T H E J O U R N A L O F C E L L B I O L O G Y

Transcription

1 Supplemental material Laloux and Jacobs-Wagner, T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Supporting data on the PopZ variants. Related to Fig. 2, Fig. 3, and Fig. 4. (A) Western blot detection of PopZ-YFP variants produced in wildtype and popz cells. Expression of popz-yfp variants was induced in wild-type cells (top) and popz cells (bottom) with xylose 0.03% in M2G medium for 5 h. Volumes of samples loaded on the gel were proportional to the OD of the culture. The YFP fusions were detected with an anti-gfp antibody. Molecular mass markers are shown. White lines indicate when lanes were reordered for display purposes. Image contrast was not modified. All PopZ-YFP variants were produced in wild-type cells (with only minor degradation products), although C and H3H4 were present in comparatively lower amounts. Similar profiles were obtained when the PopZ-YFP variants were produced in the popz strain, except that the bands corresponding to C-YFP and H3H4-YFP were relatively fainter in popz samples, indicating a lower protein amount (see also B and C). Strains (wild-type popz background/ popz background) and expected molecular masses are as follows: CB15N/CJW2238, which do not carry YFP fusion (none); CJW3693/CJW3707 for full-length (48.6 kd); CJW3695/CJW3709 for H3H4 (43.5 kd); CJW3696/CJW3710 for C (40.9 kd); CJW3801/CJW3804 for N (32.4 kd); CJW3694/CJW3708 for N (46.3 kd); CJW3697/CJW3711 for C (37.3 kd); CJW3802/CJW3805 for H3H4 (35.6 kd); CJW3816/CJW3818 for H2 (46.9 kd); and CJW4023/CJW4407 for free YFP (26.9 kd). (B) Comparison of fluorescence intensities within populations of cells producing the xylose-induced C-YFP or H3H4-YFP variants or the natively produced PopZ-YFP. Shown are distributions of normalized fluorescence intensity per cell for each strain as indicated. Cells were grown exponentially in M2G. The synthesis of C-YFP and H3H4-YFP was induced with xylose 0.03% for 5 h before imaging. For each cell, the total fluorescence intensity was normalized by the cell area. A.U., arbitrary units. Images were all obtained on the same day using the same acquisition settings such that fluorescence intensities are comparable. Strains are as follows: CJW2245 for PopZ-YFP, native promoter; CJW3711 for C-YFP, Pxyl promoter; and CJW3802 for H3H4-YFP, Pxyl promoter. (C) Fraction of cells with foci for cells having a normalized fluorescence intensity comprised within the overlap range shown in B. Analysis was performed on the set of images used in B. Only cells having a normalized fluorescence intensity between and arbitrary units were considered. Cell counts are indicated for each strain (n). (D) The H3H4 variant of PopZ-TC does not accumulate in a large area when overproduced in wild-type C. crescentus. PopZ-TC or H3H4-TC overproduction was induced with xylose 0.3% for 6 h in CJW3924 or CJW3921, respectively, before FlAsH staining. (E) Localization of PopZ-TC variants in E. coli. Cells were grown exponentially in LB, and the synthesis of PopZ-TC variants was induced with arabinose 0.02% for 3.5 h before FlAsH staining. Strains are as follows: CJW3991 for full-length; CJW4622 for N; CJW3995 for H2-TC; and CJW3996 for H3H4. Note that all TC fusions were at the C terminus except for N, which was tagged at the N terminus because the C-terminal fusion was unstable. Bars, 2 µm. Control of PopZ localization in time and space Laloux and Jacobs-Wagner S1

