Third-Generation Antisense (3GA) Technology: Insights into Mechanism of Action Reina Improgo, Ph.D. Idera Pharmaceuticals

Transcription

1 Third-Generation Antisense (3GA) Technology: Insights into Mechanism of Action Reina Improgo, Ph.D. Idera Pharmaceuticals Oligonucleotide and Peptide Therapeutics March 27, 2017

2 First generation antisense Phosphorothioate chemistry was the first chemical modification applied to antisense technology Increased tissue bioavailability Over 2 dozen compounds advanced to clinical development and then discontinued Unintended immune activation observed; Toll-like Receptors (TLRs) had not yet been discovered Discovery of TLR9 explained why the presence of CG motifs led to immune activation Raised questions on whether anti-viral and anti-cancer activity were due to immune activation rather than antisense mechanism of action Agrawal, S et al., Proc. Natl. Acad. Sci. USA, (1988) ; Agrawal, S et al., Proc. Natl. Acad. Sci. USA, (1989) ; Agrawal, S et al., Proc Natl Acad Sci USA. (1991) ; Galbraith, WM et al., Antisense Res Dev. (1994) ; Zhang, R et al., Clin Pharmacol Ther. (1995) 44-53; Agrawal, S et al., J Immunol. (2003) 1621.

3 Chemistry of second generation antisense pioneered by Idera PS-DNA allowed RNase H cleavage 2 -O-substituted RNA provided metabolic stability and binding to RNA Reduced immune stimulation OCH 3 OCH 3 Metelev, V et al., Bioorg. Med. Chem. Lett. (1994) ; Zhang, R et al., Biochem Pharmacol. (1995) Agrawal, S et al., Biochem Pharmacol. (1995) 571-6; Yu, D et al., Bioorg Med Chem. (1996) Agrawal, S et al., Antisense Nucleic Acid Drug Dev. (1997) ; US Patent # 5,652,355.

4 Second generation antisense is the most successful chemistry to date, however, limitations exist Clinical proof of concept established against multiple RNA targets Limited therapeutic index Injection site reactions Flu-like symptoms Hepatotoxicity Thrombocytopenia Immunotoxicity

5 Nucleic acids and immune receptors Desmet, et al. Nat Rev Immunol Jun 22;12(7):479-91

6 Idera s pipeline of candidates

7 Third generation antisense design First generation Second generation Third generation, 3GA

8 Activation of TLR9 requires 5 -end accessibility

9 Linking two antisense sequences via their 5 ends abrogates immune activation BCL2 as representative target Sequences: Bcl2 antisense: Bcl2 3GA: 5 -TCTCCCAGCGTGCGCCAT-3 3 -TACCGCGTGCGACCCTCT-X-TCTCCCAGCGTGCGCCAT-3 Same Bcl2 sequence comparing 3GA vs. antisense dose response 3GA

10 Summary of 3GA design Lack of accessible 5 - ends abrogates immune activation 1,2,3,4,5 Accessible 3 - ends allows degradation and clearance 6 Phosphorothioate backbone confers stability and bioavailability 19- to 21-mer length is optimal for targeting RNA 1 1 Bhagat, L et al., J Med Chem (2011) Yu, D et al., Bioorg Med Chem Lett (2000) ; 3 Kandimalla, E et al., Bioconjugate Chem. (2002) ; 4 Yu, D et al., Nucleic Acid Res (2002) ; 5 Putta, M et al., Bioconjugate Chem Temsamani, J et al., Ann N Y Acad Sci. (1992) U.S. patent #8,431,544 issued to Idera in 2013.

11 3GA Studies Using PCSK9 as a Target

12 Structure and chemistry of compounds used in this study Target Site Phosphorothioate Hybrid/Gapmer 5-5 -Linked 3-3 -Linked Tandem Repeat sirna Duplex

13 Comparative gene-silencing activity of 3GA, 1GA, and 3-3 linked control in cell-based assays

14 % PCSK9 Knockdown Relative to PBS % P C S K 9 K n o c k d o w n R e la tiv e to P B S In vivo dose-dependent activity of 3GA targeting PCSK9 Treatment Period PCSK9 3GA, s.c GA, mg/kg 3 G A, m g /k g C57/BL6 Day Gene Silencing Effect Measurement of PCSK9 mrna in liver

15 % PCSK9 Knockdown Relative to PBS % P C S K 9 K n o c k d o w n R e la tiv e to P B S % PCSK9 Knockdown Relative to PBS % P C S K 9 K n o c k d o w n % P R C e S la K tiv 9 K e n to o c P k B d S o w n R e la tiv e to P B S In vivo activity of 3GA is sustained up to 12 days posttreatment Treatment Period 15 mg/kg, s.c. % P C S K 9 K n o c k d o w n C57/BL6 R e la tiv e to P B S Day Treatment Period 44 DDa ay ys s PPo os t-t s t-t r er ae tm a tme ne tn t 4 Days Post-Treatment 1GA 11G GA A 2GA 2 G2 GA A 3GA 3 G3 GA A 0 Gene Silencing Effect Measurement of PCSK9 mrna in liver D ad yas yps ops ot-t s t-t r e ar tm e a tm e n te n t 12 Days Post-Treatment 1 G1 1GA AG A 2 G22GA AG A 3 G3GA 3A G A

