SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans"

Transcription

1 EUKARYOTIC CELL, Aug. 2008, p Vol. 7, No /08/$ doi: /ec Copyright 2008, American Society for Microbiology. All Rights Reserved. SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans Kimberly D. Gank, 1 Michael R. Yeaman, 1,2 * Satoshi Kojima, 1 Nannette Y. Yount, 1 Hyunsook Park, 1 John E. Edwards, Jr., 1,2 Scott G. Filler, 1,2 and Yue Fu 1,2 Division of Infectious Diseases, LAC-Harbor UCLA Medical Center, Torrance, California 90509, 1 and David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, California Received 31 October 2007/Accepted 15 May 2008 Candida albicans is usually a harmless human commensal. Because inflammatory responses are not normally induced by colonization, antimicrobial peptides are likely integral to first-line host defense against invasive candidiasis. Thus, C. albicans must have mechanisms to tolerate or circumvent molecular effectors of innate immunity and thereby colonize human tissues. Prior studies demonstrated that an antimicrobial peptideresistant strain of C. albicans, R, is hypervirulent in animal models versus its susceptible counterpart (36082 S ). The current study aimed to identify a genetic basis for antimicrobial peptide resistance in C. albicans. Screening of a C. albicans genomic library identified SSD1 as capable of conferring peptide resistance to a susceptible surrogate, Saccharomyces cerevisiae. Sequencing confirmed that the predicted translation products of S and R SSD1 genes were identical. However, Northern analyses corroborated that SSD1 is expressed at higher levels in R than in S. In isogenic backgrounds, ssd1 /ssd1 null mutants were significantly more susceptible to antimicrobial peptides than parental strains but had equivalent susceptibilities to nonpeptide stressors. Moreover, SSD1 complementation of ssd1 /ssd1 mutants restored parental antimicrobial peptide resistance phenotypes, and overexpression of SSD1 conferred enhanced peptide resistance. Consistent with these in vitro findings, ssd1 null mutants were significantly less virulent in a murine model of disseminated candidiasis than were their parental or complemented strains. Collectively, these results indicate that SSD1 is integral to C. albicans resistance to host defense peptides, a phenotype that appears to enhance the virulence of this organism in vivo. The colonization of human tissues is an essential first step in the pathogenesis of invasive candidiasis. This paradigm is based on multiple lines of evidence as follows: (i) colonization precedes and is an independent risk factor for disseminated candidiasis (16, 21, 28, 37), (ii) colonization burden correlates with the risk of invasive disease (6, 8, 22), and (iii) measures that reduce colonization burden reduce the subsequent risk of fungemia (18, 29). Innate immunity plays a crucial role in controlling candidal colonization and preventing invasive candidiasis. Thus, understanding the relationship among candidal pathogenicity, molecular immunobiology, and host defense is directly relevant to addressing the unacceptably high rates of morbidity and mortality presently associated with candidal infection (1, 12, 23, 27). In immunocompetent individuals, molecular mechanisms of innate immunity are believed to mediate first-line host defense against invasive candidiasis. High-level cellular inflammatory responses are usually invoked only if these defenses fail to control colonization by Candida albicans. Principal among innate immune defenses are antimicrobial peptides elaborated in skin or upon mucosal surfaces. For example, human -defensins (e.g., human -defensin-1 [h D-1] or h D-2) are considered integral to innate defense of the integument (3). Likewise, histatins are important molecular effectors of constitutive immunity against Candida in the oral setting (6). Little is known about the molecular mechanisms that govern C. albicans resistance to antimicrobial peptide-induced growth inhibition or lethality (41). Prior studies have examined the relationship between resistance to thrombin-induced platelet microbicidal protein-1 (tpmp-1) and C. albicans virulence in the rabbit model of infective endocarditis (42). These investigations demonstrated that the peptide-resistant strain C. albicans R proliferated in cardiac vegetations and spleen to densities logarithmically higher than those seen for the orthogenic and peptide-susceptible counterpart, S. Moreover, subsequent studies revealed that fluconazole was significantly less efficacious in reducing tissue burden due to