Trascrizione sintesi di tutti gli RNA cellulari

Transcription

1 Trascrizione sintesi di tutti gli RNA cellulari

2 RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica

3 Formazione del legame fosfodiesterico

4 I precursori della sintesi sono i ribonucleotidi trifosfato. L energia che occorre per la formazione del legame fosfodiesterico è data dall eliminazione del pirofosfato per idrolisi del legame.

5 La direzione di sintesi è 5-3

6 La sequenza nucleotidica dell RNA è dettata dalla sequenza nucleotidica del DNA

7 L enzima che catalizza l unione dei ribonucleotidi è l RNA polimerasi

8

9 RNA polimerasi sintetizza RNA in direzione 5 3 E in grado di iniziare la sintesi. Non necessita di un innesco Utilizza ribonucleosidi 5 -trifosfato (ATP, GTP, UTP e CTP) e richiede Mg++ Il 3 OH agisce da nucleofilo sul gruppo fosfato in 5 del ribonucleoside trifosfato entrante e si ha liberazione di PPi (NMP)n + NTP = (NMP)n+1+ PPi PPi2Pi Ogni nucleotide è selezionato in base alle regole della complementarietà A:U e G:C

10 closed promoter complex Transcription RNA polymerase open promoter complex initiation elongation termination RNA product

11 Legame al promotore della RNA polimerasi Apertura della doppia elica Inizio della sintesi Allungamento Terminazione

12 Direzione della sintesi Filamento senso Filamento antisenso

13 5' G C A G T A C A T G T C 3' coding strand 3' C G T C A T G T A C A G 5' template strand transcription 5' G C A G U A C A U G U C 3' RNA

14 5..AGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGT AGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGC TACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTT GTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAA TACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCGCTATA GTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCCGATGG TGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGCTTGAA TTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCAAACTT TTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATGCTCTA GAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATTGATAA AGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAGAAGGA AAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTACGTCTC CTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCCCAGTC AGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCGCAGCA CCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCACTTTCC TCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAATTGCAAC CACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAATTTCTG GTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGCAGCCTA AAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCAGTTCAG TTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAGGCATG CCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTACCTGGC ACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTA ACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGACTTCAAA TAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAATGTGTA ACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTATTTGGA TTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGAGGAC AGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAACTTTTG AACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGATAATA AGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTGTGAGA AATGTTTATTTTTGTGGCACTGTATATGTTAA..3

15

16 Holoenzyme The holoenzyme of RNA-pol in E.coli consists of 5 different subunits: 2. holoenzyme core

17 RNA-pol of E. Coli subunit MW function Determine the DNA to be transcribed Catalyze polymerization Bind & open DNA template Recognize the promoter for synthesis initiation

18 Prokaryotic promoter 5' 3' region T T G A C A A A C T G T -10 region T A T A A T A T A T T A (Pribnow box) Consensus sequence start 3' 5'

19

20

21

22 c. Termination The RNA-pol stops moving on the DNA template. The RNA transcript falls off from the transcription complex. The termination occurs in either - dependent or -independent manner.

23 -independent termination The termination signal is a stretch of nucleotides on the RNA transcript, consisting of many GC followed by a series of U. The sequence specificity of this nascent RNA transcript will form particular stem-loop structures to terminate the transcription.

24

25 The human RNA polymerases Polymerase Location Product RNA polymerase I nucleolus 18S, 28S, 5.8S rrna RNA polymerase II nucleoplasm hnrna/mrna, U1, U2, U4, U5 snrna RNA polymerase III nucleoplasm trna, 5S RNA, U6 snrna, 7SL RNA mitochondrial RNA polymerase mitochondrion all mitochondrial RNA

26

27 b). Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mrna structure 5 3 translated region

