Clonal variability of expression

Transcription

1 Identification of human S/MAR elements to improve gene expression and regulation University of Lausanne CHO genome engineering to decrease transcription and secretion bottlenecks Nic Mermod ELRIG meeting, Manchester, November 3 Clonal variability of expression More reliable expression with MAR elements Transgene + Vector elements MAR GFP expression, no MAR E/P GFP GFP expression + MAR Cell counts 56 transfection No MAR transfections With MAR 3 GFP fluorescence (polyclonal populations) 5 RNA POLII Integration-linked effects (e.g. transgene copy number) Position effects (e.g. chromatin-linked silencing) Clone / protein effects (e.g. clonal fitness) Normalized occurrence 4 3 H3K4me3 (active) H3K7me3 H3K36me3 (transcribed) -kb 6 MARs, ChIP-Seq +kb Girod et al., Nat Meth (7); Galbete et al., Molec Biosyst (9); Grandjean et al., NAR (); Majocchi et al., NAR (3); Arope et al., PLOS One (3), in press

2 Recombination involved in iterative MAR transfection? Total transfected CHO cell pool GFP fluorescence (fold increase) One transfection x GFP x MAR-GFP GFP expression x GFP x MAR-GFP Transgene copy number x GFP x MAR-GFP Transgene copy number (fold increase) GFP fluorescence (fold increase) 4 3 Two transfections x GFP x MAR-GFP x GFP No stable cells x MAR-GFP 7. x GFP x MAR-GFP Transgene copy number (fold increase) wild-type CHO CHO recombination mutant CHO end-joining mutant Improving integration Grandjean et al., NAR () CHO-M Genome Sequence and Omics approach 3 Gb of raw CHO-M genome sequence assembled (N5 > 5 kb) Genome of 6 therapeutic-producing clones sequenced (8X) Ongoing CHO Ome engineering (transient & stable) Gene anotation and transcriptome analysis mrna sequence and level for 6 89 CHO-M genes genes essentially silent in CHO-M cells 98% of CDS common to CHO-M and K CHO-M genome and transcriptome

3 CHO-M genome sequencing and engineering. For producer clone characterization. To understand and improve transgene integration 3. For CHO secretion and metabolic pathways stable engineering CHO Clones Generation and Sequencing IgG LC or HC MAR vector PvuI Selection Two electroporation cycles Clone selection, genome sequencing? Direct or inverted repeats With or without vector fragments One/several genomic integration loci Characterizing transgene integration

4 Transgene Analysis by Deep Sequencing (simplified) paired-end, short DNA fragments Mate pair, long fragments Can we detect transgene mutations? CMV enhancer Test for other / larger variations No insertion/deletion detected hygromycin resistance gene Only expected sequence changes detected (already present in vector)

5 Can we detect transgene mutations? Potential mutations detected analyze further by PCR, or take another clone Transgene-Genome Fusions Sequencing Mixed plasmid vectors in various orientations and orders Portion of CHO chromosome scaffold with inserted transgenes Genomic (PE) short fragments (-6 bp) R (+/- strand) Possibly deleted portion of scaffold R R (+/- strand) (+ strand) 5 3 R (+ strand) 3 5 R (+/- strand) R (- strand) R (+/- strand) R (- strand) R (+ strand) R (+/- strand) R (+/- strand) R (- strand) Align sequences at left and right junctions Transgene-genome insert representation Genome Vector Vector Genome Junctions PCR amplification and sequence validation

