Supplementary table captions

Transcription

1 Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 06 Table S Strains and plasmids used in the present study Supplementary table captions Table S Primers used in gene cloning, plasmid construction and quantitative RT-qPCR analysis

2 Table S Strain/plasmid Strain Description Source/Reference Trans-T F-φ80(lacZ) M5 lacx74hsdr(r k-, m k+ ) reca398endatona TransGen, Beijing, China Transetta (DE3) F - ompthsds B (r B- m B- )gal dcm lacy(de3)prare(argu, argw,ilex,glyt,leuw,prol))cam r ) TransGen, Beijing, China BL(DE3) F - ompt hsds(r B- m B- ) gal dcm(de3) TransGen, Beijing, China Plasmid peasy TM -Blunt General cloning vector, T7 promoter, f ori, Amp and Kan TransGen, Beijing, China pet-8a(+) General expression vector, T7 promoter, f ori, Kan Novagen, Madison, USA pgro7 A molecular chaperone plasmid expressing GroES-GroEL, arab promoter, Cm r Takara, Dalian, China pkje7 A molecular chaperone plasmid expressing DnaK-DnaJ-GrpE, arab promoter, Cm r Takara, Dalian, China peasy-ocuge peasy TM -Blunt derived vector containing OcUGE gene This study peasy-ocuge peasy TM -Blunt derived vector containing OcUGE gene This study peasy-ocuxe peasy TM -Blunt derived vector containing OcUXE gene This study peasy-ocuxe peasy TM -Blunt derived vector containing OcUXE gene This study pet8a-ocuge pet-8a (+) derived vector containing OcUGE gene This study pet8a-ocuge pet-8a (+) derived vector containing OcUGE gene This study pet8a-ocuxe pet-8a (+) derived vector containing OcUXE gene This study pet8a-ocuxe pet-8a (+) derived vector containing OcUXE gene This study pet8a-tocuxe pet-8a (+) derived vector containing truncated OcUXE gene This study pet8a-tocuxe pet-8a (+) derived vector containing truncated OcUXE gene This study

3 Table S Primers Sequences(5'-3') Description FUXE- AGCAAGAAATCACCACTCTC Forward primer used for OcUXE amplification in the first round RUXE- ATATGTGTCTAGACATTATGAT Reverse primer used for OcUXE amplification in the first round FUXE- ATGCTACCTAGTAGGGCGAG Forward primer used for OcUXE amplification in the second round RUXE- TCAGGGAGCCGAAGCTAAAC Reverse primer used for OcUXE amplification in the second round FUXE- ATGAAGGGGCTCTCTCAG Forward primer used for OcUXE amplification in the first round RUXE- TTCTGAACTAATGATGCAGT Reverse primer used for OcUXE amplification in the first round FUXE- ATGCCCCCAGTCAGCAGGAC Forward primer used for OcUXE amplification in the second round RUXE- TCAAAATGCCATGGCCAACG Reverse primer used for OcUXE amplification in the second round FUGE- AAACCCTCATTTAGTCTCATCTTCTTGA Forward primer used for OcUGE amplification in the first round RUGE- CGTCTTTTCCGTTTCCTTATTCTTT Reverse primer used for OcUGE amplification in the first round FUGE- ATGGGATCGGAGTGTAAGACGGAGA Forward primer used for OcUGE amplification in the second round RUGE- TCAAGCCTTTGGCCTGTAACCGTACTGATT Reverse primer used for OcUGE amplification in the second round FUGE- TCTCGCTCTTGATTCTTGATTTCG Forward primer used for OcUGE amplification in the first round RUGE- TGGTTTGGGTTCCTCCTTTAAGT Reverse primer used for OcUGE amplification in the first round FUGE- ATGGCGGGTTTGAACATCATGGTGA Forward primer used for OcUGE amplification in the second round RUGE- CTAATTATTCACTAGTATTTTAGCTTCC Reverse primer used for OcUGE amplification in the second round F8aUXE CGCGGATCCGAATTCATGGGATCGGAGTGTA Forward primer used for pet8a-ocuxe construction R8aUXE CGCGGATCCGAATTCATGGCGGGTTTGAACA Reverse primer used for pet8a-ocuxe construction F8aUXE TGCGGCCGCAAGCTTCTAATTATTCACTAGT Forward primer used for pet8a-ocuxe construction R8aUXE GTGCGGCCGCAAGCTTCTATTTCTCCCCGTTCAG GAT Reverse primer used for pet8a-ocuxe construction

4 F8aUGE R8aUGE F8aUGE R8aUGE FRTUXE RRTUXE FRTUXE RRTUXE FRTUGE RRTUGE FRTUGE RRTUGE CGCGGATCCGAATTCATGGGATCGGAGTGTA TGCGGCCGCAAGCTTTCAAGCCTTTGGCCTG CGCGGATCCGAATTCATGGCGGGTTTGAACA TGCGGCCGCAAGCTTCTAATTATTCACTAGT GTTCGTCCATGCTGACATTG CATCGGCCTGCATCAATTA GATCAACCGCGAATTGAACT TAATGCAGGAGACCCTCCAC AAGAACTTGGCTGGAAAGCA TGGGCCTTTTATCCCACATA CTTCGAGGATGACCCATGAT AATTTCCTCCTTGGGTTTGG Forward primer used for pet8a-ocuge construction Reverse primer used for pet8a-ocuge construction Forward primer used for pet8a-ocuge construction Reverse primer used for pet8a-ocuge construction Forward primer used for OcUXE RT-qPCR Reverse primer used for OcUXE RT-qPCR Forward primer used for OcUXE RT-qPCR Reverse primer used for OcUXE RT-qPCR Forward primer used for OcUGE RT-qPCR Reverse primer used for OcUGE RT-qPCR Forward primer used for OcUGE RT-qPCR Reverse primer used for OcUGE RT-qPCR

5 Supplementary figure legend Figure S. SDS-PAGE analysis of crude extracts from E. coli co-expressing both pet8atocuxe and pgro (), and pet8atocuxe and pkje7 (). Control, cell extracts of the empty vector without expressed molecular chaperones. Arrows refer to the expressed tocuxe and tocuxe proteins; * stands for the expressed molecular chaperones; Protein molecular mass standards (M, in kda) are indicated on the right.

6 Fig. S