strain R than in reducing that due to strain S (42). Differences in fungal growth rates, levels of adherence to vascular endothelium, levels of clearance from the bloodstream, and susceptibilities to fluconazole were ruled out as potential confounders of the above results. Thus, relative resistance to antimicrobial peptides appears to play a significant role in C. albicans pathogenesis and the efficacy of antifungal therapy. The current studies were undertaken to examine the genetic basis of antimicrobial peptide resistance in this opportunistic human pathogen. * Corresponding author. Mailing address: David Geffen School of Medicine at UCLA, Division of Infectious Diseases, St. John s Cardiovascular Research Center, Harbor-UCLA Medical Center, 1000 West Carson Street, RB-2, Torrance, CA Phone: (310) Fax: (310) These authors contributed equally to this work. Published ahead of print on 30 May MATERIALS AND METHODS Fungal strains and culture conditions. The panel of organisms used in this investigation is summarized in Table 1. All wild-type strains were obtained from the American Type Culture Collection (ATCC; Manassas, VA). (i) Candida albicans. C. albicans ATCC 36082, originally a clinical isolate, was previously determined to be susceptible to the antimicrobial peptide tpmp-1 (tpmp-1 S ; strain S ) (41). A stable tpmp-1-resistant and orthogenic coun- 1318

2 VOL. 7, 2008 CANDIDA RESISTANCE TO HOST DEFENSE PEPTIDES 1319 TABLE 1. Fungal strains used in the present investigation a Strain Parent Comments/relevant genotype terpart (tpmp-1 R ) of strain S, designated strain R, has been characterized previously (42, 43). Prior studies demonstrated that other than in differences in tpmp-1 susceptibility profiles, the S and R strains are indistinguishable by genotyping and immunotypic profiling, assessment of endothelial cell adhesion, and metabolic, germination, or growth rate characteristics (41 43). Studies have also confirmed that the tpmp-1 S and tpmp-1 R phenotypes are stable in vitro following passage in media or serum and upon passage through experimental animal models (42, 43). Moreover, prior investigations in vivo confirmed that these strains are equivalent in their interactions with platelets or cardiac vegetations and do not differ in rates of clearance after hematogenous inoculation in experimental animal models (9, 42). An initial genomic library was developed using strain R ; however, all relevant sequence data were identical to those for the genome sequence strain SC5314, the parent strain of BWP17 (10). Thus, all subsequent genetic studies were performed using C. albicans strain SC5314 as the parent strain to create null and complemented SSD1 mutants, as detailed below. (ii) S. cerevisiae. Saccharomyces cerevisiae strain ATCC (LL20), an antimicrobial peptide-susceptible, transformable strain, was used to express the C. albicans genomic library. It was maintained on yeast nitrogen base (YNB; Difco, Detroit MI) medium supplemented with 0.5% ammonium sulfate, 2% D-glucose, and 100 g/ml each of L-leucine and L-histidine (Sigma-Aldrich, St. Louis MO) and solidified with 1.5% agarose. All organisms were stored at 4 C on appropriate agar slants; strain R was stored at the same temperature on Sabouraud dextrose agar containing 7 mg/ml protamine sulfate (Sigma-Aldrich). Prior to experimentation, organisms were cultured to late logarithmic phase in YNB broth at 30 C for 12 h and prepared and enumerated as previously described (42). Construction of the C. albicans R genomic library. Initially, a C. albicans genomic library was constructed using DNA from strain R as previously described (9). In brief, C. albicans R genomic DNA was isolated and partially digested with Sau3AI (New England Biolabs). Fragments of the C. albicans genome of 6 to 10 kb in length were ligated into the BamHI site of pe-20h (originally provided by Susan Sandmeyer, University of California, Irvine) (10), which is a 2 m-based shuttle plasmid, incorporating HIS3 as a selection marker in S. cerevisiae. Plasmid constructs were transformed into Escherichia coli JM109 high-efficiency competent cells by use of the pgem-t system (Easy Vector; Promega, Madison, WI). The resultant library, comprised of 15,000 clones, was amplified in E. coli strain XL10-Gold (Stratagene, Torrey Reference(s) or source S Wild type (SSD1/SSD1) 42, R S AP R isolate derived from S (SSD1/SSD1) 41 SC5314 URA3/URA3 HIS1/HIS1 ARG4/ARG4 (SSD1/SSD1) 4, 40 CAF2-1 SC5314 ura3:: imm434/ura3 HIS1/HIS1 ARG4/ARG4 (SSD1/SSD1) 4, 40 CAI-4 CAF2-1 ura3:: imm434/ura3:: imm434 4, 40 DAY185 