Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.
|
|
- Moris Gaines
- 5 years ago
- Views:
Transcription
1 Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting
2 Chapter 7: Gene control Control of gene expression is critical in mediating cellular changes: Executing developmental programs Controlling cell cycle Responsiveness to regulators There are many examples of evolutionary variation in promoters and transcriptional regulators
3 Since all cells in an organism have the same DNA, how do the cells become different? (1) Some genes are expressed only in specific tissues (e.g., hemoglobin)
4 Since all cells in an organism have the same DNA, how do the cells become different? (2) Genes expressed in all cells are termed housekeeping genes: cytoskeleton building blocks metabolism histones, polymerases
5 Since all cells in an organism have the same DNA, how do the cells become different? (3) Even housekeeping genes are expressed at different levels -metabolic profiles of red and white muscle
6 Since all cells in an organism have the same DNA, how do the cells become different? (4) Post-transcriptional processes (Fig 7-5) also critical in regulating function: -mrna processing -mrna transport and localization -mrna degradation -translation -post-translational modification -3-dimensional organization -compartmentation -protein degradation
7 Fig 7-5. Gene expression is controlled at many levels
8 Cells can change expression in response to external signals Many cells use hormonal signals to trigger changes in gene expression: e.g., glucocorticoids induce changes in metabolic enzyme expression in liver
9 Cells can change expression in response to external signals Different cells respond differently to the same hormones: e.g., glucocorticoids in liver: induction of genes that enhance conversion of amino acids to glucose. -in adipocytes, glucocorticoids repress the same gene
10 Transcriptional control Genes are regulated by promoters (regions upstream of coding region) Genes can also be regulated at sites that are distant from promoters (even in introns)
11 Gene regulatory proteins Regulatory regions of DNA have short sequences (elements) that bind specific gene regulatory proteins e.g., Sp1 binds GGGCGG CCCGCC These proteins recognize subtle differences in the structure of the outside of the major groove of the DNA double helix
12 Gene regulatory proteins Each protein differs in how it binds DNA and how it interacts with other proteins Several common DNA binding motifs including:
13
14 -helix-turn-helix motif (Fig 7-14), include homeodomain proteins
15
16 -zinc finger proteins (Figs )
17
18
19
20 -leucine zippers (Fig. 7-21)
21 -helix-loop-helix (HLH) (Fig 7-25)
22 Gene regulatory proteins DNA binding ability of gene regulatory proteins can be influenced by: -localization -dimerization (homodimers vs heterodimers)
23
24
25 Tryptophan repressor is a simple model of ligand-dependent gene regulation (Fig-7-34, 7-35) Repressor protein can bind DNA and trp If trp absent, repressor cannot bind DNA (unrepressed) When trp available, repressor binds and prevents RNA Pol from binding gene
26
27
28
29
30 Eukaryotic gene expression What regulates transcription (Fig 7-41) Promoter: binding site for RNA Pol II and general transcription factors Other regulatory sequences can be far away (even 50,000 bp) Activators (or enhancers) bind to specific DNA sequences (modify local DNA structure)
31 Eukaryotic gene expression
32 Gene activators Activators can work synergistically (Fig 7-47) Order of binding of activators and combination of activators influences transcription (Fig 7-48)
33
34
35 Gene repressors Repressors can work many different ways (Fig 7-49) -competition with activators for sites -masking activation site on activator -disruption of general transcription factors -affecting chromatin remodelling
36
37
38 Co-activators and co-repressors These proteins do not bind DNA but bind DNAbinding proteins (Fig 7-50)
39 Myogenesis: an example of programmed transcriptional regulation (Fig 7-72) Precursor cells are myoblasts Hormonal conditions cause differentiation: turning on suites of muscle-specific genes in the appropriate order Hormones induce expression of myogenic factors (transcription factors)
40 Control of gene expression 1. Localization of transcription factors Hormone kinase kinase X
41 Control of gene expression 2. Dimerization Hormone kinase kinase
42 Control of gene expression 3. Affinity for DNA (phosphorylation dependent) Hormone kinase kinase
43 Control of gene expression 4. Affinity for DNA (ligand dependent) Hormone
44 Control of gene expression 5. Affinity for DNA (ligand dependent) Hormone
Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators
Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators At least 5 potential gene expression control points Superfamily of Gene Regulators Activation of gene structure Initiation
More informationCELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
More informationRegulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
More informationDifferential Gene Expression
Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationGene Expression. Lesson 6
Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life
More informationTranscription factors
Atlas of Genetics and Cytogenetics in Oncology and Haematology Transcription factors I Introduction * II Initiation of transcription III Transcription factors family pdf version I Introduction III.1 Helix-Turn-Helix
More informationControl of Gene Expression
Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationComplex Transcription Machinery
Complex Transcription Machinery Subunits of the Basal Txn Apparatus Stepwise Assembly of the Pre-initiation Complex Interplay of Activators, Co-regulators and RNA Polymerase at the Promoter Divide and
More informationDNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
More informationEnhancers. Activators and repressors of transcription
Enhancers Can be >50 kb away from the gene they regulate. Can be upstream from a promoter, downstream from a promoter, within an intron, or even downstream of the final exon of a gene. Are often cell type
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationChapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
More informationSynthetic cells: do bacteria need all its genes? No.
