Transcriptional control Genes are regulated by promoters (regions upstream of coding region) Genes can also be regulated at sites that are distant from promoters (even in introns)

11 Gene regulatory proteins Regulatory regions of DNA have short sequences (elements) that bind specific gene regulatory proteins e.g., Sp1 binds GGGCGG CCCGCC These proteins recognize subtle differences in the structure of the outside of the major groove of the DNA double helix

12 Gene regulatory proteins Each protein differs in how it binds DNA and how it interacts with other proteins Several common DNA binding motifs including:

13

14 -helix-turn-helix motif (Fig 7-14), include homeodomain proteins

15

16 -zinc finger proteins (Figs )

17

18

19

20 -leucine zippers (Fig. 7-21)

21 -helix-loop-helix (HLH) (Fig 7-25)

22 Gene regulatory proteins DNA binding ability of gene regulatory proteins can be influenced by: -localization -dimerization (homodimers vs heterodimers)

23

24

25 Tryptophan repressor is a simple model of ligand-dependent gene regulation (Fig-7-34, 7-35) Repressor protein can bind DNA and trp If trp absent, repressor cannot bind DNA (unrepressed) When trp available, repressor binds and prevents RNA Pol from binding gene

26

27

28

29

30 Eukaryotic gene expression What regulates transcription (Fig 7-41) Promoter: binding site for RNA Pol II and general transcription factors Other regulatory sequences can be far away (even 50,000 bp) Activators (or enhancers) bind to specific DNA sequences (modify local DNA structure)

31 Eukaryotic gene expression

32 Gene activators Activators can work synergistically (Fig 7-47) Order of binding of activators and combination of activators influences transcription (Fig 7-48)

33

34

35 Gene repressors Repressors can work many different ways (Fig 7-49) -competition with activators for sites -masking activation site on activator -disruption of general transcription factors -affecting chromatin remodelling

36

37

38 Co-activators and co-repressors These proteins do not bind DNA but bind DNAbinding proteins (Fig 7-50)

39 Myogenesis: an example of programmed transcriptional regulation (Fig 7-72) Precursor cells are myoblasts Hormonal conditions cause differentiation: turning on suites of muscle-specific genes in the appropriate order Hormones induce expression of myogenic factors (transcription factors)

40 Control of gene expression 1. Localization of transcription factors Hormone kinase kinase X

41 Control of gene expression 2. Dimerization Hormone kinase kinase

42 Control of gene expression 3. Affinity for DNA (phosphorylation dependent) Hormone kinase kinase

43 Control of gene expression 4. Affinity for DNA (ligand dependent) Hormone

44 Control of gene expression 5. Affinity for DNA (ligand dependent) Hormone

Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators

Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators At least 5 potential gene expression control points Superfamily of Gene Regulators Activation of gene structure Initiation

More information

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone

More information

Regulation of gene expression. (Lehninger pg )

Regulation of gene expression. (Lehninger pg ) Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene

More information

Differential Gene Expression

Differential Gene Expression Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

Gene Expression. Lesson 6

Gene Expression. Lesson 6 Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life

More information

Transcription factors

Transcription factors Atlas of Genetics and Cytogenetics in Oncology and Haematology Transcription factors I Introduction * II Initiation of transcription III Transcription factors family pdf version I Introduction III.1 Helix-Turn-Helix

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Complex Transcription Machinery

Complex Transcription Machinery Complex Transcription Machinery Subunits of the Basal Txn Apparatus Stepwise Assembly of the Pre-initiation Complex Interplay of Activators, Co-regulators and RNA Polymerase at the Promoter Divide and

More information

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268 DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:

More information

Enhancers. Activators and repressors of transcription

Enhancers. Activators and repressors of transcription Enhancers Can be >50 kb away from the gene they regulate. Can be upstream from a promoter, downstream from a promoter, within an intron, or even downstream of the final exon of a gene. Are often cell type

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Chapter 14 Regulation of Transcription

Chapter 14 Regulation of Transcription Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription

More information

Synthetic cells: do bacteria need all its genes? No.

Synthetic cells: do bacteria need all its genes? No. NO NEED TO REFER TO THE SLIDES. بسم هللا الرحمن الرحيم Do we need all the non coding regions of the DNA? Two weeks ago, they discovered that the genome of a plant is very small (recall that plant genome

More information

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

Gene regulation V Biochemistry 302. March 6, 2006

Gene regulation V Biochemistry 302. March 6, 2006 Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain

More information

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

GENE REGULATION IN PROKARYOTES

GENE REGULATION IN PROKARYOTES GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Eukaryotic transcription (II)

Eukaryotic transcription (II) Eukaryotic transcription (II) Transcription factors Prokaryote: Sigma factors they are similar to general transcription factor of eukaryotes, they help bring RNA pol to the promoter Transcription factors

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes 3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Transcription in Prokaryotes. Jörg Bungert, PhD Phone:

Transcription in Prokaryotes. Jörg Bungert, PhD Phone: Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating

More information

- all cells express large number of the same genes - housekeeping or common genes - many cells also express cell-type-specific genes

- all cells express large number of the same genes - housekeeping or common genes - many cells also express cell-type-specific genes Developmental Biology - Biology 4361 Lecture 8 - Differential Gene Expression October 13, 2005 The principle of genomic equivalence states that all cells in a developing organism have the same genetic

More information

Lecture 9 Controlling gene expression

Lecture 9 Controlling gene expression Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around

