RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

Transcription

1 Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the A 260. For reverse transcription-pcr (RT-PCR) and real-time Q-PCR, 1 μg of RNA was reverse transcribed with SuperScript III reverse transcriptase in the presence of 250 ng of random primers (Invitrogen). PCR and realtime PCR were performed in a thermal cycler with the following conditions: RT- PCR Realtime PCR Gene Primer sequence Cycle Tm mouse Blimp1 human BLIMP1 mouse Snail human SNAIL mouse Bmp5 human BMP5 GAPDH (mouse+human) mouse Snail human SNAIL mouse Gapdh human GAPDH Fwd 5 -GCCAACCAGGAACTTCTTGTGT-3 Rev 5 -AGGATAAACCACCCGAGGGT-3 Fwd 5 -TCGGGTCGTTTACCCCATC-3 Rev 5 -CACAGCGCTCAGGCCATTA-3 Fwd 5 -ACATCCGAAGCCACACGCTG-3 Rev 5 -AGTGAGGAGGAGGGTGAGCT-3 Fwd 5 -GAAAGGCCTTCAACTGCAAA-3 Rev 5 -TGACATCTGAGTGGGTCTGG-3 Fwd 5 -TTACTTAGGGGTATTGTGGGCT-3 Rev 5 -CCGTCTCTCATGGTTCCGTAG-3 Fwd 5 -CCGGGATCTGGGATGGCAGGA-3 Rev 5 -TGGCAGCCACATGAGCGTACT-3 Fwd 5 -TCACCATCTTCCAGGAG-3 Rev 5 -GCTTCACCACCTTCTTG-3 Fwd 5 -CTGCTTCGAGCCATAGAACTAAAG-3 Rev 5 -GAGGGGAACTATTGCATAGTCTGT-3 Fwd 5 -AATCGGAAGCCTAACTACAGCG-3 Rev 5 -GTCCCAGATGAGCATTGGCA-3 Fwd 5 -GTGAAGCAGGCATCTGAGG-3 Rev 5 -CATCGAAGGTGGAAGAGTGG-3 Fwd 5 -TTGCCATCAATGACCCCTTCA-3 Rev 5 -CGCCCCACTTGATTTTGG ºC 27 60ºC 25 60ºC 30 56ºC 30 60ºC 30 60ºC 18 56ºC sirna knockdown analysis RNAi-mediated knockdown was performed with the following short interfering RNAs (sirnas) (QIAGEN, Valencia, CA):

2 Blimp1-1: 5 -GCAACTGGATGCGCTATGT-3 ; Blimp1-2: 5 -GATCTGACCCGAATCAATG-3 ; c-jun: 5 -GATCCTGAAACAGAGCATG-3 ; c-fos: 5 -TGGGTTCATTATTGGAATTAA-3 ; Fra-1: 5 -CTGACTGCCACTCATGGTG-3 ; Fra-2: 5 -TAGGATAGGTGAAGACGAGGTTCGA-3 ; c-raf: 5'- AACATCAGACAACTCTTATTG -3' AllStar negative control sirna (QIAGEN) was used in each experiment as a non-silencing control sirna (sicont). sirnas targeting Blimp-1 (5 nm for NMuMG, 10 nm for MDA-MB- 231 cells), c-raf (si c-raf: 20 nm) and AP-1 complexes (40 nm final) were introduced in cells using Lipofectamine RNAi Max Transfection Reagent (Invitrogen) by reverse transfection according to the manufacturer s protocol. Antibody Reagents Antibodies against RelB (sc-226), c-fos (sc-7202), Fra-1 (sc-183), Fra-2 (sc-604), Bcl-2 (sc-492), and Lamin B (sc-6217) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against c-jun (9165), P-Erk (Thr202/Tyr204) (9101), Snail (C15D3) and Blimp-1 (C14A4) were purchased from Cell Signaling (Danvers, MA). ERα (Ab-15) and Vimentin (Ab-2) antibodies were obtained from Thermo Scientific (Fremont, CA). E-Cadherin, N-Cadherin, Fibronectin and c-raf antibodies were purchased from BD Transduction Lab (Franklin Lakes, NJ). Antibody against mouse BMP-5 (AF6176) was purchased from R&D Systems. Antibodies against β-actin (AC-15) and β-tubulin (TUB 2.1) were purchased from Sigma. ChIP assay