NO NEED TO REFER TO THE SLIDES. بسم هللا الرحمن الرحيم Do we need all the non coding regions of the DNA? Two weeks ago, they discovered that the genome of a plant is very small (recall that plant genome
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More information17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationGene regulation V Biochemistry 302. March 6, 2006
Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain
More informationGENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna
GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationGENE REGULATION IN PROKARYOTES
GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationEukaryotic transcription (II)
Eukaryotic transcription (II) Transcription factors Prokaryote: Sigma factors they are similar to general transcription factor of eukaryotes, they help bring RNA pol to the promoter Transcription factors
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More information32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes
3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More information- all cells express large number of the same genes - housekeeping or common genes - many cells also express cell-type-specific genes
Developmental Biology - Biology 4361 Lecture 8 - Differential Gene Expression October 13, 2005 The principle of genomic equivalence states that all cells in a developing organism have the same genetic
More informationLecture 9 Controlling gene expression
Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around
More informationChapter 18: Regulation of Gene Expression
Chapter 18: Regulation of Gene Expression Regulation of Metabolism Shuts off transcription Types of Feedback Negative feedback = body s response is to reduce the stimulus Ex: regulation of body temp, blood
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGene Regulation in Eukaryotes
Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationGENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationGene Expression and Regulation - 1
Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission
More informationChapter 13 - Regulation of Gene Expression
Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene
More informationQuick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer
More informationChapter 18. Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 2007-2008 Control of Prokaryotic (Bacterial) Genes 2007- Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationBCH 4054 Fall 2000 Chapter 31 Lecture Notes
BCH 4054 Fall 2000 Chapter 31 Lecture Notes 1 Chapter 31 Transcription and Regulation of Gene Expression 2 Messenger RNA Central Dogma (Francis Crick, 1958) DNA RNA Protein (Fig 31.1) Jacob-Monod Hypothesis:
More informationNucleic Acids and the Encoding of Biological Information. Chapter 3
Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic
More informationThe Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression
The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression What Are the Characteristics of the Eukaryotic Genome? Key differences between eukaryotic and prokaryotic
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationChapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationDifferences between prokaryotes & eukaryotes. Gene function
GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences
More informationEukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore
Eukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore Lecture No. # 06 Eukaryotic Transcription Factors: Transcription Activation Domains In
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More information(c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/ :57 PM
C2006/F2402 '14 OUTLINE OF LECTURE #11 (c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/2014 12:57 PM Handouts: 10C -- Typical Eukaryotic Gene,
More informationDNA & DNA : Protein Interactions BIBC 100
DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL
More informationChapter 24: Promoters and Enhancers
Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription
More informationGene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
More informationChapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS
Chapter 19 Genetic Regulation of the Eukaryotic Genome A. Bergeron AP Biology PCHS 2 Do Now - Eukaryotic Transcription Regulation The diagram below shows five genes (with their enhancers) from the genome
More informationUNIT 2 HUMAN BIOLOGY NOTES
DNA, genes and chromosomes CHAPTER 13 DNA THE CODE FOR LIFE - DNA is short for deoxyribonucleic acid found in cells of organisms. The DNA is embedded within the nucleus of a cell. - DNA is a long stranded
More informationControl of Gene Expression
Control of Gene Expression Different cell types of a organism contain the same DNA but the DNA is expressed differently. External signals can cause a cell to change the expression of its genes. DNA elements
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationMolecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes
Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription: Sending the
More informationPART FOUR - ANSWERS PART FOUR: GENE REGULATION ANSWERS. Answers to questions from Chapter 15 on Positive and negative control of the lac operon
PART FOUR: GENE REGULATION ANSWERS Answers to questions from Chapter 15 on Positive and negative control of the lac operon 15.1 laci, lacz, lacy, laca 15.2 The lac operon is negatively regulated by a repressor,
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More informationName. Student ID. Midterm 2, Biology 2020, Kropf 2004
Midterm 2, Biology 2020, Kropf 2004 1 1. RNA vs DNA (5 pts) The table below compares DNA and RNA. Fill in the open boxes, being complete and specific Compare: DNA RNA Pyrimidines C,T C,U Purines 3-D structure
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationChem 465 Biochem II Test 3
Chem 465 Biochem II Test 3 Name: Multiple choice 4 points each. 1. Which of the following are features of the wobble hypothesis? A) A trna can recognize only one codon. B) Some trnas can recognize codons
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationContact information Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone:
Contact information Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone: 453-6437 Email: bbartholomew@siumed.edu Class notes http://www.siumed.edu/~bbartholomew/hbtxn.html Other references Principles
More informationI. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:
I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural
More informationBS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt
BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationSpring 2006 Biochemistry 302 Exam 2
Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationTranscription factors
Transcription factors R. de Martin Department of Vascular Biology and Thrombosis Research Medical University of Vienna K63 A20, TTP, XIAP IκBα K48 IL-6, Il-8, MCP-1, ICAM1, SELE, ciap1/2, A20, IκBα Adapted
More informationUnit 7. Genetic Regulation, Development, and Biotechnology. AP Biology
Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely
More informationPlease sign below if you wish to have your grades posted by the last five digits of your SSN
BIO 226R EXAM II (Sample) PRINT YOUR NAME SSN Please sign below if you wish to have your grades posted by the last five digits of your SSN Signature BIO 226R Exam II has 6 pages, and 27 questions. There
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More information