16 Intact Oligos in Liver (mg/g) Sustained activity of 3GA in vivo is not associated with increased tissue accumulation Treatment Period 15 mg/kg, s.c. C57/BL6 Day Treatment Period Tissue Accumulation in Liver Measurement of intact oligos by HPLC L iv e r A c c c u m u la tio n Liver Accumulation GA 1 G A 22GA G A 33GA G A

17 Insights into the Mechanism of Action of 3GA

18 Two major mechanisms of gene silencing Antisense RNAi

19 Elucidating the mechanism of action of 3GA by analysis of targeted RNA cleavage products Analysis of Cleavage Products

20 RLM-RACE m 7 G Cleaved RNA AAAA Adapter AAAA Ligation of RACE Adapter to 5 End of Cleaved RNA Adapter AAAA cdna Synthesis Adapter 1 st Round PCR using 5 RACE Outer Primer and 3 Gene-Specific Outer Primer Adapter 2 nd Round PCR using 5 RACE Inner Primer and 3 Gene-Specific Inner Primer Gel Analysis, Cloning, and Sequencing Sequence Analysis

21 Sites of RLM-RACE target and primers Mouse PCSK9 mrna 661 uguggugcug auggaggaga cccagaggcu acagauugaa caaacugccc accgccugca 721 gacccgggcu gcccgccggg gcuaugucau caagguucua cauaucuuuu augaccucuu 781 cccuggcuuc uuggugaaga ugagcaguga ccuguugggc cuggcccuga aguugcccca 841 uguggaguac auugaggaag acuccuuugu cuucgcccag agcaucccau ggaaccugga 901 gcgaauuauc ccagcauggc accagacaga ggaagaccgc uccccugaug gaagcagcca 961 gguggaggug uaucucuuag auaccagcau ccagggugcc caucgggaga uugagggcag

22 % P C S K 9 K n o c k d o w n % PCSK9 Knockdown Relative to Untreated Control R e la tiv e to U n tr e a te d C o n tr o l Various antisense compounds used for RLM-RACE analysis A n tis e n s e C o m p o u n d Hepa1-6 cells were transfected with 50 nm oligos using Lipofectamine After 16 hours, RNA was isolated and PCSK9 expression was measured via qpcr using TagMan probes (ThermoFisher).

23 Cleavage sites observed with 1GA, 2GA, and 3GA 90% 1GA 2GA 2/10 3/10 4/10 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCTGG-5 90% 2/10 4/10 3/10 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCUGG-5 97% 3GA 25/27 1/27 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCTGG-X Numerator indicates number of sequences cleaved at the indicated site (arrowhead). Denominator indicates total number of sequences cleaved within the target site (underlined).

24 3GA cleavage sites are different from those of control compounds 97% 3GA 25/27 1/27 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCTGG-X Control AUUGUGGUGCUGAUGGAGGAGACCCAGAG X-CCACGACTACCTCCTCTGG 1/1 Control AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCTGG 1/1 Numerator indicates number of sequences cleaved at the indicated site (arrowhead). Denominator indicates total number of sequences cleaved within the target site (underlined).

25 Cleavage sites observed with 3GA are in a similar region as observed with sirna 97% 3GA 25/27 1/27 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG CCACGACTACCTCCTCTGG-X 100% sirna 17/30 11/30 1/30 1/ AUUGUGGUGCUGAUGGAGGAGACCCAGAG dtdtccacgacuaccuccucugg-5 Numerator indicates number of sequences cleaved at the indicated site (arrowhead). Denominator indicates total number of sequences cleaved within the target site (underlined).

26 Hypothesis: central region of 3GA is involved in cleavage

27 Insertion of a single mismatch in the central region of 3GA 3GA MM9 MM10 MM11 3 -CCACGACTACCTCCTCTGG-X-GGTCTCCTCCATCAGCACC-3 3 -CCACGACTACATCCTCTGG-X-GGTCTCCTACATCAGCACC-3 3 -CCACGACTAACTCCTCTGG-X-GGTCTCCTCAATCAGCACC-3 3 -CCACGACTTACTCCTCTGG-X-GGTCTCCTCCTTCAGCACC-3

28 3GA activity is impacted by the insertion of mismatches at the 9 th, 10 th, and 11 th positions Sites of mismatches in 3GA Sites of mismatches in 1GA 1GA MM9 MM10 MM11-5

