Table S1. List of DNA constructs and primers, part 1 Construct

Transcription

1 SUPPLEMENTARY TABLES: Table S1. List of DNA constructs and primers, part 1 Construct Comment (Expressed protein) Vector, PCR primers and template or source of Restriction Sites name Resistance construct paup1-3ha Wild type AUP1 C-terminally 3x HA- tagged; pct7 p3ha-aup1 Wild type AUP1 N-terminally 3x HA- tagged pspglycoaup1-3ha GlycoAUP1-3HA preceded by a SS_Amplif_Forw_NheI NheI, HindIII cleavable signal peptide obtained from AGCTTAGCTAGCCACCATGGAG gfp-gl-gpi plasmid SSandlinker_Amplif_Rev_HindIII TACCGTAAGCTAGAGATCCAG Template: gfp-gl-gpi gfp-gl-gpi Contains signal sequence of rabbit pegfp-n1, Keller et al., 2001 (46) lactase- phlorizin hydrolase paup1-3ha_1-280 Amino acids 1 to 280 of wild type AUP1 C-terminally 3x HA-tagged; pct13 paup1-3ha_1-362 Amino acids 1 to 362 of wild type AUP1 C-terminally 3x HA-tagged; pct15 paup1-3ha_1-93 Amino acids 1 to 93 of wild type haup1_ha_hindforas AUP1 C-terminally 3x HA-tagged. AAACTTAAGCTTGCCATGGAGCTCC Note that the XbaI restriction site, AGGG used for cloning, encodes serine, AUP1_HA_1_93_Xbarev which corresponds to the 94 th amino CACATGTAGAAATGAGGACCCTGAC acid of AUP1. ACTGTG Template: paup1-3ha p3ha-aup1_1-93 Amino acids 1 to 93 of wild type No PCR, insert cut from paup1-3ha_1_93 AUP1 N-terminally 3x HA-tagged. Note that the XbaI restriction site, used for cloning, encodes serine, which corresponds to the 94 th amino acid of AUP1. pglycoaup1-3ha AUP1 with introduced glycosylation site at position 3-5 (LPS in wild type AAACTTAAGCTTGCCATGGAGAATGGA substituted with NGS to create a AGGGG consensus N-glycosylation site NXS) (see Figure 5) TGGGTATAGAGAGCCCTGGGC Template: paup1-3ha 1

2 Table S2. List of DNA constructs and primers, part 2 Construct Comment (Expressed protein) Vector, PCR primers and template or source of Restriction Sites name Resistance construct ppvg/lll-3ha AUP1 with PVG motif within the PVGtoLLL_A1 transmembrane domain substituted by GTGCTGCTGCTACGCGCTACCTGT LLL (PVG/LLL), protein C-terminally TGCCCGCTG 3x HA-tagged; For localization of PVGtoLLL_A2 PVG motif see Figure 3. CAGGACGAGGAGGCAGAACAGGAGTA GCGCGTAGAGCAGCAGCAC Template: puc18-aup1_no_stop p3ha-pvg/lll PVG/LLL version of AUP1, protein No PCR, insert cut from ppvg/lll-3ha N-terminally 3x HA-tagged pglycopvg/lll-3ha PVG/LLL version of AUP1, protein C-terminally 3x HA-tagged and with AAACTTAAGCTTGCCATGGAGAATGGA internal glycosylation tag (see Figure AGGGG 5) TGGGTATAGAGAGCCCTGGGC Template: ppvg/lll-3ha pr42i-3ha AUP1 with arginine 42 substituted by AUP1_R2ILE_A1 isoleucine, protein C-terminally 3x CTGCCCGCTGACTGTT HA-tagged GGGAC AUP1_R2ILE_A2 GGACCGAGAAACAGGAAGGACG AGGAGGCAG haup1_ha_hindforas AAACTTAAGCTTGCCATGGAGCTCC AGGG TGGGTATAGAGAGCCCTGGGC Template: paup1-3ha p3ha-r42i AUP1 with arginine 42 substituted by No PCR, insert cut from pr42i-3ha isoleucine, protein N-terminally 3xHA tagged pglycor42i-3ha AUP1 with arginine 42 substituted by isoleucine, protein C-terminally 3x AAACTTAAGCTTGCCATGGAGAATGGA HA-tagged and with an internal AGGGG glycosylation tag (for localization of internal glycosylation tag see Figure 5) TGGGTATAGAGAGCCCTGGGC Template: pr42i-3ha 2

