Otefin, a Nuclear Membrane Protein, Determines

Transcription

1 Developmental Cell 14 Supplemental Data Otefin, a Nuclear Membrane Protein, Determines the Fate of Germline Stem Cells in Drosophila via Interaction with Smad Complexes Xiaoyong Jiang, Laixin Xia, Dongsheng Chen, Yingyue Yang, Haidong Huang, Lele Yang, Qiudong Zhao, Lijun Shen, Jun Wang, and Dahua Chen Ote Might Not Be Important for the Nuclear Envelope Structure It has been previously shown that Ote specifically interacts with lamin Dm0 (Goldberg et. al 1998). We used anti-ote and anti-lamin to stain ovaries, showing a specific pattern of Ote localization that overlapped with the staining pattern of Lamin DM0 at the nuclear envelope of germ cells (Figure S3) Interestingly, we found that Lamin DM0 protein expression pattern results in no difference between wild-type and ote mutants (Figure S3), suggesting that the localization of Ote in the nuclear envelope might not be important for nuclear envelope structure but mainly for GSC regulation. Supplemental Experimental Procedures Chromatin Immunoprecipitation Assay Chromatin immunoprecipitation was performed according to the method described by Shang et al., 2000and the protocol provided by the Santa Cruz Biotechnology, Inc with minor modification. Briefly, S2 cells were grown in Schneider insect medium supplemented with 10% fetal bovine serum. 2 X 10 7 cells were washed twice with PBS

2 and cross-linked with 1% formaldehyde at room temperature for 15 minutes. The cross-linking reactions were then terminated by the addition of glycine to a final concentration of M. The cells were washed with ice-cold PBS, then lysed with 6 ml buffer I (0.5% NP-40, 0.85 mm KCl, 0.5 mm EGTA, 5mM PIPES, ph 8.0). The pellet was resuspended in 1.9ml buffer II (1 X PBS, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1% SDS). Cells were then sonicated ten times for 10 s each at the normal level setting followed by centrifugation for 10 minutes. The average size of sheared fragments was expected to be 300 1,000 bp. The chromatin solution was pre-cleared by adding 50 μl Protein G plus Agarose and was incubated for 30 minutes at 4 C, followed by centrifugation at full speed for 5 minutes at 4 C. Immunoprecipitation was performed for 6 hr or overnight at 4 C with 4 μl anti-ote serum or pre-serum as a control. Subsequent to immunoprecipitation, 50 μl protein G-Agarose was added and further incubated for 1 hr. Precipitates were washed twice with 1 ml buffer II and then the pellet was washed four times with Wash Buffer (100 mm Tris (ph 8.0), 500 mm LiCl, 1% NP-40 and 1% Deoxycholate). Immunoprecipitates were eluted three times with 1% SDS 0.1 M NaHCO3. Eluates were pooled and heated at 65 C for 6 h to reverse the formaldehyde cross-linking. DNA fragments were purified once with 500 μl phenol/chloroform/isoamyl alcohol(25:24:1). The aqueous phase was retained and precipitated with isopropylalcohol and glycogen. For the PCR reaction, 1 ul from a 30-ul DNA extraction was used and cycles of amplification were performed with the following bam promoter-specific primers: 1. The forward primer: 5'- TCAAATTTCTTTAAATGCGCCCGGGTC- 3'

3 2. The reverse primer: 5'- GCCTTTTAAATCTTTCCTTATCGCCAG- 3'. FRET Analysis CFP- and YFP-tagged constructs were transfected into S2 cells. After 2 days post transfection, cells were washed with PBS, fixed with 4% formaldehyde for 10 min, and mounted on slides in 80% glycerol. Fluorescence signals were acquired by Zeiss LSM510 confocal microscope. Each data set was based on 15 individual cells. In each cell, at least five regions of interest in photobleached area or non-photobleached area were selected for analysis. dsrna Production for medea RNAi Knockdown About 500-bp medea DNA fragment were synthesized in a PCR reaction by using the following primers: 1. the sense primer, CATCGAGTCGCTGGTCAAAAAGCTC; 2. the antisense primer, GCTGTATGGTGCCGATGTCGTTGCC. The fragment was then fused to the T7 RNA polymerase binding site at both of 5 and 3 ends, which were used to generate the medea dsrna in vitro by using the RiboMAX Large Scale RNA Production Systems (Promega). Conditions for RNAi in Drosophila Cell Culture Drosophila S2 cells were diluted to a final concentration of 1 X 10 6 cells per ml in serum-free medium (Sigma). One milliliter of cells was plated per well of a six-well cell culture dish. 20 ųg of medea dsrna was added directly to the media.this was followed immediately by vigorous agitation. The cells were incubated for 30 min at room temperature followed by addition of 2 ml Schneider s media containing FBS. The cells were incubated for an additional 3-5 days to allow for turnover of the target protein.

