Technical University of Denmark. Written examination, 29 May 2012 Course name: Life Science. Course number: Aids allowed: Written material

Transcription

1 1 Technical University of Denmark Written examination, 29 May 2012 Course name: Life Science Course number: Aids allowed: Written material Exam duration: 4 hours Weighting: The exam set consists of 28 exercises that can maximally give a total of 40 points. For each exercise it is stated how many points the exercise can maximally give.

2 2 Q1 (1 points) ΔG for reaction A B is 6 kjmol -1 ΔG for reaction A C is 30 kjmol -1 Can you predict which reaction will occur fastest, given the same initial concentration of A? Mark the statements in the table below as either or. There may be more than one statement. a. At equal concentrations of A, the rate of reaction A B will be higher than the rate of reaction A C. b. At equal concentrations of A, the rate of reaction A C will be higher than the rate of reaction A B. c. It is not possible to say which reaction will have the highest rate. d. Both reactions will run at the same rate. a. At equal concentrations of A, the rate of reaction A B will be higher than the rate of reaction A C. b. At equal concentrations of A, the rate of reaction A C will be higher than the rate of reaction A B. c. It is not possible to say which reaction will have the highest rate. X X X d. Both reactions will run at the same rate. X Q2 (1point) Explain your reasoning in Q1 (why did you mark the statements or as you did). ΔG determines whether the reaction can occur spontaneously but has no effect on the rate of the reaction. Reaction rate depends on the activation energy, which is not known in this case.

3 3 Q3 (1 point) Mark the statements in the table below as either or. There may be more than one statement. Which of the below statements are true for a spontaneous reaction? a. ΔG for the reaction is negative. b. The reaction is endergonic. c. The reaction causes increased disorder in the universe. d. The reaction occurs very fast. a. ΔG for the reaction is negative. X b. The reaction is endergonic. X c. The reaction causes increased disorder in the universe. X d. The reaction occurs very fast. X Q4 (1 point) Mark the statements below as either or. There may be more than one statement. The activation energy of a reaction: a. Is a measure of the energy difference between reactants and products. b. Determines the chemical equilibrium of a reaction. c. Is highest for enzyme-catalyzed reactions. d. Is lowered in the presence of an enzyme that can catalyse the reaction.

4 4 a. Is a measure of the energy difference between reactants and products. X b. Determines the chemical equilibrium of a reaction. X c. Is highest for enzyme-catalyzed reactions. X d. Is lowered in the presence of an enzyme that can catalyse the reaction. X Q5 (1 point) What is the name of the molecule shown below? NAD+ Q6 (1 point) Mark the statements below as either or. There may be more than one statement. ΔG for movement of Na + ions across the cell membrane from the cytoplasm to the exterior of the cell is kjmol -1. This movement involves: a. Simple diffusion b. Facilitated diffusion c. An active transporter d. A channel protein

5 5 a. Simple diffusion X b. Facilitated diffusion X c. An active transporter X d. A channel protein X Q7 (1 point) Explain your reasoning in Q6 (why you marked the statements or as you did). The positive ΔG for the movement means an input of energy is needed, therefore active transport is the only option. Q8 (1 point) Mark the statements below as either or. There may be more than one statement. The mitochondrial ATP synthase: a. Is found in the mitochondrial outer membrane in eukaryotes. b. Receives electrons from the electron transport chain. c. Carries out active transport. d. Uses a proton gradient as energy source for ATP synthesis. a. Is found in the mitochondrial outer membrane in eukaryotes. X b. Receives electrons from the electron transport chain. X c. Carries out active transport. X d. Uses a proton gradient as energy source for ATP synthesis. X

6 6 Q9 (1 point) Mark the statements below as either or. There may be more than one statement. Molecules containing a large number of hydroxyl groups are: a. Basic. b. In general highly stable structurally. c. Nonpolar. d. Highly soluble in water. a. Basic. X b. In general highly stable structurally. X c. Nonpolar. X d. Highly soluble in water. X Q10 (1 point) Mark the statements below as either or. There may be more than one statement. Which of the following amino acids does not have an optical isomer? a. Arginine b. Cysteine c. Alanine d. Glycine e. Methionine

7 7 a. Arginine X b. Cysteine X c. Alanine X d. Glycine X e. Methionine X Q11 (2 points) Suppose that you have isolated a polypeptide with the following amino acid sequence: RSCFLA. Refer to the diagrams in Table 3.1 of the textbook, and draw the chemical structure of this polypeptide. In your drawing, label the N terminus and the C terminus and mark all peptide bonds with, e.g., an arrow. Q12 (1 point) How many water molecules are generated in the synthesis of the amino acid sequence RSCFLA from Q11? Five water molecules are generated.