BWP17 b ura3:: imm434/ura3:: imm434 his1::hisg/his1::hisg::his1 4, 40 arg4::hisg/arg4::hisg::arg4::ura3 (SSD1/SSD1) APR -1 (ssd1 /ssd1 -I) BWP17 ura3:: imm434/ura3:: imm434::ura3,his1::hisg/his1::hisg Present work arg4::hisg/arg4::hisg,ssd1::his1/ssd1::arg4 (ssd1/ssd1) APR -1comp (ssd1 /ssd1 -I::SSD1) APR-1 ura3:: imm434/ura3:: imm434::ura3 his1::hisg/his1::hisg Present work arg4::hisg/arg4::hisg ssd1::his1/ssd1::arg4::ssd1 (ssd1/ SSD1) APR -2 (ssd1 /ssd1 -II) c BWP17 ura3:: imm434/ura3:: imm434::ura3,his1::hisg/his1::hisg Present work arg4::hisg/arg4::hisg,ssd1::his1/ssd1::arg4 (ssd1/ssd1) APR -2comp (ssd1 /ssd1 -II::SSD1) APR-2 ura3:: imm434/ura3:: imm434::ura3 his1::hisg/his1::hisg Present work arg4::hisg/arg4::hisg ssd1::his1/ssd1::arg4::ssd1 (ssd1/ssd1) LL20(pE-20H) d LL20 S. cerevisiae; MAT leu2-1,112 his2-11,15 psi cir0 can1; 10 transformed with pe-20h LL20(pMYK-2) LL20 S. cerevisiae; MAT leu2-1,112 his2-11,15 psi cir0 can1; Present work transformed with pmyk-2 (pe-20h harboring functional SSD1) DAY185ovex DAY185 ura3:: imm434/ura3:: imm434,his1::hisg/his1::hisg::his1arg4:: hisg/arg4::hisg::arg4::ura3 (NAT1 P TDH3 SSD1/SSD1) Present work a All strains except LL20 strains are C. albicans. Mutant strains were generated as detailed in Materials and Methods. b Homozygous triple knockout derived from SC5314; intermediate strain genotypes not shown. c Constructed identically to APR -1 (ssd1 /ssd1 -I); independent validation of APR -1. d A2 m-based multicopy yeast plasmid containing the selective HIS3 gene; generously provided by Susan Sandmeyer, University of California, Irvine. Pines, CA), transformed into S. cerevisiae LL20 by standard methods, and plated on YNB agar with appropriate supplementation. Screening for fungal protamine susceptibility or resistance. Protamine is a helical cationic polypeptide used to screen for antimicrobial peptide resistance phenotypes (14, 42). Prior studies have demonstrated that resistances of C. albicans strains S and R to tpmp-1 and other antimicrobial peptides are mirrored by their responses to protamine (42, 43). Candida albicans or S. cerevisiae inocula ranging from 10 2 to 10 6 CFU were plated in 10- l volumes onto Sabouraud agar containing protamine sulfate (concentration range, 0 to 7 mg/ ml) along with appropriate supplements for specific fungal strains (e.g., arginine, histidine, uridine). Plates were incubated at 30 C, and growth was recorded every 24 h. Identification of C. albicans gene(s) in protamine-resistant clones of S. cerevisiae LL20. Plasmids from protamine-resistant clones of S. cerevisiae LL20 were rescued, amplified in E. coli, and reintroduced into protamine-susceptible (wildtype) S. cerevisiae LL20 as previously detailed (9). Resulting transformants were then confirmed for protamine resistance as described above. Plasmids from randomly selected S. cerevisiae clones with confirmed protamine resistance were rescued and subcloned into pe-20h and transformed into S. cerevisiae LL20, and transformants were then assayed for protamine resistance as described above. In addition, candidal DNAs from two random protamine-resistant clones were digested by SacI (New England Biolabs), and their restriction maps were analyzed. Functional assessment of SSD1 clones. Clones encoding the protamine-resistant phenotype contained a 6.3-kb fragment located within a SacI site and mapped to 1.9 kb from its end. To assess the function of this 6.3-kb fragment, 4.4- and 1.9-kb fragments were individually subcloned and tested for protamine resistance as described above. Comparison of SSD1 genes in C. albicans strains S and R. SSD1 genes from C. albicans strains S and R were compared for sequence and expression profiles to assess potential correlations with antimicrobial peptide susceptibility or resistance phenotypes as follows. (i) PCR amplification and sequencing. SSD1 was amplified by high-fidelity PCR (Expand high-fidelity system; Roche, Indianapolis, IN) from genomic DNA of strains S and R by use of primers SSD1-NP-1 and SSD1-CP-1 (Table 2) in a 100- l reaction mixture by following standard cycling protocols. Reaction products were verified by 0.8% agarose gel electrophoresis and independently cloned into pgem-t vectors for sequencing. Midi-plasmid prepara-

