# Date Title Page # 1. 01/20/15 Chapter 11: Genetics /09/15 Chapter 14: Human Genetics /05/15 Chapter 12: DNA and RNA 49

Transcription

1 Table of Contents # Date Title Page # 1. 01/20/15 Chapter 11: Genetics /09/15 Chapter 14: Human Genetics /05/15 Chapter 12: DNA and RNA 49 i 1

2 03/06/14 Ch. 12: DNA 49 Objective: Students will be able to describe structural characteristics of DNA and how these characteristics were discovered. Discovering DNA Griffith (1928) * Griffith concluded-there is some "factor that stays "alive!" -Transformation? Avery (1944) Avery concluded Nucleic Acid is the molecule of heredity. Hershey & Chase (1952) phosphorus (DNA) sulfur (protein coat) bacterium *Hershey and Chase concluded, Yes, Griffith was right, the molecule of heredity is DNA. Franklin (1952) Chargaff Watson and Crick (1953) 2

3 03/08/14 Ch 12: DNA and RNA 15 (Place in, back, Lab Side of Notebook) DNA Isolation 3

4 03/09/15 Ch. 12: DNA 40 Objective: Students will be able to identify the molecule of heredity. FQ Can DNA be isolated from cheek cells? Steps? Observe Explain 4

5 03/10/15 Ch. 12: DNA 52 Objective: Students will be able to model DNA structure and recognize the monomers that make up DNA. Deoxyribonucleic Acid (DNA) Structure Nucleic Acid Double Helix Twisted ladder Backbone Phosphate and sugar (deoxyribose) Rungs Made up of 4 different bases T= Thymine--1 ring A= Adenine--2 rings C= Cytosine--1 ring G= Guanine--2 rings 3 Rules DNA follows: 1. 1 ring always hooks to a 2 ring 2. A always binds to T and C always binds to G (Chargaff's Rule) 3. The "sides" of the ladder go in opposite directions=antiparallel 5

6 03/11/15 Ch 12: DNA 53 DNA Structure (Class Notes, continued) Modeling DNA 1 monomer of a nucleic acid like DNA is a nucleotide. 1 nucleotide consists of a sugar, phosphate, and a base and hooks to another nucleotide via covalent bonds. 1 purine always binds to 1 pyrimidine through complementary base pairing via hydrogen bonds. Parts Phosphate (black) Deoxyribose (red "house") Cytosine (blue pyrimidine) Guanine (yellow purine) Thymine (green pyrimidine) Adenine (orange purine) Hydrogen bond (black lines ) 6

7 03/11/15 Ch 12: DNA 53 Parts Phosphate (white) Deoxyribose (black "house") Cytosine (blue tube) Guanine (yellow tube) Thymine (green tube) Adenine (orange tube) Hydrogen bond (white rod) Directions: 1. Build nucleotides: 3 nucleotides using Cytosine (blue) 3 nucleotides using Guanine ( yellow) 4 nucleotide using Thymine ( green) 4 nucleotide using Adenine ( orange) 2. Use complementary base pairing to build 7 "rungs" of a DNA ladder. 3. Attach the rungs to form a ladder. 4. Draw the ladder in your notebook. Steps DNA Replication Read and Take Notes Chapter 12, Section 2--Descriptive Outline or SpiderMap 7

8 8

9 03/16/15 Ch. 12: DNA 52 Objective: Students will be able to model DNA replication and explain the process. Chromosomes Chromatin Chromosomes Distinguish between the following: Chromosome Nucleosome Coils Supercoils Histones DNA DNA Replication Prokaryotes Eukaryotes Analyzing Data p. 296 Section Assessment Questions p

10 03/18/15 Ch Objective: Students will be able to differentiate between DNA and RNA and model transcription and translation in order to explain how proteins are made. Central Dogma of Biology DNA RNA PROTEIN 10

11 Differences between DNA and RNA Made up of DNA RNA sugars Bases Location Types Structure Roles Size 11

12 Differences between DNA and RNA 59 Made up of DNA RNA sugars Bases Location Types Structure Roles Size 12

13 04/24/14 Ch 12: RNA 50 Objective: Students will be able to explain how RNA is made from a DNA molecule. Transcription the process of making an RNA molecule from a DNA molecule using the template strand of DNA. ABC DVD--Transcription 13

14 14

15 04/24/14 Ch. 13: RNA 33 Objective: Students will be able to explain how RNA is made from a DNA molecule. Template Complementary DNA Messenger RNA (mrna TTACGG AATGCC AAUGCC CCGCCG GGCGGC GGCGGC ACGUAG AGACTC GATAAG CUGGCUACA 15

16 03/23/15 Ch Translation: Process of making a protein from the mrna molecule. (Insert Color Sheet) Modeling--Steps: 16

17 04/05/13 Ch. 13: RNA 66 Objective: Students will be able to explain how protein is made from mrna. Translation: Process of making a protein from the mrna molecule. Terms: 17

18 elongation Questions

19 Example: Template DNA: AGTTTCAAGTTTAGGCGCAGTGTTCCATTTCGCAT mrna: Protein: 19

20 Example: Template DNA: AGTTTCAAGTTTAGGCGCAGTGTTCCATTTCGCAT mrna: Protein: 20

21 03/25/15 Ch. 12: DNA and RNA 77 Objective: Students will be able to describe the effect of mutations on translation. When Things Go Wrong DNA RNA PROTEIN Mutations: Changes in DNA 21

22 03/24/15 Ch Objective: Students will be able to explain how a cell "knows" when to start or stop making a protein. Genes are "Expressed" when they are transcribed and translated into protein. Only some genes are expressed: EXONS v. INTRONS mrna For Example: TAC AAA TAT CGC GGG CCC AAA ACT INTRONS EXONS This is RNA editing This mrna will go to the ribosome to make the protein. Cells can turn their genes on or off. Operons can do this in prokaryotes, they act as negative feedback mechanisms. In Eukaryotes, the genes are controlled individually--but still can be turned on or or off. Negative v. Positive Feedback Mechanism brain tells you you are thirsty use water go hiking sit around Normal Drink water drink a lot You urinate brain tells your kidney to get rid of excess water Operons are an example of a NEGATIVE FEEDBACK MECHANISM 22

23 03/27/15 Ch Objective: Students will be able to explain how a cell "knows" when to start or stop making a protein. Prokaryotes RNA Polymerase Lactose Repressor DNA Lac genes Promoter Operators Transcription lac operon Eukaryotes RNA Polymerase TATA Box Introns DNA Promoter Sequences Transcription Exons Development and Differentiation Hox genes: Master control genes 23

24 03/27/15 Ch Objective: Students will be able to explain how a cell "knows" when to Lactose start or stop making a protein. Repressor Prokaryotes RNA Polymerase Lac genes DNA Promoter Operators Transcription lac operon Eukaryotes RNA Polymerase TATA Box Introns DNA Promoter Sequences Transcription Exons Development and Differentiation Hox genes: Master control genes 24

25 Receptors Skin Control Center Brain sends message to sweat glands and capillaries Effectors Sweat Glands produce sweat Capillaries dilate: blood goes to surface Stimulus Body Temperature Raises Response Body Temperature Lowers High Normal Low Body Temperature Lowers Stimulus Body Temperature Raises Response Skin Receptors Sweat Glands inactive Capillaries constrict: blood goes to core muscles contract: shivering Effectors Control Center Brain sends message to sweat glands and capillaries and muscles 25