8 8 Q13 (1 point) Refer to the following diagram of DNA complementary base pairing below. Write the four bases of the DNA strand that would pair with the exposed 3 end strand? Remember to mark the 3 and 5 ends. 5 TCGA 3 Q14 (1 point) What is the correct order of the following events in the excision repair of DNA? (1) Base-paired DNA is made complementary to the template. (2) Damaged bases are recognized. (3) DNA ligase seals the new strand to existing DNA. (4) Part of a single strand is excised. 2;4;1;3

9 9 Q15 (1 point) Two individuals have a mutation in gene X but at different sites. The mutation affects the first individual adversely, and the second individual experiences no effect. Explain this observation. Example of a correct answer: The mutation in gene X in the first individual must have occurred in an essential region of the gene that is required for its function. The mutation in gene X in the second individual may be a silent mutation, or it may be in a region that is nonessential for the function of that protein. Q16 (1 point) Refer to the diagram below showing the RFLP patterns at a hypothetical locus in a family wherein some individuals develop high cholesterol. Immediately below the RFLP patterns are the cholesterol levels of each corresponding individual. What inferences can we draw from these results? There is a striking association between the RFLP pattern and the cholesterol level of the individuals. Only those with the broadly-spaced RFLP pattern (from left, lanes 2, 3, 5, 6, 8, 9, and 12) have cholesterol levels over 200. Q17 (1 point) A 10 bp double-stranded DNA fragment was cut by three different restriction enzymes to produce the below fragments. Only the bases of one strand are shown and it is always from the same strand. Furthermore, all fragments starts with the 5 end and ends with the 3 end: (1) When cut by enzyme 1: AC, TAC, and GGATG (2) When cut by enzyme 2: TA, CGG, and ATGAC (3) When cut by enzyme 3: GAC, GAT, and TACG What is the nucleotide sequence of the original 10 bp double-stranded DNA fragment? 5 TACGGATGAC 3 3 ATGCCTACTG 5 Answering 5 TACGGATGAC 3 also gives full points.

10 10 Q18 (1 point) Mark the statements below as either or. There may be more than one statement. In DNA sequencing, ddntps are added at much lower concentrations than are dntps. If ddntps were added at higher concentrations, what would be the most likely result(s)? a. The ddntps would bind to one another. b. All of the reactions would terminate early and long strands would not be produced. c. The ddntps would bind to DNA polymerase and prevent it s function. d. The ddntps would not bind to the dye. a. The ddntps would bind to one another. X b. All of the reactions would terminate early and long strands would not be produced. X c. The ddntps would bind to DNA polymerase and prevent it s function. X d. The ddntps would not bind to the dye. X Q19 (1 point) We are looking at the character skin colour in gum bears. The allele that encodes yellow skin (Y) dominates the allele that encodes red skin (y). Two gum bears, a red and a yellow, are mated. They are both homozygous with regards to skin colour. What are the geno- and phenotypes of the F1 generation and in which proportion? All have the genotype Yy and the phenotype yellow. Q20 (1 point) What is the sequence of bases of the anticodon of the trna molecule that carries methionine? Remember to mark the 5 and 3 ends. 5 C A U 3

11 11 Q21 (1.5 points) Below is shown the 20 N-terminal amino acids of two proteins, X and Z. Which of the two proteins are most likely to be transported to the endoplasmatic reticulum? Explain your reasoning. X: MLGVSLAAGLLALSLWGALA Z: RKREHGPHKHRKNQRHEDRK Protein X. The signal peptide that directs protein to the ER consists of a stretch of amino acids of which many are hydrophobic. The 20 N-terminal amino acids of protein X are mainly hydrophobic, while there are no hydrophobic amino acids in the 20 N-terminal amino acids of protein Z. Q22 (1 point) Underline the open reading frame of the below mrna molecule: 5 U C G A A U G C C A A A U U A C U G C U G A A A U A A G 3 5 U C G A A U G C C A A A U A A C U G C U G A A A U A A G 3 Q23 (1 point) You want to express a human gene (encoding a protein) in E.coli. Why do you use a cdna library instead of a genomic DNA library as a source of DNA in cloning? In order to avoid the introns, which will not be removed by E.coli. Q24 (1 point) Name an antibiotic. Examples of antibiotics include Ampicillin (penicillin), Tetracycline, Kanamycine, and Chloramphenicol. Q25 (1 point) Which two components are required in a plasmid in order to be stably maintained (generation after generation)? An origin of replication and a gene that gives the cell a selective advantage, e.g., a resistance gene to an antibiotic.

12 12 Q26 (7 points) The below diagram shows part of a metabolic network. Metabolites are shown as letters. Numbers each represent a particular enzyme-catalysed reaction. Step 2 is likely to be the commitment step controlling production of product F, as it is the first step in the pathway that leads only towards product F. Now answer the following questions: a. Suggest how the enzyme catalysing step 2 might be regulated by product I and explain the effect of this regulation. Answer (2 points): Via a positive feedback mechanism (probably allosteric). When high amounts of product I are present, enzyme 2 will be activated and metabolite B will be directed towards formation of product F, in favour of more product I. b. Suggest how the same enzyme might be regulated by product F and explain the effect of this regulation. Answer (2 points): Via a negative feedback mechanism (probably allosteric). When high amounts of product F are present, the activity of enzyme 2 will be down-regulated, reducing the formation of even more product F.