2 Figure S2. The expanded matrix formed by overproduced PopZ-TC can be detected by phase-contrast microscopy. Cells (CJW4410) were grown exponentially in PYE supplemented with xylose 0.3% for 5 h to induce the overexpression of popz-tc from a medium-copy plasmid and the expression of mcherry from the chromosome. PopZ-TC and DNA were labeled with FlAsH and DAPI, respectively. Cells were imaged by phase-contrast microscopy. (A) Phase-contrast, FlAsH, DAPI, and mcherry signals of a representative cell overproducing PopZ-TC. The cell outline is shown with the fluorescent signals. The arrows delimit the area that appears lighter in phase contrast and that matches with the FlAsH signal and the DNA-free area. The free mcherry signal fills the whole cell, including the PopZ-TC rich area. Bar, 4 µm. (B) Fluorescence intensity profiles for DAPI, FlAsH, and mcherry in the cell outlined in A. The total fluorescence intensity was obtained for each segment along the cell length and normalized by segment area. The portion of the cell between 14 and 17 µm corresponds to the PopZ-TC rich region, characterized by a higher FlAsH signal intensity and a lower DAPI signal intensity, whereas the mcherry signal does not vary in that area compared with the rest of the cell. A.U., arbitrary units. (C) Phase-contrast microscopy profile of the cell outlined in A. The total phase signal intensity was obtained for each segment along the cell length and normalized by segment area. The area comprised between 14 and 17 µm that corresponds to the PopZ-TC rich region appears lighter. S2

3 Figure S3. Cellular concentration of PopZ and fraction of its diffusing pool during the cell cycle. Swarmer cells (CJW2245) were grown in M2G and imaged every 20 min. For each time point, the fluorescence intensity of PopZ-YFP was measured for 325 cells. (A) The concentration of PopZ-YFP was obtained by normalizing the total fluorescence intensity per cell by cell area. A.U., arbitrary units. (B) The fraction of cytoplasmic PopZ-YFP was calculated by dividing the fluorescence intensity that is not localized in polar foci by the total fluorescence intensity. Error bars show standard deviations. Control of PopZ localization in time and space Laloux and Jacobs-Wagner S3

4 Figure S4. Data supporting the experiments on novobiocin-treated, TipN-depleted, and A22-treated cells. Related to Fig. 5 and Fig. 6. (A and B) Time course detection of PopZ-YFP produced as a single copy from the native locus in novobiocin-treated cells. Swarmer CJW2237 cells were harvested and grown in M2G medium with or without 25 µg/ml novobiocin and imaged every 30 min. The fraction of cells with two PopZ-YFP foci (A) or two CFP-ParB foci (B) was quantified for each time point. Means from three independent experiments per condition are shown. Error bars show SEM. (C) Histograms of fluorescence intensity (normalized by cell area) and cell length for populations of CJW2237 (top) or CJW2214 (bottom) novobiocin-treated cells displaying one or two PopZ-YFP foci, from a time course experiment described in A and B or in Fig. 5 A, respectively. The number of PopZ-YFP foci was obtained for each cell from all time points. For all cells with either one focus or two foci, the total fluorescence intensity (normalized by cell area) associated with the PopZ-YFP signal was calculated (A.U., arbitrary unit; top), and