28

29 TATA box (TATAAAA) located approximately bp upstream of the +1 start site determines the exact start site (not in all promoters) binds the TATA binding protein (TBP) which is a subunit of TFIID GC box (CCGCCC) binds Sp1 (Specificity factor 1) CAAT box (GGCCAATCT) binds CTF (CAAT box transcription factor) Octamer (ATTTGCAT) binds OTF (Octamer transcription factor) Sequence elements within a typical eukaryotic gene 1 1 based on the thymidine kinase gene octamer transcription element promoter +1 ATTTGCAT GC CAAT GC TATA

30 TATA box

31 Proteins regulating eukaryotic mrna synthesis General transcription factors TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH 1, TFIIJ assemble with TFIID RNA polymerase II binds the promoter region via the TFII s Transcription factors binding to other promoter elements and transcription elements interact with proteins at the promoter and further stabilize (or inhibit) formation of a functional preinitiation complex 1 TFIIH is also involved in phosphorylation of RNA polymerase II, DNA repair (Cockayne syndrome mutations), and cell cycle regulation

32 Nome Alias Chromosoma TAF1 250 Xq13.1 TAF1L 250like 9p21.1 TAF q24.12 TAF p15.1 TAF q13.33 TAF4B q11.2 TF2D TBP + TAF TAF q24-10q25.2 TAF6 80 7q22.1 TAF6L 11q12.3 TAF7 55 5q31 TAF7L 50 Xq22.1 TAF8 43 6p21.1 TAF9 32 5q11.2-5q13.1 TAF p15.3 TAF p21.31 TAF p35.3 TAF p13.3 TAF q11.1-q11.2

33 Binding of the general transcription factors E F TAFs B TFIID H A TBP J TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH, TFIIJ assemble with TFIID

34 Binding of RNA polymerase II E F B TFIID H A TBP J RNA pol II RNA polymerase II (a multisubunit protein) binds to the promoter region by interacting with the TFII s TFs recruit histone acetylase to the promoter

35 TATA BOX BINDING PROTEIN TBP Saddle-like domain TATA BOX DNA BINDING

36 TAF5 stabilizes TAFs interaction, specially histonelike ones (TAF6, TAF9) TAF1: Acetyl transferase activity Interaction with TFIIF TAF6 TAF11 TAF4 TAF12 TAF9 TAF13 TAF3 TAF12 TAF8 TAF4 TAF10 TBP TAF7 TAF5 TAF5 TAF11 TAF8 TAF3 TATA BOX TAF13 TAF6 TAF9TAF10

37 DNA BENDING

38 TFIID

39 Pre-initiation complex (PIC) RNA pol II TF II A TBP TAF TATA TF II F TF II B TF II E TF II H DNA

40 Pre-initiation complex (PIC) TBP of TFII D binds TATA TFII A and TFII B bind TFII D TFII F-RNA-pol complex binds TFII B TFII F and TFII E open the dsdna (helicase and ATPase) TFII H: completion of PIC

41 41 Muller and Tora 2004 Embo Journal

42 Curr Opin Genet Dev Oct;20(5): Epub 2010 Jul 2. Developmental regulation of transcription initiation: more than just changing the actors. Müller F, Zaucker A, Tora L. Source Department of Medical and Molecular Genetics, Division of Reproductive and Child Health, Institute of Biomedical Research, University of Birmingham, B15 2TT Edgbaston, Birmingham, UK. Abstract The traditional model of transcription initiation nucleated by the TFIID complex has suffered significant erosion in the last decade. The discovery of cell-specific paralogs of TFIID subunits and a variety of complexes that replace TFIID in transcription initiation of protein coding genes have been paralleled by the description of diverse core promoter sequences. These observations suggest an additional level of regulation of developmental and tissue-specific gene expression at the core promoter level. Recent work suggests that this regulation may function through specific roles of distinct TBP-type factors and TBP-associated factors (TAFs), however the picture emerging is still far from complete. Here we summarize the proposed models of transcription initiation by alternative initiation complexes in distinct stages of developmental specialization during vertebrate ontogeny.