3 1320 GANK ET AL. EUKARYOT. CELL TABLE 2. Primer sequences used in the current investigation Use Name Direction a Sequence Cloning SSD1-NP-1 S CGGGATCCATGAGCTCGTCACAAGATTAC SSD1-CP-1 AS GCGTCGACTGTCAAACATGCAAAGCCATAC Sequencing S1 S CTGACGACATTGGGTC S1.5R S CGTTTCAAAGATCATTAGG S1.75 S GGATCTCGTGGTAGTGG S2 S GCTCCTTACTTGCCAC S2.5 S GGATCGTAATCGTGCT S3 S CGGACATGTTGTAGCTG S3.5 S CGATAGAATTCCCTGGC S4 S CATGTTGCCGATATTGC S4.5 S CACACAAAGTGAATTCTG S5 S CTTGGGAGATCAAGC S6 S CGAGTCATCGTTTGAT AS0 AS TCCGCTGGAGTAGTAG AS1 AS GCAACTGGTCACCATG AS1.5 AS GCATAACGTCTCAATGGT AS2 AS CCAAACTAGTTGCTTTCC AS2.5 AS CTAACAATGTCAAGTTAGG AS4 AS CGGTAGACTCCTTACC AS5.5 AS CAGTAGAAACATATGCATC AS6 AS GCCCATATGCTAATGATC AS7 AS GGATGACCTATTACCTCCA AS8 AS GAGCTTGCACTTCTTCC Mutant engineering HIS AS AACGTCGTGACTGGGAAAAC ARG AS TATCCGCTCACAATTCCACA SSD1S S ACTGCTCATGGGCATTCAAGA SSD1AS AS TTCTCTGCAACTGAATCCGCT Northern probes ACT1a S GACGGTGAAGAAGTTGCTGC ACT1b AS CAAACCTAAATCAGCTGGTC EFB1a S CATTGAACGAATTCTTGGCTG EFB1b AS CAACAGCAGCTTGTAAGTC SSD1 overexpression TDH3a S TATTAATCTCAATTTGGTTGGATTCATTCATTAAAAA CTATCTGGTCAACAATTCAATTTATTACAATTTGG TGAGGCAATCAAGCTTGCCTCGTCCCC TDH3b AS GCAAGTTTTTCCCCTTTCTGCTGGAAACCCTGGCTG GGGTATTATTACTGTTGTTGTTGTAATCTTGTGAC GAGCTCATATTTGAATTCAATTGTGATG NorThra S ATCAAGCTTGCCTCGTCCCC NorThrb AS GCTTGCACTTCTTCCAATTGACG a S, sense; AS, antisense. tions (Qiagen) were digested with BamH1 and Sal1, and sequences of both alleles were determined. Open reading frame searches and amino acid translations were compared to the published version of SSD1 (GenBank accession AF012898) from strain SC5314. (ii) Analysis of SSD1 gene expression in strain S versus R. Expression levels of SSD1 were compared over time in strains S and R in the presence and absence of sublethal levels of protamine by use of Northern analysis. Candidal RNA was extracted from logarithmic-phase cells and confirmed for quantity and purity by spectrophotometry and agarose gel electrophoresis using standard methods. Expression of SSD1 was evaluated by Northern blot analysis using standard methods (5). Northern blots were probed with the fulllength SSD1 open reading frame amplified from strain SC5314; they were also probed with ACT1 and EFB1 (Table 2) to control for RNA loading. Probed membranes were subjected to densitometry for quantification (GS-700 densitometer implementing Quantity One software, version [Bio-Rad, Hercules, CA]). Radial diffusion assay for antimicrobial peptide susceptibility. Fungal susceptibility or resistance to prototypic antimicrobial peptides from diverse human tissues was evaluated in an ultrasensitive radial diffusion assay (47). Histatin-5 (his-5), human neutrophil defensin-1 (hnp-1; -defensin), and h D-2 were obtained commercially (Biosource/Invitrogen, Carlsbad, CA). RP-1, RP-11, and RP-13 are synthetic peptides designed in part from platelet microbicidal proteins; these peptides were synthesized, purified, and authenticated as previously described (44). The zones of inhibition were measured to the nearest 0.1 mm in diameter, subtracting the well diameter. Vehicle alone was included as an internal control in all experiments, which were performed independently a minimum of three times. MIC and MFC assays. MICs and minimum fungicidal concentrations (MFCs) were determined for C. albicans strains by use of the broth microdilution method from the CLSI (formerly NCCLS) (23a). (i) Protamine. For MIC assays, CFU/ml inocula of C. albicans strains were exposed to serial dilutions of protamine in RPMI 1640 liquid medium (buffered to ph 7.0 using MOPS [morpholinepropanesulfonic acid]) for 48 h at 30 C. The MIC of each strain was quantified by visual inspection and validated by spectrophotometry as the lowest dilution that yielded no detectable growth. MFCs were assessed by plating the MIC cultures onto yeast extract-peptone-dextrose incubated as described above. The MFC of each strain was interpreted as the lowest concentration that did not permit detectable growth. (ii) Nonpeptide stressors. To assess the potential for SSD1 specificity in antimicrobial peptide resistance, MICs of nonpeptide agents were determined using standard broth macrodilution methods as previously described (2, 42). For these studies, a panel of agents was selected based on the following distinct targets of fungal cell disruption: hydrogen peroxide (H 2 O 2 ; range, 100 to 0.2 mm; oxidative injury); sodium dodecyl sulfate (SDS; range, 0.1 to % [wt/vol]; lipid membrane disruptant); and amphotericin B (AMB; range, 10 to 0.02 g/ml; polyene antagonist of ergesterol). These MIC and MFC assays were carried out using the protocol described above for antimicrobial peptides. Engineering of SSD1 null and complemented C. albicans mutants. The C. albicans strains used in mutational studies are summarized in Table 1. Each strain is a derivative of the SC5314 genetic background. The SSD1 gene in C.