the cell length (micrometers) was obtained (bottom). Shown are the distributions of those values in the corresponding cell populations. (D) The initiation of DNA replication and the appearance of a PopZ focus at the new pole are not well correlated in tipn cells. Swarmer cells of CJW4774 were grown on a M2G agarose pad. PopZ-YFP and DnaN-CFP were imaged in a time-lapse experiment every 4 min. For each cell, the cell length at which two PopZ-YFP foci (x axis) or at least one DnaN-CFP focus (indicative of DNA replication; y axis) is detected for the first time was recorded. Each dot represents one cell. Correlation coefficient (r), p-value, and cell count (n) are indicated. (E H) The delay in the formation of a second PopZ polar focus in A22-treated cells can be explained by a general delay in cell cycle progression. (E) Synchronized CJW2266 cells were grown on M2G agarose pads in the presence or absence of 10 µm A22. A different subset of cells was imaged every 30 min. The mean cell length was calculated for each time point. The means of four independent experiments are shown. Error bars show SEM. (F) Representative cells from one experiment described in E are shown for each time point, under untreated and A22-treated conditions. Red arrows point to bipolar YFP-PopZ foci. Bar, 2 µm. (G) The fraction of cells with bipolar YFP-PopZ was obtained for each time point in four independent experiments described in E. The mean for each time point is shown. Error bars show SEM. (H) Synchronized CJW2618 cells were grown on M2G agarose pads in the presence of 10 µm A22 and imaged every 5 min. For each cell, the cell length at which PopZ-YFP (x axis) or MipZ-CFP (y axis) reached the new pole was recorded. Each dot represents one cell (n = 155). Correlation coefficient (r) and p-value are indicated. S4

5 Figure S5. Expanded selective matrix formed by the N PopZ variant as well as supporting data for the experiments on ParA K20R -producing C. crescentus cells and on the DivIVA fusions in E. coli. Related to Fig. 7. (A) Formation of DNA-free LRI areas upon overproduction in C. crescentus. Overproduction of PopZ-TC or N-TC was induced in wild-type C. crescentus for 6 h with xylose 0.3% in PYE medium. Cells were stained with FlAsH (for the localization of TC fusions) and DAPI (for DNA labeling) and were imaged by DIC microscopy to visualize the characteristic DNA-free LRI polar regions. Brackets delimit examples of LRI areas. Insets show a zoomed example of an LRI area. Strains are as follows: CJW3921 for full-length and CJW3922 for N. (B) Localization of free mcherry in cells overproducing PopZ-TC or N-TC. Cultures were supplemented with xylose 0.3% for 5 h to induce the overproduction of the PopZ-TC variants as well as the synthesis of free mcherry. TC fusions were visualized with FlAsH. Strains are as follows: CJW4410 for full-length and CJW4411 for N. Brackets delimit the PopZ-TC rich (top) or N-TC rich (bottom) area. (C) Kymograph of CFP-ParB and PopZ-YFP in a representative ParA K20R -producing cell as in Fig. 7 F. (D) DivIVA-GFP producing E. coli cells (CJW4906) were grown, stained, and imaged in the same conditions as in Fig. 7 I. (E) CJW4917 cells producing DivIVA-ParA R195E -CFP were grown as in Fig. 7 I except that cells were kept in M9 + glucose instead of being washed in arabinose-containing medium, to keep popz-tc expression repressed. Staining and imaging were performed as in Fig. 7 I. (F) DivIVA-VirB10 producing cells (CJW4919) were grown, stained, and imaged in the same conditions as in Fig. 7 I. Arrows point at PopZ-TC rich LRI regions. (G) CJW4920 cells were grown, induced, and imaged in the same conditions as in Fig. 7 J. Representative cells are shown for selected time points. Bars: (A, main images) 4 µm; (A, insets) 1 µm; (B and G) 2 µm; (D F) 5 µm. Control of PopZ localization in time and space Laloux and Jacobs-Wagner S5