6 Integration locus for BS-producing clone Genome-vector sequence, verified by PCR amplification and re-sequencing: - LEFT JUNCTION...CTGAAATTGCTTTCATTTTTAAAATTTTTTTGTATTTTTATTATTTTATTTTATTTTGGCTTTTGGGGATTTACATTTTTTTTAAGCAGAAGAAATTCAGGATTGTGGTGTTAAGGAATAATAGATCTTCCCTTTTAA AATCCGTTATGATGTTGAAAGGCTTTTTTTAAAATGGACTATATATATATGTATATATGAGTACGATATTTTTTTTCCTTTGAAAAATTTTATCGATCGGTTTAAAATTCCCCCCGTAATGCGTCCTTGCTTTGCTCTG AGCGCTTCTTGTCTCGA - then plasmid DNA sequence.. plasmid DNA sequence then back into genomic DNA.9kb further down the chromosome:ttgtaccgcgcgcagcctccgaccccactccggccctcggcgcctttgaagcggcag GTTCCTGACCTCCCTCCCCTTCCTTCTTTCCCTTTGTCCTCCTCGGCGCCCTCCGGGGTTCGAGAGGCGCCGGCCTGGGTAGGGGCGCGCGAGTCCCTCACCG... - RIGHT JUNCTION CHO genome.9 kb of deleted genome. CHO genome Transgenes in CHO BahCC gene Vector integration sites: Deleted from CHO genome: CHO scaffold 6949 CHO DNA scaffold sequence: Characterizing integration locus Current clone reporting file, V.

7 CHO-M gene expression profile vs transgene integration sites Expression level of CHO-M genes hit by transgene Max: 3-4 ( gene) Relative expression (mrna levels) Reads / kb / M total mapped reads (RPKM) Undetectable: read (9 834 genes, 44.6%) Moderate: 4-4 ( 975 genes, 3.5%) Low: -4 (9 53 genes, 4.%) High: 4-4 (75 genes,.8%) Ranked gene number A need for CHO clones sequencing? NGS can assess: Transgene integrity at fusions with genome Transgene copy number and correct sequence Number and location(s) of genomic integration loci Possible adverse effects from some transgene integration Providing an early validation at clone selection stage

8 Integration events statistics genomic integration loci mapped on 6 clones 7 fusions sequences validated by PCR + sequencing Most inserted transgenes mapped are in or near CHO genes Variable vector fusions ( in MAR, in selection cassette, in HC, etc) Can we deduce and engineer the recombination mechanism? CHO-M genome sequencing and engineering. For producer clone characterization. To understand and improve transgene integration 3. For CHO secretion and metabolic pathways stable engineering

9 Possible Mechanisms for Transgene Integration? Plasmid copies Genomic DNA NHEJ G-early S phase Chromosome break, activates repair mechanisms Late S-G phase HR Clean ligation-like vector genome fusions? Integration at random genomic sequences? NO or Sequence homology of vector and genomic DNA? NO Characterizing integration mechanism HR vs. NHEJ vs. MMEJ transgene integration mechanisms Plasmid copies Genomic DNA NHEJ G-early S phase MMEJ / Alt-EJ S phase Late S-G phase HR Microhomologies at relevant positions? Templated DNA insert at junction? YES Characterizing integration mechanism

10 Transient CHO Engineering to Improve Integration Recombination engineering by sirna transfection: Single MAR-GFP DNA transfection, Polyclonal pools of CHO cells Cell$counts$ GFP$expression$(RLU)$ Transient recombination engineering yields very high expression Can we stably engineer recombination? CHO engineering to improve integration CHO-M engineering with transposon vectors plasmid containing a transgene Plasmid ITR containing a transposon Plasmid containing the transposase gene Concatemer formation Transposase binding to ITR Transposase expression Integration by recombination into genome Transposon excision.. Host genome.... Concatemer integration Transposon integration Host genome CHO metabolic engineering

11 Combine MARs elements transposon vectors Stable polyclonal cell pools generated without selection ITR GFP MAR ITR +/- PB transposase +PB +PB transposase -PB transposase Electroporated CHO cells in suspension (after 3 weeks, without antibiotic selection) Transgene copy number MAR GFP fluorescence per transgene MAR increases expression per transgene copy from transposable vectors High expression from -4 integrated transposons (.6 -. g/l IgG) MARs, transposons and double transfections MAR % GFP positive cells 4 3 With transposase No transposase Single transfection Nearly 5% of stably expressing CHO cells without selection Double transfection Ley et al., 3; PLOS ONE Recombination pathway engineering Stable recombination engineering of CHO-M cells with transposon vector Parental CHO-M: GFP expressing pool Recombination-engineered CHO-M: GFP expressing pool Recombination-engineered CHO-M: GFP-expressing clone Percent total population M M M3 Expression stability Clone 4 Clone 8 Clone 9 Clone Clone 6 Clone 9 Clone 6 CHO-M Culture time (days) CHO engineering to improve integration