3 Table S3. List of DNA constructs and primers, part 3 Construct Comment (Expressed protein) Vector, PCR primers and template or source of Restriction Sites name Resistance construct pd58i-3ha AUP1 with aspartic acid 58 substituted DtoILE_A1 by isoleucine, protein C-terminally 3x TGGAGCTGCGCGCTGCCAAAGCGT HA-tagged CCTGCAGATG DtoILE_A2 CGAATGCGAAGGACGCTGATTGGCAG CGCGCAGCTGACCA Template: puc18-aup1_no_stop p3ha-d58i AUP1 with aspartic acid 58 substituted No PCR, insert cut from pd58i-3ha by isoleucine, protein N-terminally 3xHA-tagged pglycod58i-3ha AUP1 with aspartic acid 58 substituted by isoleucine, protein C-terminally AAACTTAAGCTTGCCATGGAGAATGGAT 3xHA-tagged and with an internal CAGGGG glycosylation tag (see Figure 5 for position of glycosylation site tag) TGGGTATAGAGAGCCCTGGGC Template: pd58i-3ha pr62f/r63f-3ha AUP1 with arginines 62 and 63 RRtoFF_A1 substituted by phenylalanines, protein CTGCCAGACAGCGCTTTTTTTGT C-terminally 3x HA-tagged AGTGCGGACCATGTGT RRtoFF_A2 ACACATGGCGCACTACGAAAAAGAAA AGGACGCTGTGGCAG Template: puc18-aup1_no_stop p3ha-r62f/r63f AUP1 with arginines 62 and 63 No PCR, insert cut from pr62f/r63f-3ha substituted by phenylalanines, protein N-terminally 3xHA-tagged AUP1 with arginines 62 and 63 pglycor62f/r63f- 3HA substituted by phenylalanines, protein AAACTTAAGCTTGCCATGGAGAATGGAT C-terminally 3x HA-tagged and with CAGGGG an internal glycosylation tag (see Figure 5 for position of glycosylation TGGGTATAGAGAGCCCTGGGC site tag) Template: pr62f/r63f-3ha puc18-aup1_no_stop AUP1 in puc18 vector for point mutagenesis; PCT8 puc18, ampicillin paup1 Wild type AUP1; PCT6 paup1-gfp Wild type AUP1, C-terminally EGFP- pegfp-n3, tagged 3

4 SUPPLEMENTARY MATERIAL LEGENDS Movie S1. Targeting of AUP1-GFP from the ER to lipid droplets COS-7 cells were transfected with GFP-tagged AUP1 and incubated for 20 h in medium supplemented with delipidated serum to deplete LDs. Subsequently, oleic acid (500 µm) and cycloheximide (10 µg/ml) were added into the medium to promote LD formation and inhibit protein biosynthesis, respectively. AUP1-GFP (green) was imaged by fluorescence microscopy every three minutes for a total of 72 minutes. Then, LDs were stained for 10 min in situ using LD540 to detect LDs, followed by separate imaging of the GFP (green) and the LD540 (red) channel. The last frame of the movie shows the overlay of these two images, taken after a total of 82 min. Scale bar, 10 µm. Fig. S1. Targeting of AUP1-GFP from the ER to lipid droplets COS-7 cells were transfected with GFP-tagged AUP1 and incubated for 20 h in medium supplemented with delipidated serum to deplete LDs. Subsequently, oleic acid (500 µm) and cycloheximide (10 µg/ml) were added into the medium to promote LD formation and inhibit protein biosynthesis, respectively. AUP1-GFP (green) was imaged by fluorescence microscopy every three minutes for a total of 72 minutes. The first and last of these frames are shown in the two upper panels. Then, LDs were stained for 10 min in situ using LD540 to detect LDs, followed by separate imaging of the GFP (green, lower left panel) and the LD540 (red, lower right panel) channel. Scale bar, 10 µm. The full movie can be found as Supplementary Movie S1. Fig. S2. Localization of AUP1 point mutants by subcellular fractionation 4

5 COS-7 cells were transfected with plasmids encoding indicated proteins (top panels: N- terminally HA-tagged constructs; middle panels: C-terminally HA-tagged constructs; bottom panels: constructs bearing a N-terminal glycosylation site and C-terminal HA tag). LDs were induced by incubation of cells with 150 µm oleic acid and isolated by floatation in sucrose gradient. The LD fraction (LDs) and the remaining fractions of the gradient (II, III and if applicable IV) were analyzed by immunoblotting using antibodies against: a LD marker (ACSL3), an ER marker (Calnexin), the transfected AUP1 (anti-ha) and a cytosolic marker (GAPDH) if indicated. 5

6 Fig. S1 00:00 01:12 01:22 01:22 6

7 Fig. S2 cdna HA_WT HA_PVG/LLL HA_R42I HA_D58I HA_R62F/R63F Fraction LDs II III LDs II III LDs II III LDs II III LDs II III ACSL3 Calnexin AUP1 (anti-ha) Lane cdna WT_HA PVG/LLL_HA D58I_HA R62F/R63F_HA Fraction LDs II III IV LDs II III IV LDs II III IV LDs II III IV ACSL3 Calnexin GAPDH AUP1 (anti-ha) Lane cdna GlycoAUP1_HA GlycoPVG/LLL _HA GlycoR42I_HA GlycoD58I_HA GlycoR62F/ R63F_HA Fraction LDs II III LDs II III LDs II III LDs II III LDs II III ACSL3 Calnexin AUP1 (anti-ha) Lane