6 Table S1. Strains used in this study Strain name Relevant genotype or features Reference Construction method C. crescentus strains CB15N Synchronizable variant of wild-type CB15, also named NA1000 Evinger and Agabian, 1979 CJW2214 CB15N popz parb::cfp-parb xylx::pxmyfp4-popz Ebersbach et al., 2008 CJW2226 MC1000/pNDM220-cfp-parB Ebersbach et al., 2008 CJW2237 CB15N parb::cfp-parb popz::pbgent-popz-yfp Ebersbach et al., 2008 CJW2238 CB15N popz Ebersbach et al., 2008 CJW2245 CB15N popz::pbgent-popz-yfp Ebersbach et al., 2008 CJW2249 CB15N popz parb::cfp-parb Ebersbach et al., 2008 CJW2266 CB15N xylx::pxmyfp4-popz Ebersbach et al., 2008 CJW2618 CB15N mipz::mipz-cfp popz::pbgent-popz-yfp G. Ebersbach a CJW3544 CB15N tipn xylx::phl32pxyltipn mipz::mipz-cfp popz:: pbgent-popz-yfp W. Schofield b CJW3693 CB15N xylx::pxyfpc-2 popz Mating between CB15N and S17-1/ pxyfpc-2 popz CJW3694 CB15N xylx::pxyfpc-2 popz N Mating between CB15N and S17-1/ pxyfpc-2 popz N CJW3695 CB15N xylx::pxyfpc-2 popz H3H4 Mating between CB15N and S17-1/ pxyfpc-2 popz H3H4 CJW3696 CB15N xylx::pxyfpc-2 popz C Mating between CB15N and S17-1/ pxyfpc-2 popz C CJW3697 CB15N xylx::pxyfpc-2 popzc Mating between CB15N and S17-1/ pxyfpc-2 popzc CJW3707 CB15N popz xylx::pxyfpc-2 popz Mating between CJW2238 and S17-1/ pxyfpc-2 popz CJW3708 CB15N popz xylx::pxyfpc-2 popz N Mating between CJW2238 and S17-1/ pxyfpc-2 popz N CJW3709 CB15N popz xylx::pxyfpc-2 popz H3H4 Mating between CJW2238 and S17-1/ pxyfpc-2 popz H3H4 CJW3710 CB15N popz xylx::pxyfpc-2 popz C Mating between CJW2238 and S17-1/ pxyfpc-2 popz C CJW3711 CB15N popz xylx::pxyfpc-2 popzc Mating between CJW2238 and S17-1/ pxyfpc-2 popzc CJW3801 CB15N xylx::pxyfpc-2 popzn Transformation of CB15N with pxyfpc-2 popzn CJW3802 CB15N xylx::pxyfpc-2 popzh3h4 Transformation of CB15N with plasmid from pxy- FPC-2 popzh3h4 CJW3804 CB15N popz xylx::pxyfpc-2 popzn Mating between CJW2238 and S17-1/ pxyfpc-2 popzn CJW3805 CB15N popz xylx::pxyfpc-2 popzh3h4 Mating between CJW2238 and S17-1/ pxyfpc-2 popzh3h4 CJW3816 CB15N xylx::pxyfpc-2 popz H2 Mating between CB15N and S17-1/ pxyfpc-2 popz H2 CJW3818 CB15N popz xylx::pxyfpc-2 popz H2 Mating between CJW2238 and S17-1/ pxyfpc-2 popz H2 CJW3921 CB15N/pJS14-pxyl-popZ-TC Transformation of CB15N with pjs14-pxyl-popz-tc CJW3922 CB15N/pJS14-pxyl-popZ N-TC Transformation of CB15N with pjs14-pxyl-popz N- TC CJW3924 CB15N/pJS14-pxyl-popZH3H4-TC Transformation of CB15N with pjs14-pxyl-pop- ZH3H4-TC CJW4023 CB15N xylx::pxyfpc-2 Transformation of CB15N with pxyfpc-2 CJW4407 CB15N popz xylx::pxyfpc-2 Mating between CJW2238 and S17-1/pXYFPC-2 CJW4410 CB15N xylx::pxchyc-2/pjs14-pxyl-popz-tc Mating between CJW3921 and S17-1/pXCHYC-2 CJW4411 CB15N xylx::pxchyc-2/pjs14-pxyl-popz N-TC Mating between CJW3922 and S17-1/pXCHYC-2 CJW4432 CB15N popz xylx::pxtcyc-2 popz N Mating between CJW2238 and S17-1/pXTCYC- 2 popz N CJW4441 CJW4613 CB15N parb::cfp-parb popz::pbgent-popz-yfp xylx::px- CHYC-2 para K20R Mating between CJW2237 and S17-1/pXCHYC- 2 para K20R CB15N para::para-yfp popz::pcfpc-4 popz xylx::pxt- Successive transductions of popz::pcfpc-4 popz CYC-2 para K20R and xylx::pxtcyc-2 para K20R into CJW3010 (Schofield et al., 2010) CJW4626 CB15N para::para-yfp popz::pcfpc-4 popz Transduction of popz::pcfpc-4 popz into CJW3010 (Schofield et al., 2010) CJW4721 CB15N parb::cfp-parb popz::pbgent-popz-yfp dnan:: pchyc-1 dnan Transduction of dnan::pchyc-1 dnan into CJW2237 S6