43 Mol Cell Dec 25;36(6): Shifting players and paradigms in cell-specific transcription. D'Alessio JA, Wright KJ, Tjian R. Source Howard Hughes Medical Institute, University of California, Berkeley, 94720, USA. Abstract Historically, developmental-stage- and tissue-specific patterns of gene expression were assumed to be determined primarily by DNA regulatory sequences and their associated activators, while the general transcription machinery including core promoter recognition complexes, coactivators, and chromatin modifiers was held to be invariant. New evidence suggests that significant changes in these general transcription factors including TFIID, BAF, and Mediator may facilitate global changes in cell-type-specific transcription.

44 Specific variants of general transcription factors regulate germ cell development in diverse organisms. Freiman RN. Source Department of Molecular and Cell Biology, Brown University, 70 Ship St., Box G-E4, Providence, RI 02903, USA. Abstract Through the reductive divisions of meiosis, sexually reproducing organisms have gained the ability to produce specialized haploid cells called germ cells that fuse to establish the diploid genome of the resulting progeny. The totipotent nature of these germ cells is highlighted by their ability to provide a single fertilized egg cell with all the genetic information necessary to develop the complete repertoire of cell types of the future organism. Thus, the production of these germ cells must be tightly regulated to ensure the continued success of the germ line in future generations. One surprising germ cell development mechanism utilizes variation of the global transcriptional machinery, such as TFIID and TFIIA. Like histone variation, general transcription factor variation serves to produce gonadal-restricted or -enriched expression of selective transcriptional regulatory factors required for establishing and/or maintaining the germ line of diverse organisms. This strategy is observed among invertebrates and vertebrates, and perhaps plants, suggesting that a common theme in germ cell evolution is the diversification of selective promoter initiation factors to regulate critical gonadal-specific programs of gene expression required for sexual reproduction. This review discusses the identification and characterization of a subset of these specialized general transcription factors in diverse organisms that share a common goal of germ line regulation through transcriptional control at its most fundamental level.

45 Figure 1 Integration of multiple regulatory steps in transcription initiation by RNA polymerase II (Pol II). Schematic representation of the proteins required for chromatin-dependent initiation of Pol II transcription. Numerous protein-dna and protein-protein interactions are depicted by individual factors and multi-protein complexes recruited to regulatory DNA sequences. Transcription initiation by Pol II is dependent on the combinatorial efforts of multiple factors and multi-subunit complexes around the start site of transcription. TBP, TATA-box binding protein; TAFs, TBP-associated factors; Nuc., nucleosomes; HATs, histone acetyltransferases; HDACs, histone deacetylases; RE, recognition element; TATA, TATAbox, Inr, initiator; DPE, downstream promoter element.

46

47 Phosphorylation of RNA-pol TF II H is of protein kinase activity to phosphorylate CTD of RNA-pol. (CTD is the C-terminal domain of RNA-pol)

48 b. Elongation The elongation is similar to that of prokaryotes. The transcription and translation do not take place simultaneously since they are separated by nuclear membrane.

49 c. Termination The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.

50

51 Structure of eukaryotic mrna 5 Cap 7mGppp 5 untranslated region initiation AUG translated region 3 untranslated region UGA termination polyadenylation signal AAUAAA (A) ~200 poly(a) tail all mrnas have a 5 cap and all mrnas (with the exception of the histone mrnas) contain a poly(a) tail the 5 cap and 3 poly(a) tail prevent mrna degradation loss of the cap and poly(a) tail results in mrna degradation 3

52 Steps in mrna processing (hnrna is the precursor of mrna) capping (occurs co-transcriptionally) cleavage and polyadenylation (forms the 3 end) splicing (occurs in the nucleus prior to transport) exon 1 intron 1 exon 2 cap Transcription of pre-mrna and capping at the 5 end Cleavage of the 3 end and polyadenylation cap cap poly(a) Splicing to remove intron sequences cap poly(a) Transport of mature mrna to the cytoplasm

53

54 The 5 - cap structure is found on hnrna too. The capping process occurs in nuclei. The cap structure of mrna will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicing.