13 13 The black line in the graph below shows the relation between reaction rate and substrate concentration for the enzyme catalyzing step 2. The coloured lines show the relation between reaction rate and substrate concentration for the same enzyme, in the presence of a fixed amount of either product I or product F. c. Does the enzyme follow the Michelis-Menten model for enzyme activity? Explain your answer. Answer (1 point): No, the activity curve is sigmoid, suggesting an allosteric enzyme d. Which line (pink or blue) on the graph represents the enzyme in the presence of product I? Explain your answer. Answer (1 point): The blue line, since product I is likely to activate the enzyme the enzyme shows a higher reaction rate in the presence of product I, at a given substrate concentration. e. Which line (pink or blue) on the graph represents the enzyme in the presence of product F? Explain your answer. Answer (1 point): The pink line, since product F is likely to inhibit the enzyme the enzyme shows a lower reaction rate in the presence of product I, at a given substrate concentration.

14 14 Q27 (3 points) Patients with a particular heritable disease have point mutations in a specific gene; let s call it gene A. The below coding strand of DNA originates from gene A: 5 CTTGCTTCGGCCGGCAATGAA 3 a. Assuming that the first codon is the 5 terminal CTT, translate the entire DNA strand into amino acids. L-A-S-A-G-N-E (Leucine-Alanine-Serine-Alanine-Glycine-Asparagine-Glutamic acid) T18 (thymine, position 18), which is marked in bold, is in the patients suffering from the disease mutated to an A (adenine). Now answer the following questions: b. In the wildtype gene, which amino acid does the codon that T18 is part of encode? (Should be very easy for you to answer, if you answered the above question). N, Asparagine. c. Which amino acid does the same codon encode, when T18 is mutated to A? K, Lysine. d. Is a silent mutation possible at nucleotide position 18? Explain your reasoning. Yes, a silent mutation occurs, if the T mutates to C: AAT as well as AAC encodes Asparagine (N).

15 15 Q28 (3.5 points) Another heritable disease preferentially afflicts men. The disease is caused by a mutation in a gene located to the X chromosome; let s call it gene B. a. Name an example of a heritable disease that preferentially afflicts men. Classical examples include hemophilia and red-green colour blindness. In the below figure, the first 490 nucleotides of gene B wt (the normal, non-disease causing variant of the gene) is shown GCTTAGTGCTGAGCACATCCAGTGGGTAAAGTTCCTTAAAATGCTCTGCAAAGAAATTGGGACTTTTCAT 140 TAAATCAGAAATTTTACTTTTTTCCCCTCCTGGGAGCTAAAGATATTTTAGAGAAGAATTAACCTTTTGC 210 TTCTCCAGTTGAACATTTGTAGCAATAAGTCATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTT 280 TTGCGATTCTGCTTTAGTGCCACCAGAAGATACTACCTGGGTGCAGTGGAACTGTCATGGGACTATATGC Primer A 350 AAAGTGATCTCGGTGAGCTGCCTGTGGACGCAAGATTTCCTCCTAGAGTGCCAAAATCTTTTCCATTCAA Primer B 420 CACCTCAGTCGTGTACAAAAAGACTCTGTTTGTAGAATTCACGGATCACCTTTTCAACATCGCTAAGCCA 490 AGGCCACCCTGGATGGGTCTGCTAGGTCCTACCATCCAGGCTGAGGTTTATGATACAGTGGTCATTACAC 3 The first 490 nucleotides of gene B wt. In gene B mut (the disease-causing variant of the gene), 50 nucleotides (from nucleotide no ) is deleted. This is equivalent to the nucleotides marked in bold. To test whether a man carries gene B wt or gene B mut, the following primers are designed for a PCR reaction: Primer A: 5 TTGCGATTCTGCTTTAGTGC 3 Primer B: 3 GGACACCTGCGTTCTAAAGG 5

16 16 The sequences to which they bind are underlined in the figure. Please note that primer A, actually binds the complementary DNA strand, which is not written. After completion of PCR with DNA from the man and primer A and B, the length of the PCR product is examined by electrophoresis along with a ladder of DNA fragments of known size. b. What is the length of the amplified PCR product, if the man s X chromosome contains B wt? Explain your reasoning. If the mans X chromosome contains B wt, the PCR product will be 110 bp (the number of nucleotides between the two primers (70 bp) + the length of the two primers (2 * 20 bp)). c. What is the length of the amplified PCR product, if the man s X chromosome contains B mut? Explain your reasoning. If the mans X chromosome contains B mut, the PCR product will be 60 bp, since 50 bp is missing: 110 bp 50 bp = 60 bp.