Modeling the Genetic Engineering of Trees

Transcription

1 Lab 17 Modeling the Genetic Engineering of Trees PROBLEM Can a plant be genetically engineered to take up more carbon dioxide? BACKGROUND Enabling trees to use carbon dioxide more efficiently may be a way to reduce air pollution. In theory, one way to help trees use carbon dioxide more effectively is by accelerating the enzymes of photosynthesis. However, the enzymes for photosynthesis are already very efficient. Plants can make sugars by the process of photosynthesis over a wide range of carbon dioxide concentrations. Another way to enable trees to use carbon dioxide more efficiently might be by increasing the rate at which sugars are moved and used in a plant. Usually sugars must move from the leaves, where sugars are made, to the growing parts of stems and roots. Some research has shown that plants with more-active enzymes for transporting sugars and using sugars do grow faster. If genes for the more-active enzymes could be located, duplicated, and inserted into ordinary plants, the ordinary plants might grow faster. An enzyme that is crucial for transporting sugar is sucrose phosphate synthetase. This enzyme catalyzes a reaction that makes sucrose from activated fructose and glucose. Sucrose is the main sugar that is transported in the sap of woody plants. Some plants with more-active sucrose phosphate synthetase enzymes grow faster in air that contains more carbon dioxide than normal. Inserting the genes for more-active sucrose phosphate synthetase enzymes into ordinary plants might also make ordinary plants grow faster. The first step in moving a gene from one plant to another is to find the gene in the first plant. This laboratory exercise will simulate a technique for finding a gene for sucrose phosphate synthetase. The gene will be located by using a technique called a DNA probe. Also the laboratory exercise will simulate the process of making a protein from a known DNA sequence. The protein will represent the enzyme sucrose phosphate synthetase. OBJECTIVES Model the process of using a probe to identify a specific gene. Model the process of making an enzyme from a known DNA sequence. Analyze the effects on a plant and its surrounding environment of increasing an enzyme s effectiveness. Materials (per group) data sheet 1 scissors tape Biotechnology Manual 155

2 Safety Be careful when using scissors. Procedure PART 1 1. Using data sheet 1, cut out all of the DNA sequence and tape the ends together in their original order. Cut out the probe. Save the rest of data sheet 1 for later. 2. The gene for the enzyme sucrose phosphate synthetase is somewhere in the DNA sequence. To find the gene you will expose the DNA to a model radioactive DNA probe. The probe is only a part of the sucrose phosphate synthetase gene. Try to match the probe s sequence with its complementary sequence on the DNA. The probe s sequence is not exactly complementary to the gene s sequence, so find the best fit for the probe on the DNA. Remember that the 5 end of the probe should point toward the 3 end of the DNA sequence. 3. After you locate part of the sucrose phosphate synthetase gene with the probe, you must find both ends of the gene. Examine the DNA sequence, starting from each end of the probe, until you find the start and stop codons. The start and stop codons identify the ends of the model sucrose phosphate synthetase gene. Record the sequence of the gene on the laboratory recordsheet. 4. Show your results to your teacher. When your teacher confirms that you have located the sucrose phosphate synthetase gene, cut off the sequence for the sucrose phosphate synthetase gene from the rest of the DNA. You will work with the sucrose phosphate synthetase gene in part Answer questions 1 and 2 in the analyses and conclusions section. PART 2 1. Using data sheet 1, cut out all the blank pieces that represent amino acids. 2. The DNA sequence of the gene codes for the amino-acid sequence of sucrose phosphate synthetase. Using the list of codons supplied by your teacher, determine the amino-acid sequence of the model sucrose phosphate synthetase. Write the amino-acid sequence for the protein on your recordsheet. 156 Biotechnology Manual

3 3. Show your results to your teacher. If you have correctly identified the amino-acid sequence, assemble the model protein using the amino-acid blanks from data sheet 2. Tape the ends of the blanks together to make the protein. Write the name of the proper amino acid on each blank as you tape the pieces together. The first amino acid in the protein should be methionine. 4. Tape the side chains of the cysteine amino acids together according to your teacher s instructions. Fold the model sucrose phosphate synthetase enzyme in such a way as to make a lock-and-key attachment site. 5. When you are finished making your model sucrose phosphate synthetase enzyme, show it to your teacher. 6. On your recordsheet, make and label a drawing of the model enzyme. 7. Answer questions 3 5 in the analyses and conclusions section. Biotechnology Manual 157

4 Data Sheet 1 DNA SEQUENCE 3 CATAATGATTCTCCATTGTACAATGGATGACAACCAACACCCGCCAACCGG CACAGACAGCCTTATGCGCATGTTCCCAGAGGGAAACCCATTCTGATAACACCGC TGTCGCTCAGAGAGTCAGGA 5 PROBE SEQUENCE 5 GTTGGTTGTGGGTGGTTGGAAGTGTCTGTGGAATCGCGTCCAAGGG 3 AMINO ACID BLANKS 158 Biotechnology Manual

5 Laboratory Recordsheet 17 Modeling the Genetic Engineering of Trees OBSERVATIONS 1. Write the DNA sequence of the model gene for the enzyme sucrose phosphate synthetase. 2. Write the amino-acid sequence for the model enzyme sucrose phosphate synthetase. 3. Make and label a drawing of the model enzyme. ANALYSES AND CONCLUSIONS 1. Describe the ways the model gene differs from the model probe that you used. 2a. How many bases are in the codons for the model gene, including the stop codon? b. For how many amino acids does the model gene code? Explain your answer. Biotechnology Manual 159

6 3. Analyze the process that was modeled in parts 1 and 2 by drawing a diagram of the entire process. 4. Explain how this model process differs from the actual process. 5. Infer what might be some benefits to people of having genetically engineered trees that grow faster than ordinary trees. 160 Biotechnology Manual