55 b. Poly-A tailing at 3 - end There is no poly(dt) sequence on the DNA template. The tailing process dose not depend on the template. The tailing process occurs prior to the splicing. The tailing process takes place in the nuclei.

56

57 Polyadenylation cleavage of the primary transcript occurs approximately nucleotides 3 -ward of the AAUAAA consensus site polyadenylation catalyzed by poly(a) polymerase approximately 200 adenylate residues are added cleavage AAUAAA mgpppnmpnm mgpppnmpnm AAUAAA A A A polyadenylation A A A 3 poly(a) is associated with poly(a) binding protein (PBP) function of poly(a) tail is to stabilize mrna

58

59

60 Genes Dev Sep 1;25(17): Ending the message: poly(a) signals then and now. Proudfoot NJ. Source Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom. Abstract Polyadenylation [poly(a)] signals (PAS) are a defining feature of eukaryotic protein-coding genes. The central sequence motif AAUAAA was identified in the mid-1970s and subsequently shown to require flanking, auxiliary elements for both 3'-end cleavage and polyadenylation of premessenger RNA (premrna) as well as to promote downstream transcriptional termination. More recent genomic analysis has established the generality of the PAS for eukaryotic mrna. Evidence for the mechanism of mrna 3'-end formation is outlined, as is the way this RNA processing reaction communicates with RNA polymerase II to terminate transcription. The widespread phenomenon of alternative poly(a) site usage and how this interrelates with pre-mrna splicing is then reviewed. This shows that gene expression can be drastically affected by how the message is ended. A central theme of this review is that while genomic analysis provides generality for the importance of PAS selection, detailed mechanistic understanding still requires the direct analysis of specific genes by genetic and biochemical approaches.

61 Cell Cycle Nov 15;9(22): Epub 2010 Nov 15. To polyadenylate or to deadenylate: that is the question. Zhang X, Virtanen A, Kleiman FE. Source Chemistry Department, Hunter College, City University of New York, NY, USA. Abstract mrna polyadenylation and deadenylation are important processes that allow rapid regulation of gene expression in response to different cellular conditions. Almost all eukaryotic mrna precursors undergo a co-transcriptional cleavage followed by polyadenylation at the 3' end. After the signals are selected, polyadenylation occurs to full extent, suggesting that this first round of polyadenylation is a default modification for most mrnas. However, the length of these poly(a) tails changes by the activation of deadenylation, which might regulate gene expression by affecting mrna stability, mrna transport, or translation initiation. The mechanisms behind deadenylation activation are highly regulated and associated with cellular conditions such as development, mrna surveillance, DNA damage response, cell differentiation and cancer. After deadenylation, depending on the cellular response, some mrnas might undergo an extension of the poly(a) tail or degradation. The polyadenylation/deadenylation machinery itself, mirnas, or RNA binding factors are involved in the regulation of polyadenylation/deadenylation. Here, we review the mechanistic connections between polyadenylation and deadenylation and how the two processes are regulated in different cellular conditions. It is our conviction that further studies of the interplay between polyadenylation and deadenylation will provide critical information required for a mechanistic understanding of several diseases, including cancer development.

62

63

64 Splicing Rimozione di un introne attraverso due reazioni sequenziali di trasferimento di fosfato, note come transesterificazioni. Queste uniscono due esoni rimuovendo l introne come un cappio

65

66

67

68

69 Chemistry of mrna splicing two cleavage-ligation reactions transesterification reactions - exchange of one phosphodiester bond for another - not catalyzed by traditional enzymes branch site adenosine forms 2, 5 phosphodiester bond with guanosine at 5 end of intron intron 1 Pre-mRNA 2 OH-A branch site adenosine exon 1 exon 2 5 G-p-G-U - A-G-p-G 3 First clevage-ligation (transesterification) reaction