4 VOL. 7, 2008 CANDIDA RESISTANCE TO HOST DEFENSE PEPTIDES 1321 Downloaded from FIG. 1. Comparative susceptibilities of C. albicans strains containing native or altered SSD1 genotypes. (A) Equivalence in growth rates of a range of inocula (10 6 to 10 CFU) on media lacking protamine after 48 h of incubation. (B) S. cerevisiae was transformed with pe-20h plasmid constructs containing genomic DNA from Candida albicans R. Clones of interest were isolated after 120 h of culture at 30 C on YNB with protamine (5 mg/ml). Plasmid-specific protamine resistance was verified by rescue of plasmids from resistant clones, reintroduction into susceptible S. cerevisiae, and culture on YNB-protamine agar. Quadrants: 1, S. cerevisiae containing the empty plasmid pe-20h; 2 to 4, S. cerevisiae transformed with pe-20h containing a 6.3-kb region of genomic DNA from C. albicans strain R (peptide resistant). Inocula of each strain were equivalent. (C) Differential susceptibilities of strains on media containing protamine (5 mg/ml) after 48 h of incubation. albicans strain BWP17 was disrupted using a previously described PCR method (40). The two alleles of the SSD1 gene were replaced by HIS1 and ARG4, respectively. Primers for amplification of HIS1 and ARG4 disruption cassettes, and those used to confirm the integration of HIS1 and ARG4 markers, were as shown in Table 2. The initial SSD1 null mutant genotype was ura3 (genotype, ssd1 /ssd1 ura3/ura3). Because it exhibits a gene locus effect (4), URA3 was then replaced in its original locus through homologous recombination. Thus, a 3.9-kb fragment encompassing the complete URA3 gene was reintroduced, yielding the final URA3 prototrophic null mutant strains. Two independent null mutants were created in this manner for comparison and for assessment of reproducibility. To complement each null mutant, a plasmid containing a hisg-ura3-hisg cassette (pmb-7) was constructed with the complete SSD1 coding sequence plus upstream and downstream flanking regions (4.5-kb DraI-BglII fragment). The construct was linearized by SacI digestion and integrated into the ssd1 /ssd1 null mutant to create an initial complemented strain. In each complemented organism, URA3 was then removed by intrachromosomal recombination with 5-fluoroorotic acid selection, and URA3 was reintroduced into its native locus as described above. This process yielded final SSD1 complemented strains with URA3 authentically replaced in the original locus. An independent complemented strain was created for each SSD1 null mutant. Prior to further study, the genotypes of each mutant and complemented strain were verified by Southern analysis. The lack of SSD1 expression in null mutants was confirmed by Northern analyses and quantitative PCR. Candida albicans strain DAY185 (HIS1 ARG4 URA3 heterozygous) served as an SSD1 prototroph control. Because URA3 in strain DAY185 is not in its original locus, C. albicans strain CAF 2-1 was used as an additional control, as it retains a URA3 allele in its original locus (10, 40). All C. albicans strains exhibited equivalent growth rates at 30 C over 48 h. SSD1 overexpression studies. To generate SSD1 overexpression strains of C. albicans, the strong constitutive promoter TDH3 was integrated immediately upstream of the SSD1 coding sequence in DAY185. To do so, a PCR product containing the NAT1-P TDH3 cassette (kindly provided by Aaron Mitchell) and the respective primers indicated in Table 2 was generated. The PCR fragment was introduced into recipient strains by standard methods, and the resulting clones were screened on yeast extract-peptone-dextrose agar containing 400 on September 13, 2018 by guest

5 1322 GANK ET AL. EUKARYOT. CELL FIG. 2. Influence of differential protamine concentration on strain susceptibilities by radial diffusion assay. Key to protamine concentration/ well: 1, 0.2 mg/ml; 2, 0.4 mg/ml; 3, 2 mg/ml; 4, 7 mg/ml; 5, doubly distilled water; 6, 0.1% acetic acid (the last two wells are negative controls). Experimental techniques are as detailed in Materials and Methods. g/ml nourseothricin (25). Next, resulting nourseothricin-resistant clones were verified by colony PCR using cognate primers (Table 1). Overexpression strains were evaluated for protamine resistance as described above. Murine model of hematogenously disseminated candidiasis. To assess the influence of SSD1-mediated antimicrobial peptide resistance in C. albicans virulence in vivo, the null and complemented SSD1 strains were compared with their wild-type parent in a murine model of disseminated candidiasis (31). All mouse experiments were carried out according to the NIH guidelines for the ethical treatment of animals. Organisms were confirmed to retain original genotypic and antimicrobial peptide resistance phenotypes following passage in serum (data not shown), as demonstrated for strain following in vivo infection (42, 43). Groups of 10 male BALB/c mice were randomly selected to receive either the wild-type parent (DAY185), the null mutant (APR -2; ssd1 / ssd1 - ), or the complemented (APR -2comp; ssd1 /ssd1 - ::SSD1) strain of C. albicans. To induce hematogenously disseminated candidiasis, mice were inoculated via the tail vein with blastospores of C. albicans in 0.3 ml of phosphate-buffered saline (31). Mice were monitored for survival three times daily for 14 