More information

Chapter 18: Regulation of Gene Expression

Chapter 18: Regulation of Gene Expression Chapter 18: Regulation of Gene Expression Regulation of Metabolism Shuts off transcription Types of Feedback Negative feedback = body s response is to reduce the stimulus Ex: regulation of body temp, blood

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Gene Regulation in Eukaryotes

Gene Regulation in Eukaryotes Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Gene Expression and Regulation - 1

Gene Expression and Regulation - 1 Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission

More information

Chapter 13 - Regulation of Gene Expression

Chapter 13 - Regulation of Gene Expression Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

Chapter 3. DNA, RNA, and Protein Synthesis

Chapter 3. DNA, RNA, and Protein Synthesis Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer

More information

Chapter 18. Regulation of Gene Expression

Chapter 18. Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 2007-2008 Control of Prokaryotic (Bacterial) Genes 2007- Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

BCH 4054 Fall 2000 Chapter 31 Lecture Notes

BCH 4054 Fall 2000 Chapter 31 Lecture Notes BCH 4054 Fall 2000 Chapter 31 Lecture Notes 1 Chapter 31 Transcription and Regulation of Gene Expression 2 Messenger RNA Central Dogma (Francis Crick, 1958) DNA RNA Protein (Fig 31.1) Jacob-Monod Hypothesis:

More information

Nucleic Acids and the Encoding of Biological Information. Chapter 3

Nucleic Acids and the Encoding of Biological Information. Chapter 3 Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic

More information

The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression

The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression What Are the Characteristics of the Eukaryotic Genome? Key differences between eukaryotic and prokaryotic

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017 Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT? BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

More information

Differences between prokaryotes & eukaryotes. Gene function

Differences between prokaryotes & eukaryotes. Gene function GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences

More information

Eukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore

Eukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore Eukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore Lecture No. # 06 Eukaryotic Transcription Factors: Transcription Activation Domains In

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

(c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/ :57 PM

(c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/ :57 PM C2006/F2402 '14 OUTLINE OF LECTURE #11 (c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/2014 12:57 PM Handouts: 10C -- Typical Eukaryotic Gene,

More information

DNA & DNA : Protein Interactions BIBC 100

DNA & DNA : Protein Interactions BIBC 100 DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL

More information

Chapter 24: Promoters and Enhancers

Chapter 24: Promoters and Enhancers Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription

More information

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes

More information

Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS

Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS Chapter 19 Genetic Regulation of the Eukaryotic Genome A. Bergeron AP Biology PCHS 2 Do Now - Eukaryotic Transcription Regulation The diagram below shows five genes (with their enhancers) from the genome

More information

UNIT 2 HUMAN BIOLOGY NOTES

UNIT 2 HUMAN BIOLOGY NOTES DNA, genes and chromosomes CHAPTER 13 DNA THE CODE FOR LIFE - DNA is short for deoxyribonucleic acid found in cells of organisms. The DNA is embedded within the nucleus of a cell. - DNA is a long stranded

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression Different cell types of a organism contain the same DNA but the DNA is expressed differently. External signals can cause a cell to change the expression of its genes. DNA elements

More information

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11 Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide

More information

Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes

Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription: Sending the

More information

PART FOUR - ANSWERS PART FOUR: GENE REGULATION ANSWERS. Answers to questions from Chapter 15 on Positive and negative control of the lac operon

PART FOUR - ANSWERS PART FOUR: GENE REGULATION ANSWERS. Answers to questions from Chapter 15 on Positive and negative control of the lac operon PART FOUR: GENE REGULATION ANSWERS Answers to questions from Chapter 15 on Positive and negative control of the lac operon 15.1 laci, lacz, lacy, laca 15.2 The lac operon is negatively regulated by a repressor,

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question

More information

Name. Student ID. Midterm 2, Biology 2020, Kropf 2004

Name. Student ID. Midterm 2, Biology 2020, Kropf 2004 Midterm 2, Biology 2020, Kropf 2004 1 1. RNA vs DNA (5 pts) The table below compares DNA and RNA. Fill in the open boxes, being complete and specific Compare: DNA RNA Pyrimidines C,T C,U Purines 3-D structure

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

How to Use This Presentation

How to Use This Presentation How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Chem 465 Biochem II Test 3

Chem 465 Biochem II Test 3 Chem 465 Biochem II Test 3 Name: Multiple choice 4 points each. 1. Which of the following are features of the wobble hypothesis? A) A trna can recognize only one codon. B) Some trnas can recognize codons

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Contact information Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone:

Contact information Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone: Contact information Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone: 453-6437 Email: bbartholomew@siumed.edu Class notes http://www.siumed.edu/~bbartholomew/hbtxn.html Other references Principles

More information

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon: I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural

More information

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

Spring 2006 Biochemistry 302 Exam 2

Spring 2006 Biochemistry 302 Exam 2 Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

Transcription factors

Transcription factors Transcription factors R. de Martin Department of Vascular Biology and Thrombosis Research Medical University of Vienna K63 A20, TTP, XIAP IκBα K48 IL-6, Il-8, MCP-1, ICAM1, SELE, ciap1/2, A20, IκBα Adapted

More information

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely

More information

Please sign below if you wish to have your grades posted by the last five digits of your SSN

Please sign below if you wish to have your grades posted by the last five digits of your SSN BIO 226R EXAM II (Sample) PRINT YOUR NAME SSN Please sign below if you wish to have your grades posted by the last five digits of your SSN Signature BIO 226R Exam II has 6 pages, and 27 questions. There

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information