Supplementary Methods. Bacterial strains and plasmids. Transconjugants 4-3, 7-24, 10-2, 10-5, 12-5, 29-11, and

Transcription

1 Supplementary Methods Bacterial strains and plasmids. Transconjugants 4-3, 7-24, 10-2, 10-5, 12-5, 29-11, and all contained single plasmids from clinical isolates of Escherichia coli collected at a hospital in Shanghai, People s Republic of China and 10-5 contained distinct plasmids from the same isolate; all others were derived from different isolates 1. Azide-or rifampin-resistant E. coli J53 were the recipients for conjugation. Plasmids phsh10-2 and phsh10-5 were contained in transconjugants 10-2 and 10-5, respectively. E. coli V517 2 and E. coli J53 containing plasmid R1 3 were used as standards for plasmid size. E. coli DH10B was used as a recipient for transformation in knockout and cloning experiments. Strains were routinely grown at 37 C in Luria-Bertani (LB) medium except as noted otherwise. Stock cultures were stored at -80 C in 10% glycerol brain heart infusion broth. Conjugation. To determine whether the difference in ciprofloxacin minimum inhibitory concentration (MIC) between transconjugants 10-2 and 10-5 owed to genetic elements contained on their plasmids, outcrossing of the plasmids was performed, with rifampinresistant E. coli J53 as recipient. Cultures of donor and recipient cells in logarithmic phase (0.5 ml of each) were added to 4 ml of fresh LB broth and incubated overnight without shaking. Transconjugants were selected on Trypticase soy agar (TSA) plates containing rifampin (200 µg/ml; Sigma Chemical Co., St. Louis, Mo.) for counterselection and ampicillin (100 µg/ml), sulfamethoxazole (300 µg/ml), or tetracycline (20 µg/ml) to select for plasmid-encoded resistance. MICs of ciprofloxacin of donor and recipient strains were compared by disk diffusion according to NCCLS guidelines 4. 1

2 Estimation of plasmid size. Plasmid DNA was isolated withthe QIAGEN plasmid midi kit (QIAGEN, Valencia, Calif.). Isolated plasmid DNA from transconjugants 10-2 and 10-5, as well as reference strains, was subjected to electrophoresis on 0.6% Megabase Agarose (Bio-Rad Laboratory, Hercules, Calif.) gel without ethidium bromide. The reference plasmid DNAs were the several plasmids in E. coli V517 (sizes, 54, 5.6, 5.1, 3.9, 3.0, 2.7, and 2.1 kb) and R1 (92 kb). The migration distances of DNA bands were measured directly from photographs of the gels obtained following staining with ethidium bromide. Sizes of phsh10-2 and phsh10-5 were approximated by comparison of their migration distance to that of the reference plasmids. MIC determination. All susceptibility determinations for which quantitative data were required were carried out by agar dilution or broth microdilution and interpreted according to CLSI guidelines 5. For most experiments, MIC testing was additionally carried out by ciprofloxacin Etesting (AB biodisk, Solna, Sweden). Southern Hybridization. Plasmids phsh10-2 and phsh10-5 were screened for the qnra gene by Southern hybridization, which was carried out with the ECL direct nucleic acid labeling and detection system (Amersham Biosciences (GE Healthcare), Piscataway, N.J.) in accordance with the manufacturer's recommendations. The plasmids were subjected to electrophoresis in 0.6% Certified Megabase Agarose gel without ethidium bromide at 70 V for 3.5 h. After depurination, denaturation, and neutralization of the gel, DNAs were transferred to a Hybond-N + membrane (Amersham Biosciences (GE Healthcare), Piscataway, N.J.) by capillary blotting overnight. The membrane, which was fixed by UV exposure, was hybridized with the horseradish peroxidase-labeled qnra probe, and then the signals were detected by exposure of the membrane to Hyperfilm ECL film (Amersham 2

3 Biosciences (GE Healthcare), Piscataway, N.J.) The qnra probe was made from plasmid phsh10-5 by PCR amplification with primers 5'-TCAGCAAGAGGATTTCTCAand 5'-GGCAGCACTATTACTCCCA. Northern Hybridization. Total cellular RNA was extracted from transconjugants 10-2 and 10-5 with the Invitrogen (Carlsbad, CA) S.N.A.P. Total RNA isolation kit. RNA concentrations were measured spectrophotometrically, and equal amounts of RNA were separated on 1% agarose gels containing formaldehyde. A vacuum manifold was used to transfer RNA from gels onto a Hybond-N + membrane (Amersham Biosciences (GE Healthcare), Piscataway, N.J.), and RNA was crosslinked with ultraviolet light. Probe hybridization was carried out with the Ambion (Austin, TX) NorthernMax kit according to the manufacturer s protocol. The qnra DNA probe, amplified from phsh10-5 as above, was labeled with Ambion s BrightStar Psoralen-Biotin kit and used to hybridize the RNA fixed to the nylon membrane. Probe was detected by Hyperfilm ECL film (Amersham Biosciences (GE Healthcare), Piscataway, N.J.) using a chemiluminescence technique (Ambion BioDetect kit.) Cloning. aac(6`)-ib-cr was cloned into three plasmids. pbc SK(+) (Stratgene, La Jolla, CA), was used for initial cloning, for complementation, and for Mutant Prevention Concentration testing. pgem-3zf(+) (Promega, Madison, WI) was used for the acetylation assay since pbc SK carries a chloramphenicol acetyltransferase which interfered with the assay. pbad-24 (Invitrogen, Carlsbad, CA), an expression vector, was used for the site-directed mutagenesis experiment to provide transcripts containing only the aac(6`)-ib-cr gene. 3