70 ligation of exons releases lariat RNA (intron) intron 1 U-G-5 -p-2 -AA Splicing intermediate exon 1 exon 2 5 G-OH 3 A-G-p-G A - 3 Second clevage-ligation reaction intron 1 Lariat U-G-5 -p-2 -A Spliced mrna 3 G-A exon 1 exon 2 5 G-p-G 3

71 Recognition of splice sites invariant GU and AG dinucleotides at intron ends donor (upstream) and acceptor (downstream) splice sites are within conserved consensus sequences donor (5 ) splice site branch site acceptor (3 ) splice site G/GUAAGU... A... YYYYYNYAG/G U1 U2 small nuclear RNA (snrna) U1 recognizes the donor splice site sequence (base-pairing interaction) U2 snrna binds to the branch site (base-pairing interaction) Y= U or C for pyrimidine; N= any nucleotide

72 intron 1 Step 2: binding of U4, U5, U6 2 OH-A exon 1 exon 2 U5 5 G-p-G-U - A-G-p-G 3 U1 U2 U4 U6 intron 1 Step 3: U1 is released, then U4 is released 2 OH-A exon 1 exon 2 U5 U6 U2 5 G-p-G-U - A-G-p-G 3

73 Step 4: U6 binds the 5 splice site and the two splicing reactions occur, catalyzed by U2 and U6 snrnps intron 1 mrna 3 G-A U6 2 OH-A U-G-5 -p-2 -A U5 U2 5 G-p-G 3

74

75

76

77 Trans-splicing Nei protozoi e in un nematode

78

79 Brief Funct Genomics May;10(3): doi: RNA splicing: disease and therapy. Douglas AG, Wood MJ. Source Department of Physiology, Anatomy and Genetics, University of Oxford, UK. Abstract The majority of human genes that encode proteins undergo alternative pre-mrna splicing and mutations that affect splicing are more prevalent than previously thought. The mechanism of premrna splicing is highly complex, requiring multiple interactions between pre-mrna, small nuclear ribonucleoproteins and splicing factor proteins. Regulation of this process is even more complicated, relying on loosely defined cis-acting regulatory sequence elements, trans-acting protein factors and cellular responses to varying environmental conditions. Many different human diseases can be caused by errors in RNA splicing or its regulation. Targeting aberrant RNA provides an opportunity to correct faulty splicing and potentially treat numerous genetic disorders. Antisense oligonucleotide therapies show particular promise in this area and, if coupled with improved delivery strategies, could open the door to a multitude of novel personalized therapies.

80 Trends Cell Biol Jun;21(6): Epub 2011 Apr 21. Pre-mRNA splicing: where and when in the nucleus. Han J, Xiong J, Wang D, Fu XD. Source Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA , USA. Abstract Alternative splicing is a process to differentially link exon regions in a single precursor mrna to produce two or more different mature mrnas, a strategy frequently used by higher eukaryotic cells to increase proteome diversity and/or enable additional post-transcriptional control of gene expression. This process can take place either co-transcriptionally or post-transcriptionally. When and where RNA splicing takes place in the cell represents a central question of cell biology; co-transcriptional splicing allows functional integration of transcription and RNA processing machineries, and could allow them to modulate one another, whereas post-transcriptional splicing could facilitate coupling RNA splicing with downstream events such as RNA export to create additional layers for regulated gene expression. This review focuses on recent advances in co- and post-transcriptional RNA splicing and proposes a new paradigm that some specific coupling events contribute to genome organization in higher eukaryotic cells.

81 Trends Genet May;27(5): Epub 2011 Apr 15. Genetic therapies for RNA mis-splicing diseases. Hammond SM, Wood MJ. Source Department of Physiology, Anatomy and Genetics, University of Oxford, South Parks Road, Oxford, UK, OX1 3QX. Abstract RNA mis-splicing diseases account for up to 15% of all inherited diseases, ranging from neurological to myogenic and metabolic disorders. With greatly increased genomic sequencing being performed for individual patients, the number of known mutations affecting splicing has risen to 50-60% of all disease-causing mutations. During the past 10years, genetic therapy directed toward correction of RNA mis-splicing in disease has progressed from theoretical work in cultured cells to promising clinical trials. In this review, we discuss the use of antisense oligonucleotides to modify splicing as well as the principles and latest work in bifunctional RNA, trans-splicing and modification of U1 and U7 snrna to target splice sites. The success of clinical trials for modifying splicing to treat Duchenne muscular dystrophy opens the door for the use of splicing modification for most of the mis-splicing diseases.