days. Animals still surviving at day 14 were censored at that time point. These studies were repeated twice and the results were combined for analysis. Statistical analyses. In vitro experiments were performed a minimum of two independent times on different days. Two-way analysis of variance was used to compare differences in data; the Bonferroni correction for multiple comparisons was used where appropriate. Data exhibiting discontinuous distributions (e.g., MICs) were analyzed by nonparametric Wilcoxon rank sum statistics. Differences in survival among mouse groups infected with comparative C. albicans strains were analyzed using the log rank test (31). P values of 0.05 were considered significant. RESULTS Screening for protamine resistance of C. albicans and S. cerevisiae. Results of the screen for protamine resistance are summarized in Fig. 1. Consistent with prior studies, the growth of C. albicans S was inhibited by protamine in an inoculum-, time-, and concentration-dependent manner. In contrast, the growth of C. albicans R was not detectably affected even in the presence of the highest protamine concentration tested (7 mg/ml). Growth rates of the genetically defined panel of C. albicans strains DAY185 and CAF2-1, as well as that of S. cerevisiae strain LL20 (data not shown), were inhibited by protamine to equivalent extents. It is noteworthy that the background strains appeared to have intrinsically high resistance to protamine compared with strains derived from SC5314. Candida albicans strains used in each of the abovedescribed studies had equivalent growth rates (Fig. 1A), and empty plasmid controls (e.g., pe-20h) did not alter growth or baseline protamine susceptibility phenotypes of the S. cerevisiae LL20 recipient strain (data not shown). Identification of C. albicans SSD1-mediated protamine resistance in S. cerevisiae. Clones of S. cerevisiae transformed with C. albicans DNA were screened for capability of growth on protamine agar and assessed for candidal gene(s) (Fig. 1B). Eight such clones were chosen randomly and their plasmids analyzed as described above. Each of these clones contained an equivalent 6.3-kb insert, identified by sequencing to be C. albicans SSD1. SacI digestion of plasmids containing C. albicans SSD1 (e.g., pmyk-2) yielded identical restriction maps comprised of two fragments (1.9 and 4.4 kb). Neither fragment alone conferred protamine resistance when subcloned into S. cerevisiae. In vitro protamine susceptibility of SSD1 null and complemented strains of C. albicans. To verify that SSD1 governed protamine susceptibility in C. albicans, we constructed mutant strains in which both alleles of SSD1 were disrupted. Null mutation of SSD1 (e.g., APR -2) in the SC5314 background correlated with significantly high susceptibility to protamine compared to that of the parental strain (DAY185) or those of SSD1-complemented strains (e.g., the APR -2comp strain) (Fig. 1C and 2). Influence of SSD1 on resistance to diverse antimicrobial peptides. Next, we investigated whether SSD1 also mediates resistance to antimicrobial peptides of sources and structures divergent from those of protamine (Table 3). The null mutant was more susceptible to all antimicrobial peptides tested, except his-5, which exerted relatively low but equivalent activities against all C. albicans strains. Conversely, the expression of SSD1 in S. cerevisiae resulted in reduced susceptibility to his-5,

6 VOL. 7, 2008 CANDIDA RESISTANCE TO HOST DEFENSE PEPTIDES 1323 TABLE 3. Comparative influence of C. albicans SSD1 on C. albicans and S. cerevisiae susceptibilities to diverse antimicrobial peptides Peptide (concn mg/ml ) b LL20(pE-20H) Mean zone of inhibition (mm) for indicated strain (genotype) a S. cerevisiae C. albicans LL20(pMYK-2) APR -2 (ssd1 /ssd1 -II) DAY185 Pro (0.2) * 2.6 Pro (0.4) 5.0* * 3.3 Pro (0.5) 6.3* * 4.0 Pro (2) 8.9* * 5.3 Pro (7) * 8.2 his-5 c hnp-1 d * 4.0 h D-2 e 4.6* * 3.3 RP-1 f 6.3* * 3.0 RP-11 g * 1.9 RP-13 h * 1.0 a Results represent mean values with standard deviations of 1 mm derived from a minimum of three independent experiments performed on different days, with equivalent results (standard error, 5%). Asterisks indicate significant differences (P 0.05) between respective organism strains. Note that a larger zone represents a relative increase in susceptibility; smaller zones represent relative decreases in susceptibility. Results shown for APR -2 (ssd1 /ssd1 -II) were indistinguishable from those for APR -1 (ssd1 /ssd1 -I) (see Table 1). b Pro, protamine. For peptides other than protamine, the tested concentration was 10 g/well. c his-5 is a 24-amino-acid peptide found in human oral secretions and has a largely extended structure; the calculated net charge at ph 7 is 5 (7). d hnp-1 is a 30-amino-acid neutrophil antimicrobial peptide that conforms predominantly to a -sheet structure; the calculated net charge at ph 7 is 3 (32). e h D-2 is a 41-amino-acid peptide of -sheet and turn structure present in several human tissues, such as skin and mucosal secretions; the calculated net charge at ph 7 is 6 (46, 48). f RP-1 is an 18-amino-acid -helical peptidomimetic designed in part based on microbicidal helices of human platelet factor-4 family kinocidins (44, 49, 50); the calculated net charge at ph 7 is 8. g RP-11 is a 13-amino-acid -helical peptidomimetic