29 In vivo activity of 3GA is impacted by the insertion of sitespecific mismatches at 9 th, 10 th, and 11 th positions PCSK9 C57/BL6 Treatment Period 15 mg/kg 3GA, s.c. Day Treatment Period Gene Silencing Effect Measurement of PCSK9 mrna in liver

30 In vivo activity of 3GA is significantly impacted by the insertion of site-specific mismatches at 9 th, 10 th, and 11 th positions ApoB C57/BL6 Treatment Period 15 mg/kg 3GA, s.c. Day Treatment Period Gene Silencing Effect Measurement of ApoB mrna in liver Compounds were targeted against mapob nucleotides

31 RLM-RACE for mpcsk9 3GA with a single mismatch at the 10 th position in vivo

32 Specificity of 3GA allows targeting of point mutations

33 % B R A F W T E x p r e s s io n R e la tiv e to U n tr e a te d C o n tr o l WT 3GA but Not V600E 3GA Silences WT Expression HCT116 Colorectal Carcinoma (Homozygous WT) + WT 3GA + V600E 3GA W T 3 G A V E 3 G A HCT116 cells were treated with WT 3GA or V600E 3GA using Lipofectamine After 16 hours, cell lysate was prepared and RNA was isolated. BRAF WT levels were measured via qpcr.

34 % B R A F V E E x p r e s s io n R e la tiv e to U n tr e a te d C o n tr o l V600E 3GA but Not WT 3GA Silences V600E Expression MCF10A BRAF V600E CompoZr Breast Epithelial Cells (Homozygous Mutant) x + WT 3GA + V600E 3GA W T 3 G A V E 3 G A MCF10A V600E cells were treated with WT 3GA or V600E 3GA using Lipofectamine After 16 hours, cell lysate was prepared and RNA was isolated. BRAF V600E levels were measured via qpcr.

35 % B R A F V E E x p r e s s io n R e la tiv e to U n tr e a te d C o n tr o l C a s p a s e 3 /7 A c tiv ity (% P B S C o n tr o l) V600E 3GA but Not WT 3GA Silences V600E Expression MCF10A BRAF V600E CompoZr Breast Epithelial Cells (Homozygous Mutant) x + WT 3GA + V600E 3GA W T 3 G A V E 3 G A -8 8 W T 3 G A V E 3 G A MCF10A V600E cells were treated with WT 3GA or V600E 3GA using Lipofectamine After 16 hours, cell lysate was prepared and RNA was isolated. BRAF V600E levels were measured via qpcr.

36 BRAF V600E Mutation BRAF is an oncogene that is mutated in about 15% of cancers BRAF V600E is the most common BRAF mutation. Human BRAF mrna 1781 gucaaucauc cacagagacc ucaagaguaa uaauauauuu cuucaugaag accucacagu 1841 aaaaauaggu gauuuugguc uagcuacagu gaaaucucga uggagugggu cccaucaguu 1901 ugaacaguug ucuggaucca uuuuguggau gtcatcagaa tgcaagataa aaatccatac U>A V600 E Mutation GUG Wild Type codon GAG V600E mutation codon WT BRAF 3GA : 3 -TCGATGTCACTTTAGAGCT-X-TCGAGATTTCACTGTAGCT-3 V600E BRAF 3GA: 3 -TCGATGTCTCTTTAGAGCT-X- TCGAGATTTCTCTGTAGCT-3

37 MYD88 L265P MYD88 is an adaptor protein activated downstream of TLR signaling. MYD88 L265P is a recurrent mutation in hematologic malignancies. WT 3GA: 3 -CTTCGCTGACTAGGGGTAG-X-GATGGGGATCAGTCGCTTC-3 L265P 3GA: 3 -CTTCGCTGGCTAGGGGTAG-X-GATGGGGATCGGTCGCTTC-3

38 % M Y D 8 8 E x p re s s io n R e la tiv e to U n tr e a te d C o n tr o l L265P 3GA Silences L265P But Not WT Expression OCI-Ly10 Cells (Heterozygous) x + L265P 3GA WT Expression L265P Expression OCI-Ly10 cells were treated with WT 3GA or L265P 3GA using Lipofectamine RNAiMax. After 48 hours, cell lysate was prepared and RNA was isolated. BRAF WT levels were measured via qpcr.

39 Summary 3GA is a novel structure. 3GA exerts potent gene-silencing activity in cell-based assays as well as in vivo. Sustained gene-silencing activity of 3GA in vivo is not associated with tissue build-up. 3GA generates cleavage sites in the target RNA in a similar region as that observed with sirna. The mechanism of 3GA renders specificity in targeting RNA. Specificity and mechanism of 3GA allows allele-specific targeting.

40 Acknowledgements Sudhir Agrawal Wayne Jiang Lakshmi Bhagat Sharanya Iyengar Evren Kocabas Argon Mallikarjuna Putta Dong Yu Jimmy Tang Irek Nowak Daqing Wang