Supporting Information for

Transcription

1 Supporting Information for Ultra-selective and sensitive DNA detection by a universal apurinic/apyrimidinic probe-based Endonuclease IV signal amplification system Xianjin Xiao, Chen Song, Chen Zhang, Xin Su, and Meiping Zhao* Beijing National Laboratory for Molecular Sciences, MOE Key Laboratory of Bioorganic Chemistry and Molecular Engineering, College of Chemistry and Molecular Engineering, Peking University, Beijing , China * To whom correspondence should be addressed. Tel: ; Fax: ; mpzhao@pku.edu.cn Experimental Section Sequences used (from 5 to 3 ): 42-nt PM Target : GTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAG 42-nt MM Target : GTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAG 27-nt AP-probe: FAM-TCGTCTCCACUGAAACATACTCCATAA-TAMRA 21-nt AP-probe: FAM-TCTCCACUGAAACATACTCCA-BHQ1 S1

2 Notes: To be more practical, the perfectly matched target 42-nt PM Target is the mutant type of JAK2 V617F, which contains a G to T point mutation. The 42-nt MM Target corresponds to the wild type of JAK2 V617F. Mutation bases are highlighted in bold and underlined while uracils are highlighted in bold and italic. To avoid multiple perfect-match DNA sequences in the tested samples, we checked the sequence of the 21-nt AP-probe in the NCBI human genome database ( It was found that the only one perfect match sequence for the 21-nt AP-probe is the mutant-type of JAK2 V617F, which is exactly the modeling target of our experiments. Preparation of the AP-probe: To a 50-μL PCR tube, 5 μl of 10 ThermolPol buffer (New England Biolabs, USA), 5 pmol of dually-labeled uracil-containing probe, 1.5 unit of UDG(New England Biolabs, USA) were added and the volume of the mixture solution was brought up to 47 μl with ddh 2 O. After incubation for 10 min, the solution was immediately used for further analysis. Detection of DNA sequences: To the above obtained AP-probe solution, 2.5 μl of the 42-nt PM target sequence (5 pmol, 0.5 pmol, 0.1 pmol, 10 fmol, 1 fmol, respectively) and 0.1 unit of endonuclease IV (Fermentas, Canada) were added and brought up to a total volume of 50 μl. The tube was put into Rotor-gene 6000 real time PCR (Corbett, Australia) and the temperature was raised to 53 C immediately. Fluorescence intensity was measured once a cycle, and each cycle lasts for 5 s (gain level of the detector: 7.33). The total detection time is 15 min (180 cycles). All experiments were performed independently in triplicate. Detection of low abundance mutation: To the obtained AP-probe solution, 2.5 μl of the specified abundance of mixed targets (100%, 10%, 5%, 2.5%, 1%, and 0% PM to MM ratio, respectively) and 0.1 unit of endonuclease IV (Fermentas, Canada) were added and brought up to a total volume of 50 μl. Put the tube into Rotor-gene 6000 real time PCR (Corbett, Australia) and raise the temperature to 52.5 C immediately. Fluorescence was read once a cycle, S2

3 and each cycle lasts for 5 s (gain level of the detector: 6.77). The total detection time is 10 min (120cycles). All experiments were performed independently in triplicate. Monitoring the AP-probe-based Endonuclease IV signal amplification (APESA) reactions at different temperatures Figure S1. Time courses of the fluorescence responses of APESA system at different temperatures. The reaction solutions comprise 5 pmol 27-nt AP-probe, 5 pmol 42-nt PM target and 0.1 unit endonuclease IV. The plateaued fluorescence intensities are different because the quantum yields of the fluorophore differ from each other at different temperatures. Determination of the melting temperatures of the hybrids between the 27-nt AP-probe and different target sequences Sequences used: Unlabeled 27-nt AP-probe: 5 -TCGTCTCCACUGAAACATACTCCATAA-3 27-nt perfectly match target: 5 -TTATGGAGTATGTTTCTGTGGAGACGA-3 27-nt one-base mismatch target: 5 -TTATGGAGTATGTGTCTGTGGAGACGA-3 S3

4 A solution containing 5 μl of 10 ThermolPol buffer (New England Biolabs), 5 pmol of unlabeled 27-nt AP-probe (sequences are the same as the dually labeled 27-nt AP-probe), UDG(0.1 units; New England Biolabs) and 1 μl 1 LC green were added to a 50-μL PCR tube. The volume of the mixture was brought up to 47.5 μl with ddh 2 O. Upon incubation at 37 C for 10 min, 5 pmol of the tested 27-nt perfectly match or one-base mismatch target sequences were added and the total volume was made up to 50 μl. The melting procedure was carried out in a Rotor-gene 6000 real time PCR (Corbett; Australia). Determination of the melting temperatures of the hybrids between the 21-nt AP-probe and different target sequences Sequences used: Unlabeled 21-nt AP-probe: 5 -TCTCCACUGAAACATACTCCA-3 21-nt perfectly match target: 5 -TGGAGTATGTTTCTGTGGAGA-3 21-nt one-base mismatch target: 5 -TGGAGTATGTGTCTGTGGAGA-3 A solution containing 5 μl of 10 ThermolPol buffer (New England Biolabs), 5 pmol of unlabeled 21-nt AP-probe (sequences are the same as the dually labeled 21-nt AP-probe), UDG(0.1 units; New England Biolabs) and 1 μl 1 LC green were added to a 50-μL PCR tube. The volume of the mixture was brought up to 47.5 μl with ddh 2 O. Upon incubation at 37 C for 10 min, 5 pmol of the tested 21-nt perfectly match or one-base mismatch target sequences were added and the total volume was made up to 50 μl. The melting procedure was carried out in a Rotor-gene 6000 real time PCR (Corbett; Australia). Notes: In above experiments, we used 27-nt and 21-nt targets instead of the 42-nt target to carry out the melting curve determination because in our experiments, it was observed that the unpaired bases in the hybrid formed between the 42-nt target and the AP-probes might also associate with the LC green and interfere with the fluorescence measurement. S4

5 Figure S2. Fluorescence intensity responses of the APESA system in detection of the PM targets at concentrations lower than 10 fmol by using the 27-nt AP-probe. As shown in Figure S2, 3.0 fmol targets can be clearly detected when the measurement time was prolonged to 50 min. Discussion on the background signals in Figure 3 As can be seen from curve f in Figure 3, the control solution (0 fmol) also showed a small background signal. We prepared a no-enzyme control solution to see if the AP-probe was stable in the solutions. The fluorescence increase of the no-enzyme control solution was observed to be negligible, indicating that the main reason for the background signal was not the instability of AP-probe, but, as mentioned in the main text, the enzyme s residual activity in cleaving the unbound probes. S5

6 Figure S3. Fluorescence intensity responses of the APESA system in detection of the PM target with various abundances by using the 27-nt AP-probe. Discussion on the background signals in Figure 4 The fluorescence increase of the control solution in Figure 4 (curve f) may be caused by two reasons. One was the previously mentioned enzymatic cleavage of the unbound probes. The other one was the signals generated by some of the MM sequences that might participate in the hybridization. We then carried out the detection at relatively higher temperatures in the range from 52.5 to 53.3 C to further inhibit the undesired hybridization. The background signal decreased as expected. However, the discrimination factor was not notably improved, most probably due to the decreased rate of hybridization between the PM target and probes at this relatively high temperature. The detection limit was observed to be 1%. S6