designed in part based on microbicidal helices of human platelet factor-4 family kinocidins (44, 49, 50); the calculated net charge at ph 7 is 6. h RP-13 a 17-amino-acid -hairpin peptidomimetic designed in part based on -core motifs of human platelet factor-4 family kinocidins (44, 49, 50); the calculated net charge at ph 7 is 3. h D-2, and synthetic peptides RP-1, RP-11, and RP-13 but not to defensin hnp-1 compared to what was seen for the respective controls (Table 3). MIC and MFC studies of protamine and nonpeptide stressors. (i) Protamine MICs and MFCs versus C. albicans strains. C. albicans strains DAY185, APR -2, and DAY185ovex were assessed for relative susceptibility to protamine by use of two methods. As anticipated, overexpression of SSD1 in C. albicans (DAY185ovex; P TDH3 -SSD1/SSD1) conferred increased protamine resistance, while the null mutant was hypersusceptible in this assay system compared to the wild type (Fig. 3). Likewise, by use of a standard CLSI protocol (23a), wild-type (DAY185; SSD1/SSD1), null, and overexpression strains were tested for comparative protamine resistance in liquid medium. As in the agar assays, strains exhibited MIC and MFC values consistent with the hypothesis that SSD1 is integral to antimicrobial peptide resistance in C. albicans. Thus, protamine MICs were 10 g/ml, 20 g/ml, and 5 g/ml for strains DAY185, DAY185ovex, and APR -2, respectively. Moreover, MFC values were equal to MICs in all strains tested. (ii) Nonpeptide stressor MICs and MFCs versus C. albicans strains. To determine if SSD1 is required for resistance to stresses other than antimicrobial peptides, four genetically defined C. albicans strains were tested for susceptibility to nonpeptide fungal antagonists (Table 4). The MICs and MFCs for H 2 O 2, SDS, and AMB were similar among these strains, regardless of SSD1 null deletion or complementation. Moreover, in no case did the MIC or MFC of an SSD1 gene-altered strain vary more than 1 dilution from that of its respective control. Importantly, the majority of instances in which twofold increases in MIC or MFC were observed favored greater resistance by the protamine-susceptible strain (e.g., H 2 O 2 or AMB MICs and MFCs against S versus R ) (Table 4). Thus, antimicrobial peptide resistance mediated by SSD1 appears to be distinct from a general stress response. (iii) Sequence and expression profiles of SSD1 in C. albicans. The above results implicated SSD1 as an integral genetic determinant of protamine and other antimicrobial peptide resistance phenotypes in C. albicans. Sequencing of the native SSD1 genes in strains S and R confirmed that the amplified portions of DNA sequences were 3.8 kb in length. A single-base-pair mismatch was observed at one codon site (bp position 1017 to 1019), but this mismatch translates to an identical conserved amino acid (alanine) in each strain. Other than this conserved base pair, there is 100% identity at the nucleotide level among SSD1 alleles from the strains studied herein to the published and assembled SSD1 sequences in the Candida Genome Database (open reading frames and of strain SC5314; assembly 19) (36). Therefore, no qualitative differences were observed between SSD1 genes in strains S and R. Northern analyses demonstrated a consistent relative increase in SSD1 expression in strain R compared with what was seen for its protamine-susceptible counterpart, S (Fig. 4). The authenticity of differential SSD1 expression was verified by independent normalization to ACT1 (Fig. 4), EFB1, or total RNA (data not shown). Importantly, the elevated level of SSD1 transcription was relatively constitutive and not significantly altered by growth in the presence versus the absence of sublethal levels of protamine. Influence of SSD1 on C. albicans virulence in vivo. Results from in vivo studies comparing virulence levels of SSD1 null, complemented, and wild-type C. albicans strains are summarized in Fig. 5. Mice infected the wild-type strain (DAY185) had a median survival of 7 days. In contrast, mice infected with the null mutant (ssd1 /ssd1 -II) exhibited significantly prolonged survival (median survival, 9 days) compared with their wild-type strain-infected counterparts (P 0.05). Importantly, complementation of the null mutant with SSD1 restored virulence to that of the wild-type strain. DISCUSSION Previous studies have demonstrated that reduced in vitro susceptibility to antimicrobial peptides correlates with increased virulence of C. albicans in a rabbit model of infective endocarditis and hematogenous dissemination (42, 43). More recently, this concept has been extended to show that antimicrobial peptide resistance negatively influences antifungal efficacy in this model (42). In the above-described studies, the