7 Table S1. Strains used in this study (Continued) Strain name Relevant genotype or features Reference Construction method CJW4745 CB15N popz parb::cfp-parb/pjs14-pxyl-popz N-TC Mating between CJW2249 and S17-1/pJS14-pxylpopZ N-TC CJW4746 CB15N popz parb::cfp-parb/pjs14-pxyl-popz-tc Mating between CJW2249 and S17-1/pJS14-pxylpopZ-TC CJW4768 CB15N popz vana::pvcfpc-4 para R195E Mating between CJW2238 and S17-1/ pvcfpc-4 para R195E -CFP CJW4769 CJW4770 CJW4774 CJW4845 CJW4846 E. coli strains CB15N popz xylx::pxyfpc-2 popz vana::pvcfpc- 4 para R195E Mating between CJW3707 and S17-1/ pvcfpc-4 para R195E CB15N popz xylx::pxyfpc-2 popz N vana::pvcfpc- Mating between CJW3708 and S17-1/ 4 para R195E pvcfpc-4 para R195E CB15N tipn popz::pbgent-popz-yfp dnan::pcfpc- 1 dnan CB15N popz vana::pvcfpc-4 para R195E /pjs14-pxylpopz-tc CB15N popz vana::pvcfpc-4 para R195E /pjs14-pxylpopz N-TC MC1000 F 2 Q2 arad139 (ara,leu)7697 (lac)chi74 galu 2 galk 2 rpsl S17-1 M294::RP4-2 (Tc::Mu)(Km::Tn7); for conjugative transfer (mating) Casadaban and Cohen, 1980 Simon et al., 1983 Successive transductions of popz::pbgent-popz-yfp and dnan::pcfpc-1 dnan into CJW1407 (Lam et al., 2006) Mating between CJW4768 and S17-1/pJS14-pxylpopZ-TC Mating between CJW4768 and S17-1/pJS14-pxylpopZ N-TC CJW3991 MC1000/pNDM220-cfp-parB/pBAD33-popZ-TC Transformation of CJW2226 with pbad33-popz-tc CJW3995 MC1000/pNDM220-cfp-parB/pBAD33-popZ H2-TC Transformation of CJW2226 with pbad33- popz H2-TC CJW3996 MC1000/pNDM220-cfp-parB/pBAD33-popZH3H4-TC Transformation of CJW2226 with pbad33-pop- ZH3H4-TC CJW3997 MC1000/pNDM220-cfp-parB/pBAD33-popZ-yfp Transformation of CJW2226 with plasmid from pbad33-popz-yfp CJW4001 MC1000/pNDM220-cfp-parB/pBAD33-popZ H2-yfp Transformation of CJW2226 with pbad33- popz H2-yfp CJW4002 MC1000/pNDM220-cfp-parB/pBAD33-popZH3H4-yfp Transformation of CJW2226 with pbad33-pop- ZH3H4-yfp CJW4622 MC1000/pNDM220-cfp-parB/pBAD33-TC-popZ N Transformation of CJW2226 with pbad33-tcpopz N CJW4659 MC1000/pNDM220-cfp-parB/pBAD33-yfp-popZ N Transformation of CJW2226 with pbad33-yfppopz N CJW4673 MC1000 rpla::rpla-gfp/pbad33-popz-tc Transformation of MC1000 rpla::rpla-gfp (unpublished data) with pbad33-popz-tc CJW4684 MC1000/pNDM220-cfp-parB/pBAD33-popZ C-yfp Transformation of CJW2226 with pbad33-popz Cyfp CJW4685 MC1000/pNDM220-cfp-parB/pBAD33-popZN-yfp Transformation of CJW2226 with pbad33-popznyfp CJW4744 MC1000/pKS-mcfp-N2/pBAD33-popZ-TC Successive transformations of MC1000 with pksmcfp-n2 (P. Angelastro c ) and pbad33-popz-tc CJW4835 MC1000/pNDM220-parA R195E -CFP/pBAD33-popZ-yfp Successive transformations of MC1000 with pndm220-para R195E -cfp and pbad33-popz-yfp CJW4836 MC1000/pNDM220-parA R195E -CFP/pBAD33-yfp-popZ N Successive transformations of MC1000 with pndm220-para R195E -cfp and pbad33-yfp-popz N CJW4906 MC1000/pZD6 Transformation of MC1000 with pzd6 plasmid (Ding et al., 2002) CJW4917 CJW4918 