82 Curr Gene Ther Aug 1;11(4): RNA splicing manipulation: strategies to modify gene expression for a variety of therapeutic outcomes. Wilton SD, Fletcher S. Source University of Western Australia, Crawley. Abstract Antisense oligomers initially showed promise as compounds to modify gene expression, primarily through RNaseH induced degradation of the target transcript. Expansion of the field has led to new chemistries capable of invoking different mechanisms, including suppression of protein synthesis by translational blockade and gene silencing using short interfering RNAs. It is now apparent that the majority of the eukaryotic genome is transcribed and non-protein coding RNAs have been implicated in the regulation of gene expression at many levels. This review considers potential therapeutic applications of antisense oligomers to modify gene expression, primarily by interfering with the process of exon recognition and intron removal during gene transcript splicing. While suppression of gene expression will be necessary to address some conditions, it is likely that antisense oligomer splice modification will have extensive clinical application. Pre-mRNA splicing is a tightly coordinated, multifactorial process that can be disrupted by antisense oligomers in a highly specific manner to suppress aberrant splicing, remove exons to by-pass nonsense or frame-shifting mutations or influence exon selection to alter spliceoform ratios. Manipulation of splicing patterns has been applied to a diverse range of conditions, including b-thalassemia, Duchenne muscular dystrophy, spinal muscular atrophy and certain cancers. Alternative exon usage has been identified as a major mechanism for generating diversity from a limited repertoire of genes in higher eukaryotes. Considering that the majority of all human primary gene transcripts are reportedly alternatively spliced, intervention at the level of pre-mrna processing is likely to become increasingly significant in the fight against genetic and acquired disorders.

83 SRE Splicing Regulator Elements These elements are conventionally classified as exonic splicing enhancers (ESEs) or silencers (ESSs) if from an exonic location they function to promote or inhibit inclusion of the exon they reside in, and as intronic splicing enhancers (ISEs) or silencers (ISSs) if they enhance or inhibit usage of adjacent splice sites or exons from an intronic location. In general, these splicing regulatory elements (SREs) function by recruiting transacting splicing factors that activate or suppress splice site recognition or spliceosome assembly by various mechanisms

84

85

86 Differenti molecole di mrna dallo stesso gene Splicing alternativo Uso di promotori alternativi Uso di segnali di poliadenilazione alternativi

87

88

89

90 d. mrna editing Taking place at the transcription level One gene responsible for more than one proteins

91 Different pathway of apo B Human apo B gene hnrna ( base) CAA to UAA At 6666 liver apo B100 (500 kd) intestine apo B48 (240 kd)

92

93 Structure of prokaryotic messenger RNA 5 Shine-Dalgarno sequence PuPuPuPuPuPuPuPu 3 AAU termination translated region initiation AUG The Shine-Dalgarno (SD) sequence base-pairs with a pyrimidine-rich sequence in 16S rrna to facilitate the initiation of protein synthesis

94 Il gene dei procarioti è policistronico

95 Enhancers Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche più di 50 Kb.

96 Regolazione dell espressione genica Organizzazione della cromatina Punto 1 Inizio della trascrizione

97 Meccanismi di Regolazione dell espressione genica Fase Nucleare Scelta del gene che deve essere espresso Maturazione dell RNA Trasferimento Nucleo Citoplasma Fase Citoplasmatica Sintesi delle catene polipeptidiche Modificazioni post-traduzionali Trasferimento delle proteine nelle sedi di competenza