Name: Date: IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY.

Transcription

1 IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY. 1. What is a mutation? Any change in a DNA sequence 2. Name and describe the two categories types of gene mutations. Point: substitution, one nucleotide is switched Framshift: insertion/deletion, one nucleotide is added or removed. 3. Why are point mutations considered less harmful that frameshift mutations? Point will maybe change one amino acid. Framshift will change every amino acid after the mutation. 4. What happens to the amino acid sequence in additions/insertions and deletions. It is totally messed up 5. Label the diagram with the different types of gene mutations. THE CAT RAN FAR THE CAT RAN FAR THE CAT RAN FAR THE CAA TRA NFA R THE CTT RAN FAR THE CAT ANF AR insertion substitution deletion 6. Label the pictures with the different types of chromosomal mutations. Deletion Duplication Inversion Translocation 7. What are restrictions enzymes and where did they come from? Proteins that cut DNA a specific sequence called restriction sites. They originated in bacteria to protect the cell from viruses.

2 8. Label whether each restriction enzyme will create sticky ends or blunt ends? Sticky Sticky blunt 9. Please identify the recognition sites for the following RE. Put a box around the recognition sites in the DNA sequence and arrows to indicate where the cuts will occur. Restriction enzyme BamHI: ATCGGATCCTGTCGACGCCAATAGCTGTCGACTAGCTCCATTGTCA TAGCCTAGGACAGCTGCGGTTATCGACAGCTGATCGAGGTAACAGT Cannot do on computer. See MS. Pender if you cant figure it out. 10. What are plasmids? Small Circular DNA found in bacteria. Also called vectors. 11. What is recombinant DNA? DNA that contains DNA from two sources Plasmid DNA + Foreign DNA= recombinant DNA 12. Describe the 6 steps to create recombinant DNA. 1. Cut open plasmid and DNA with gene encoding for insulin with same RE 2. Mix cut plasmid with cut DNA (they have the same sticky ends) 3. Seal with ligase 4. Transformation: Insert recombinant DNA into bacteria 5. Recombinant DNA replicates and bacteria divides 6. DNA is transcribed and translated

3 13. What two processes are used in creating GMOs? To create a GMO you need to create a recombinant DNA with the gene you want to add to the organism. Then you need to transform all the cells in the organism to create a transgenic/genetically modified oraganism 14. Explain how is Bt corn is a GMO? Bt corn expresses a foreign gene that is a natural pesticide. 15. What is in-vitro fertilization and why is it used? In-vitro fertilization is a process used to create and embryo outside of the human body. It is used for individuals who cannot successfully reproduce on their own. 16. What are the steps of in-vitro fertilization? Step 1 egg production: female takes daily hormones to encourage healthy egg development. Once egg development has reached optimum levels, the patient is scheduled for egg retrieval Step 2 egg retrieval: Using ultrasound, doctors select the healthiest eggs for retrieval.using a very thin needle, these eggs are removed from the follicles where they are produced Eggs placed in a petri dish inside an incubator which has a similar environment to the human body and will keep the eggs healthy and alive. Step 3 sperm retrieval and fertilization: A sperm sample is gathered from the male and examined under a microscope for health. If sample is healthy: 50, ,000 are added to the petri dish to fertilize the harvested eggs. If the sample lacks enough healthy sperm: doctors select healthiest and inject them directly into the harvested eggs. Step 4 checking fertilization and development: Fertilized eggs are examined after hours to check progress. Healthy embryos continue to grow in the incubator for another 3-6 days Step 5 implantation: the healthiest embryos are implanted using a catheter (a narrow, hollow tube) that is inserted through the cervix 17. What is sex selection/pre-implantation genetic diagnosis? Why is it used? Sex Selection: Embryo can be tested to see if it is male or female. Parents will sometimes choose to only implant embryos of a particular sex Pre-implantation Genetic Diagnosis (PGD): In some cases, a complete genetic analysis is conducted before embryos are implanted in the uterus. This could be due to medical conditions of the mother, family history of genetic diseases, or simply the wishes of the parents

4 18. What is the process of PGD? Step 1. Undergo normal IVF treatment to collect and fertilize your eggs. Step 2. Embryo is grown in the lab for two - three days until the cells have divided and consists of around eight cells. Step 3. A trained embryologist removes one or two of the cells from the embryo. Step 4. The cells are tested to see if the embryo contains the gene that causes the genetic condition in the family. Polar bodies present in female embryos so they can be selected for Analyze DNA sequence in sections of DNA that code for conditions in a single gene Other technologies allow for detection of extra or missing chromosomes Step 5. Embryos unaffected by the condition are transferred to the womb to allow them to develop. 19. What is the process of reproductive cloning? a. Donor egg cell is enucleated (nucleus removed) b. Somatic cell of to be cloned individual is gather, and nucleus is extracted c. Somatic cell nuclear transfer (nucleus of somatic cell put into egg) d. Zygote becomes a blastocyst, and then an embryo e. Embryo is implanted f. Clone is born 20. What is formed in reproductive cloning? An infant organism with a genetically identical genome 21. What is formed in therapeutic cloning? Cells/tissues/organs that are genetically identical to the donor of the somatic cell 22. What processes are used for DNA fingerprinting? To create a DNA fingerprint you must cut an individuals DNA with restriction enzymes and then run gel electrophoresis 23. What is gel electrophoresis and why is it used? Used to create DNA fingerprints

5 24. Why are restriction enzymes important in gel electrophoresis/dna fingerprinting? You cannot run a gel electrophoresis to see different lengths of the fragments of a persons DNA without cutting it with restriction enzymes first. 25. What are embryonic stem cells, where are they found and what are their potential? Embryonic stem (ES) cells are formed as a normal part of embryonic development. They can be isolated from an early embryo and grown in a dish. ES cells have the potential to become any type of cell in the body, making them a promising source of cells for treating many diseases. 26. What are somatic stem cells, where are they found and what are their potential? Somatic stem cells (also called adult stem cells) exist naturally in the body. They are important for growth, healing, and replacing cells that are lost through daily wear and tear. Under natural circumstances somatic stem cells can become only a subset of related cell types. 27. What are somatic stem cells, where are they found and what are their potential? Induced pluripotent stem (ips) cells are created artificially in the lab by "reprogramming" a patient's own cells. ips cells can be made from readily available cells including fat, skin, and fibroblasts (cells that produce connective tissue). Mouse ips cells can become any cell in the body (or even a whole mouse). Although more analysis is needed, the same appears to be true for human ips cells, making them a promising source of cells for treating many diseases. Importantly, since ips cells can be made from a patient's own cells, there is no danger that their immune system will reject them.