3 For binding of AP-1 subunits, Hs578T cells were crosslinked with 1% formaldehyde at room temperature for 10 min and the reaction stopped by addition of glycine (125 mm final). After three washes in cold PBS, cell pellets were resuspended in ChIP lysis buffer (50 mm Hepes ph 7.5, 140 mm NaCl, 1% Triton X-100 plus protease inhibitor cocktail) and incubated 30 min on ice. Following sonication and centrifugation, the supernatants were incubated with 2 μg salmon sperm DNA, 150 μg BSA and 40 μl protein A-Sepharose for 2 h at 4 C and centrifuged to preclear. The resulting supernatants were immunoprecipitated overnight at 4 C with 2 μg c-jun (sc- 1694), c-fos (sc-52), Fra-1 (sc-605), Fra-2 (sc-604) antibodies plus 40 μl protein A-Sepharose and 2 μg salmon sperm DNA. Immunoprecipitates were washed sequentially for 5 min each time at 4 C with ChIP lysis buffer, ChIP lysis high salt buffer (50 mm Hepes ph 7.5, 500 mm NaCl, 1% Triton X-100), ChIP wash buffer (10 mm Tris ph 8, 250 mm LiCl, 0.5% NP40, 1 mm EDTA) and twice with TE buffer. Following elution in 50 mm Tris ph 8, 1% SDS, 10 mm EDTA at 65 C for 10 min, both the input and pooled eluates were incubated overnight at 65 C to reverse the crosslinking. DNA was purified with QIAquick PCR purification kit and 1 μl from 50 μl DNA extraction was used for PCR. PCR primers for ChIP analysis conditions were as follows: PRDM1 promoter containing the bp AP-1 binding site: Fwd 5 -GTTGCATGATGGTGTATGTGGCCT-3 Rev 5 -ATCCAGCCTGCTCAAGAGGGTTTA-3 94 C for 60 sec., 54 C for 45 sec. and 72 C for 30 sec.; for 40 cycles. PRDM1 promoter that does not carry any AP-1 site (negative control): Fwd 5 -TCCTTCCCTGTGTTTGGTCCCATT-3 Fwd 5 -ATTGTTTCCTTCAAGCAGGCACCC-3

4 94 C for 60 sec., 54 C for 45 sec. and 72 C for 30 sec.; for 40 cycles. The Blimp-1 ChIP assay for the BMP5 promoter was performed using an EZ-ChIP kit (Millipore Corporation, Billerica, MA), according to the manufacturer s instructions. MDA-MB-231 cells were transfected with pcdna4/blimp1-v5-tag expression vector and ectopic expression confirmed by Western blot analysis (data not shown). After 24 h, formaldehyde (1% final) was added to the cell culture medium. Whole cell lysates were sonicated for 15 cycles of 15 sec each. After preclearing with ChIP grade Protein G-agarose, 100 μl of sheared DNA-protein complexes were immunoprecipitated with two different mouse monoclonal antibodies against V5 epitope (Invitrogen and Sigma), respectively, or normal mouse IgG (Millipore). The crosslinking was reversed and genomic DNA fragments purified with a QIAquick PCR purification kit as above. Four putative Blimp1 binding sites at -63, -116, -765, and -966 bp (labeled sites 1, 2, 3, and 4, respectively) were identified by analyzing 1 kb genomic region upstream of the BMP5 transcription start site using TransFac (genomatix.de). Due to the close proximity of the sites, primer sets were designed to amplify the two regions: The sequences of putative sites 1 and 2 are: CTTTACCAGTTTCAAATTA and AATTGTGAAAATGGAGACT. The corresponding primer set is as the following: Fwd 5 -CACTGTTTCATGTTAGATGCGTGG-3 Rev 5 -TAAGCACAACCCTGCTGGGAAAGA-3 The sequences of putative sites 3 and 4 are: AAAACTCAAATTTCAATCTG and GACAATGAAAGTATTGTGA. The corresponding primer set is as the following: Fwd 5 -GAAACAAGAAACCAGGCGCCTCTA-3 Rev 5 -CGTCATGACTACATGCAGATTGAAA-3

5 The GAPDH promoter, which does not contain any known Blimp-1 sites was used as a negative control: Fwd 5 -TACTAGCGGTTTTACGGGCG-3 Rev 5 -TCGAACAGGAGGAGCAGAGAGCGA-3 Conditions used for PCR of these sites: 94 C for 20 sec., 58 C for 30 sec. and 72 C for 30 sec.; for 29 cycles. Immunofluorescence microscopy NMuMG cells were plated on glass coverslips. Following treatment for 48 h with TGF-β1 or BMP-5 alone or in combination, cells were washed with PBS and fixed by incubation at room temperature in 2% electron microscopy-grade paraformaldehyde (EMS), 1x PBS, 5 mm MgCl 2 for 15 min, rinsed in PBS and stored in 70% ethanol at 4 C until use. For immunofluorescence analysis, cells were rehydrated in PBS and permeabilized with 0.5% Triton X-100 in PBS. Cells were subsequently washed in PBS, blocked by incubation in Buffer A (2% (w/v) bovine serum albumin (Sigma) in PBS) and incubated for 1 h with primary mouse antibody against E-Cadherin (610182, BD Transduction Lab) diluted in Buffer A. Following washing, the coverslips were incubated for 1 h in Alexa 488-labeled secondary antibody (A21200, Invitrogen) diluted in Buffer A. Following washing, the coverslips were mounted in Vectashield with 4,6-diamidino- 2-phenylindole (DAPI; H-1200, Vector Laboratories). Fluorescence microscopy was performed using a Nikon 80i Upright Research Fluorescence Scope with Andoe Clara-E Camera and NIS- Elements Basic software with a 40x objective. The images are representative of two independent experiments.