MC1000/pMMB22-divIVA-parA R195E -cfp/pbad18kanpopz-tc MC1000/pMMB22-divIVA-parA R195E -cfp/pbad18kanpopz-yfp Successive transformations of MC1000 with pmmb22-diviva-para R195E -cfp and pbad18kanpopz-tc Successive transformations of MC1000 with pmmb22-diviva-para R195E -cfp and pbad18kanpopz-yfp CJW4919 MC1000/pZD22/pBAD18kan-popZ-TC Successive transformations of MC1000 with pzd22 (gift from P. Christie; Ding et al., 2002) and pbad- 18kan-popZ-TC CJW4920 MC1000/pZD22/pBAD18kan-popZ-yfp Successive transformations of MC1000 with pzd22 (Ding et al., 2002) and pbad18kan-popz-yfp a University of Copenhagen, Copenhagen, Denmark. b Yale School of Medicine, New Haven, CT. c Naugatuck Valley Community College, Waterbury, CT. Control of PopZ localization in time and space Laloux and Jacobs-Wagner S7

8 Table S2. Primers used in this study Primer name CJW1037 CJW1186 CJW1188 CJW1546 CJW1733 CJW1734 CJW1737 CJW1739 CJW1740 CJW1741 CJW1742 CJW1744 CJW1745 CJW1746 CJW1747 CJW1748 CJW1749 CJW1750 CJW1752 CJW1753 CJW1754 CJW1816 CJW1817 CJW1818 CJW1819 CJW1820 CJW1821 CJW1822 CJW1823 CJW1867 CJW1869 CJW1892 CJW1895 CJW sequence CCCCCCTCGAGTTACTTGTACAGCTCGTCCATGCCG GGCCATATGGTGTCCGCTAATCCTCTCCG GGCGAATTCGCGGCGGCCTTGGCCTGGCGATCG GGAGACGACCATATGGTGAGCAAGGG AAAAAGGTACCATGTCCGATCAGTCTCAAGAA TTTTTGAATTCACGGCGCCGCGTCCCCGAG AAAAAGGTACCATGCTGGTCGGCGTTTCGGCC TTTTTGAATTCACCTGCTCGGCGACTTCGTC AAAAAGGTACCATGTCGGAGGATGACGCGCCG TTTTTGAATTCACCCGACCGTCCTTGGGCAT TTTTTGAATTCACCGCGTCATCCTCCGAGATG AAAAAGGTACCATGGCCCTGCTGATGCCCAAGG CCTTGGGCATCAGCAGGGCCTGCTCGGCGACTTCGTC GACGAAGTCGCCGAGCAGGCCCTGCTGATGCCCAAGG AAAAACATATGTCCGATCAGTCTCAAGAA TTTTTAAGCTTTTAACAACATCCTGGACAACAGGCGCCGCGTCCCCGAG AAAAACATATGTCGGAGGATGACGCGCCG AAAAACATATGGCCCTGCTGATGCCCAAGG AAAAACATATGTGTTGTCCAGGATGTTGTATGTCGGAGGATGACGCGCCG TTTTTAAGCTTTTAGGCGCCGCGTCCCCGAG TTTTTAAGCTTTTACTTGTACAGCTCGTCCAT AAAAGGATCCAATAAGGAGGATTTACATATGTCCGCTAATCCTCTCCGCG CGCTCACCATTGCGACCTA ATTGATCGCGGTCGTGGTCCTCCCCACCCCACCCTTTTG CAAAAGGGTGGGGTGGGGAGGACCACGACCGCGATCAAT TTTTTGAATTCACGGCGGCCTTGGCCTGGCGAT AAAAACATATGGTGTCCGCTAATCCTCTCC CCCCCATATGCCGAGGGCGCGGTCGGCATC AAAAGGTACCGACCCGCAGCGGCATCAGCAC AAAAATCTAGAATGTCCGCTAATCCTCTCCGCG TTTTTCTCGAGTTACTTGTACAGCTCGTCCAT TTTTTGGTACCAATAAGGAGGATTTACATATGTC TTTTTTCTAGATTAACAACATCCTGGACAACAG TTTTTTCTAGATTACTTGTACAGCTCGTCCAT References Casadaban, M.J., and S.N. Cohen Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138: org/ / (80) Ding, Z., Z. Zhao, S.J. Jakubowski, A. Krishnamohan, W. Margolin, and P.J. Christie A novel cytology-based, two-hybrid screen for bacteria applied to proteinprotein interaction studies of a type IV secretion system. J. Bacteriol. 184: Ebersbach, G., A. Briegel, G.J. Jensen, and C. Jacobs-Wagner A self-associating protein critical for chromosome attachment, division, and polar organization in Caulobacter. Cell. 134: Evinger, M., and N. Agabian Caulobacter crescentus nucleoid: analysis of sedimentation behavior and protein composition during the cell cycle. Proc. Natl. Acad. Sci. USA. 76: Lam, H., W.B. Schofield, and C. Jacobs-Wagner A landmark protein essential for establishing and perpetuating the polarity of a bacterial cell. Cell. 124: Schofield, W.B., H.C. Lim, and C. Jacobs-Wagner Cell cycle coordination and regulation of bacterial chromosome segregation dynamics by polarly localized proteins. EMBO J. 29: Simon, R., U. Priefer, and A. Pühler A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1: S8