4 For pbc SK: The aac(6`)-ib-cr gene was amplified using primers 5`- ATATGCGGATCCAAAAACAAAGTTAGGCATCACAAAG and 5`- ATATGCGAATTCCTTCAGTTCCTTCAAATAATGGAGA. The DNA segment was ligated into vector pbc SK after digestion with EcoRI and BamHI. For pgem-3zf: The aac(6`)-ib-cr gene was amplified using primers 5`- ATATGCGGATCCAATGAGCAACGCAAAAACAAAGTTAG and 5`- ATATGCGAATTCTTAGGCATCACTGCGTGTTCGCTC. The DNA segment was ligated into vector pgem-3zf after digestion with EcoRI and BamHI. For pbad-24: The aac(6`)-ib-cr gene was amplified using primers 5`- ATATGCGAATTCACCATGAGCAACGCAAAAACAAAGTTAG and 5`- ATATGCAAGCTTTTAGGCATCACTGCGTGTTCGCTC. The DNA segment was ligated into vector pbad-24 after digestion with EcoRI and HindIII. Expression was induced by the inclusion of 0.1% arabinose in all media used for growing pbad-24- transformed E. coli DH10B. Complementation. E. coli DH10B containing phsh10-2 with a knockout transposon inserted into aac(6`)-ib-cr was transformed with pbc SK- aac(6`)-ib-cr by electroporation. Colonies were selected on TSA containing 40 µg/ml of kanamycin, 20 µg/ml of tetracycline and 30 µg/ml of chloramphenicol. Ciprofloxacin MICs of E. coli DH10B alone, with each plasmid, and with both plasmids, were measured by Etest and broth microdilution as above. 4

5 Site-directed mutagenesis. To determine the effect of mutations W102R and D179Y on ciprofloxacin resistance phenotype, four possible combinations of these amino acids were designated according to Table 1. For the cloning of aac0 and aac1, the coding region was amplified from transconjugant 4-3 (which carried the canonical gene) and transconjugant 10-2 (which carried aac(6`)-ib-cr), respectively. This was accomplished with the upstream and downstream primers, AAC5F and AAC6R [Table 2]. These primers contain, respectively, engineered EcoRI and HindIII sites. For the cloning of a canonical aac(6 )-Ib with a D179Y mutation, a fragment of the gene was amplified from aac0 with the forward primer AAC6G535T containing KpnI site at position 517 and 521, and an engineered t corresponding to position 535 of the gene, and downstream primers AAC6R. This was recloned into aac0, generating aac3. For the cloning of a canonical aac(6 )Ib with a W102R mutation, the same method was used, except that the template was aac1, and the forward primer was AAC6T535G, generating aac2. Plasmid pbad-24 was used as the vector for all components of this procedure. Reverse Phase High Performance Liquid Chromatography (RP-HPLC). RP-HPLC analysis of reaction products from cell extracts was conducted on an Agilent 1100 liquid chromatograph equipped with an Agilent Zorbax SB-C m column (150 mm X 4.6 mm) with guard cartridge and a UV photodiode array detector. Relative peak areas were compared at a wavelength of 280 nm. Solvent A consisted of water / 0.1% trifluoroacetic acid and solvent B consisted of acetonitrile / 0.1% trifluoroacetic acid. Solvent B was initially 15%. It was increased in an 8-minute linear gradient to 60%, followed by a 1- minute linear gradient to 70%, and finally a 1-minute linear gradient to 90%. The flow rate was 1.0 ml/min. 5

6 Reverse Phase High Performance Liquid Chromatography / Mass Spectrometry (LC/MS). LC/MS analysis was conducted on an Agilent 1100 liquid chromatograph equipped with an Agilent Zorbax SB-C18 5 m column (50 mm X 2.1 mm), a UV photodiode array detector, and an Agilent LC/MSD SL single quadrupole analyzer operating in electrospray ionization mode. Two separation methods were employed for analysis of reaction products and for spiking experiments with synthetic N- acetylciprofloxacin. Method 1: solvent A consisted of water / 0.05% trifluoroacetic acid and solvent B consisted of acetonitrile / 0.05% trifluoroacetic acid. Solvent B was initially 15%. It was increased in a 2.5-minute linear gradient to 60%, followed by a 0.35-minute linear gradient to 70%, and a 0.35-minute linear gradient to 90%, at which point it was held for 2.8 minutes. The flow rate was 200 l/min. The photodiode array detector monitored at 280 nm. Method 2: solvent A consisted of water / 0.05% trifluoroacetic acid and solvent B consisted of acetonitrile / 0.05% trifluoroacetic acid. Solvent B was initially 10%. It was increased in a 3.5-minute linear gradient to 100%, at which point it was held for 2.5 minutes. The flow rate was 0.75 ml/min. The photodiode array detector monitored at 254 and 214 nm. N-Acetylciprofloxacin Synthesis. N-Acetylciprofloxacin was prepared as described in US 4,559,341. Following recrystallization from 2-methoxyethanol, residual solvent was removed by suspending the solid in acetone, evaporating the solvent in vacuo, and drying the resulting solid under vacuum. MS (ES): m/z [M+H] H NMR (300 MHz, d 6 - DMSO): δ 8.67 (s, 1H), 7.91 (d, J = 13.5 Hz, 1H), 7.58 (d, J = 7.7 Hz, 1H), 3.81 (m, 1H), 3.67 (m, 4H), 3.34 (m, 2H), 3.29 (m, 2H), 2.08 (s, 3H), 1.31 (m, 2H), 1.19 (m, 2H). 6