12 $ CHO-M genome sequencing and engineering. For producer clone characterization. To understand and improve transgene integration 3. For CHO secretion and metabolic pathways stable engineering Clonal or protein-based variations in expression The issue of clonal / protein variability Doubling#+me#(h)# 6$ 55$ Single CHO cell clones one transfection two transfections 5$ 45$ 4$ 35$ 3$ 5$ $ 5$ $ $ $ 3$ 4$ 5$ 6$ 7$ 8$ Produc+vity#(picogram#per#cell#and#per#day#of#IgG)# «Easy-to-express IgG» -> High-producer (HP) clones Cell$lysates$ Medium$ $$$$HighGP$$$$$$$$$$$LowGP$ $HP$$$$$LP$ $ 6$ 9$ 4$ 58$ Wt$ 9$ 4$ 58$ HC$ 5# 5# LC$ $$$$$$$$$$$$$$HPGClone$$$$$$$LPGClone$ Chase$(hrs):$$$$$$$$$4$$6$$$$$$$$$$$$$4$$6$ IgG$ (HC) $ HCGLC$ Soluble$ Free$HC$ (LC) $ «Difficult-to-express IgG» -> Low-producer (LP) clones Insoluble$ Free$LC$ Aggr$LC$ CHO engineering for improved secretion

13 Dissecting protein secretion hurdles in CHO cells Soluble ER-associated proteins + Triton Supernatant: soluble cytosolic and ER proteins Aggregated cytosolic or ER-associated proteins ER-derived, Triton X- insoluble vesicles Precipitate: aggregated and vesicular proteins Cytosolic proteins LP cells + Digitonin, trypsin Supernatant: soluble ER-associated proteins 3 + Triton Precipitate: aggregated ER and vesicular proteins 4 + Digitonin, triton, trypsin Supernatant: residual undigested proteins 5 Precipitate: vesicular proteins 6 CHO engineering for improved secretion Secretion engineering of CHO host cells Stable engineering of CHO cell secretion and protein folding pathways Helper protein -- G S -- G S TX- soluble TX- insoluble High-P Low-P G=GFP S=SRP4 IgG$ (HC) $ HCGLC$ FreeGHC$ FreeGLC$ Specific productivity (pcd) High-P -- S -- S Low-P Specific productivity (fold over control) Plasmid vectors Transposon vectors Efficient protein production by secretion pathway engineering CHO engineering for improved secretion Ley et al., 3; Le Fourn et al., 3; Metabolic Engineering, online

14 Secretion pathway engineering Low producer InflixiMab clone Clone overexpressing secretion pathway proteins ER stress induction SRP elongation arrest function SRP golgi Faulty processing, precipitation in IB, targeting of IB to autophagosomes Cell cycle delay UPR stress response Efficient signal peptide removal and secretion after a multistep pathway engineering CHO engineering for improved secretion Many-fold pathway engineering Source: Khan, S. U. and M. Schroder (8), Cytotechnology 57(3): 7-3. CHO metabolic engineering

15 CHO genome and MAR for efficient clone generation Many proteins X many cell lines -> Many solutions needed MAR-transposon vectors for multisteps pathway engineering Recombination and secretion engineering improves production Perspectives for the systematic metabolic engineering of CHO cells Institute of Biotechnology Acknowledgements Niko Niederländer Yves Dusserre Stéphanie Renaud Jacqueline Masternak Stefania Puttini Ruthger van Zwieten Kaja Kostyrko Recombination analysis and engineering Xuan Droz Alessia Cochard Deborah Ley CHO secretion pathway engineering Simone Edelmann Etienne Lançon Thomas Junier Bioinformatics and automatization Maxime Albesa Yaroslav Shcherba Elena Aritonovska Solenne Birre Pavithra Iyer Nic Mermod Collaborations Selexis: I. Fisch, P.-A. Girod, A. Regamey, V. Le Fourn SIB: I. Xenarios, Ch. Iseli, S. Neuenschwander Project funding bodies KTI/CTI Swiss Government agency Selexis SA UNIL Copyright Alain Herzog