4 Figure S1. Specificity Test of anti-ote Antibody A. Ovaries from ote mutant bearing a transgene P{oteP-flag:ote} were stained with anti-ote (green), anti-flag (red) antibodies, and Hoechst (blue). Aa-Ac showed Ote, Flag, and DNA pattern; respectively. Ad showed Flag protein co-localized with Ote in the merged image. B. Wild-type ovaries were stained with anti-ote antibody (green), anti-hp1 (red) antibody (gift from Dr. Fangling Sun), which shows specific nuclear staining pattern. Ba-Bb showed Ote (nuclear membrane), HP1 (nuclear) patterns; respectively. Bc showed the merged image. Scale bar represents 10 µm.

5 Figure S2. Loss of GSC in ote Mutant Is Not Due to Cell Death Ovaries from hs-flp/+;frtg13,ote B279 /FRTG13 flies treated by heat-shock induction were stained with anti-ote antibody (Red) (Ab, Bb) and Hoechst (Blue) (Ac, Bc), as well as labeled by TUNEL (Green) (Aa, Ba), showing that Ote- GSC clones (indicated by an arrow in the merged image) (Ad) were not apoptotic. As a control, a dying cyst was shown in B (indicated by an arrowhead in the merged image) (Bd). This finding suggests that ote is required for GSC self-renewal, rather than survival. Scale bar represents 10 µm.

6 Figure S3. Ote Might Not Be Important for the Nuclear Envelope Structure A showed ovaries from w 1118 flies were stained with anti-ote (green) and anti-lamin DM0 (red) antibodies. Aa and Ab showed Ote and lamin DM0 expression pattern; respectively. Ac indicates the merged image, which revealed that Ote co-localized with lamin DM0 in the nuclear membrane. B andc showed ovaries from w 1118 (B) and ote B279 (C) flies were stained with anti-vasa (green), anti-lamin DM0 (red) antibodies. Ba and Ca showed Vasa expression pattern, Bb and Cb showed lamin DM0 expression pattern; and Bc and Cc showed the merged images. Scale bar represents 10 µm.

7 Figure S4. FRET Assay of S2 Cells Expressing CFP:Med and YFP:Ote Constructs S2 cells were transfected with CFP:Ote and YFP:Med (or CFP:Ote and YFP, images not shown) constructs. CFP and YFP signals were acquired before and after photobleaching YFP at the top half of each cell as indicated in A. B shows the measurement of FRET as indicated.

8 Table S1. Clonal Analyses of ote Deficiency in GSCs FRT Control Ote EMS Ote B279 Genotypes hs-flp/+; hs-flp/+;frtg13,ubi-gfp/ hs-flp/+;frtg13,ubi-gfp/ FRTG13,ubi-gfp/FRTG13 FRTG13, Ote EMS FRTG13, Ote B279 Days after stopping heat shock % of marked GSCs Relative % of marked GSCs Total number of examined germaria Supplemental References Goldberg, M., Lu, H., Stuurman, N., Ashery-Padan, R., Weiss, A.M., Yu, J., Bhattacharyya, D., Fisher, P.A., Gruenbaum, Y., and Wolfner, M.F Interactions among Drosophila nuclear envelope proteins lamin, otefin, and YA. Molecular and cellular biology 18(7): Shang, Y., Hu, X., DiRenzo, J., Lazar M., and Brown M. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell, (6):