7 1324 GANK ET AL. EUKARYOT. CELL FIG. 3. Impact of SSD1 overexpression on protamine resistance in C. albicans. Serial dilutions of parental (DAY185), APR -2 (ssd1 /ssd1 - II), and DAY185ovex (P TDH3 -SSD1/SSD1) strains were plated onto Sabouraud agar containing protamine ranging in concentration from 0 to 7 mg/ml. This figure illustrates the impact of SSD1 overexpression compared with parental and null mutant strains in the presence of 5 mg/ml protamine at 48 h postinoculation. Similar results were observed for protamine concentrations of 3 mg/ml or greater. Downloaded from antimicrobial peptide-resistant C. albicans strain R achieved significantly greater densities in cardiac vegetations and splenic tissue and was less susceptible to fluconazole therapy than its peptide-susceptible counterpart, S. The current studies were undertaken to explore the genetic basis for antimicrobial peptide resistance in C. albicans. The current data support the hypothesis that increased SSD1 expression in C. albicans, or heterologous expression in S. cerevisiae, confers increased resistance to antimicrobial peptides. This conclusion derives from the following complementary lines of evidence: (i) genome screening identified SSD1 from C. albicans as being uniquely capable of permitting S. cerevisiae growth in the presence of protamine; (ii) S. cerevisiae clones transformed to overexpress C. albicans SSD1 had increased resistance to antimicrobial peptides; (iii) although equivalent in sequence in the peptide-resistant strain R and in its susceptible counterpart, S, SSD1 is constitutively overexpressed in R compared with what is seen for S ; (iv) null mutation of SSD1 rendered C. albicans hypersusceptible to antimicrobial peptides; (v) complementation of this gene in C. albicans restored the parental resistance phenotype; and (vi) constitutive SSD1 overexpression in the DAY185 background conferred enhanced protamine resistance. Collectively, these results support the concept that resistance to host defense peptides is mediated by constitutively high or rapidly induced SSD1 expression early in the face of antimicrobial peptide exposure. In the present study, the hypothesis that in vitro resistance to antimicrobial peptides would translate into increased virulence during invasive candidiasis was examined by using the murine model. In these studies, null mutation of SSD1 significantly impaired C. albicans virulence compared with what was seen on September 13, 2018 by guest Genetic background TABLE 4. Influence of SSD1 on C. albicans susceptibility to nonpeptide antifungal disruptants a Specific strain (genotype) H 2 O 2 (mm) MIC of: SDS (% wt/vol ) AMB ( g/ml) H 2 O 2 (mm) MFC of: SDS (% wt/vol ) AMB ( g/ml) S R DAY185 APR -2 (ssd1 /ssd1 -II) APR -2comp (ssd1 /ssd1 -II::SSD1) a MICs and MFCs were determined by standard assays as detailed in Materials and Methods. Prototypic agents were H 2 O 2 (oxidative injury), SDS (phospholipid disruptant), and AMB (polyene ergesterol antagonist). Data represent means of three independent experiments, which yielded highly reproducible results. Strains are as defined in Table 1.

8 VOL. 7, 2008 CANDIDA RESISTANCE TO HOST DEFENSE PEPTIDES 1325 Downloaded from FIG. 4. Comparative kinetics of SSD1 expression in C. albicans strains S (S) and R (R) in the presence or absence of protamine (0.4 mg/ml) by Northern analysis. In the bottom panel, relative levels of expression of SSD1 in strains S and R were derived from densitometric analysis normalized to the housekeeping gene ACT1. Key: white bars, S ; black bars, R. Note the consistently higher expression of SSD1 in strain R in the presence or absence of protamine. Normalization to EFB1 and to total 28S rrna produced equivalent patterns of results (data not shown). for wild-type or complemented strains competent with respect to SSD1. Thus, the present data substantiate the concept that relative susceptibility or resistance to antimicrobial peptides significantly influences C. albicans virulence. These results support prior correlates between increased candidal virulence and resistance to host defense peptides in the rabbit model of disseminated infection (41 43). The current findings suggest that SSD1 governs C. albicans resistance to host defense peptides in multiple anatomic contexts. For example, SSD1 affords resistance to -defensins (e.g., hnp-1) or -defensins (e.g., h D-2) originating from mucosa, phagocytes, or other sites. Likewise, SSD1 expression reduced susceptibility to synthetic peptides RP-1, RP-11, and RP-13, which are modeled upon -helical or -hairpin determinants of platelet microbicidal proteins found in the bloodstream (44, 50). It should be noted that mice express -defensins (e.g., cryptdins) (26) and -defensins (32) as well as helical cathelicidin-related antimicrobial peptide in skin, mammary glands, and other tissues and in saliva (24). Despite structural distinctions, many host defense peptides have a net cationic charge at physiologic ph (45, 49), contain structural archetypes such as the -core motif (47), and have similar microbial targets, including the cell membrane and cellular energetics (45, 48). The fact that SSD1 appears to confer protection against host defense peptides differing in structure but sharing the mode of action suggests commonalities in peptideinduced injury against which SSD1 protects C. albicans. In contrast, an absence of candidal SSD1 in either S. cerevisiae or C. albicans did not render organisms hypersusceptible to his-5, which is found in human saliva. These findings imply that his-5 has targets different from those of other antimicrobial peptides examined in this study. Finally, we observed that peptide-susceptible strains predominated in cases of twofold-increased MICs or MFCs to nonpeptide stressors (e.g., H 2 O 2 or AMB). This inverse relationship, where SSD1 confers resistance to some but not all peptides and does not confer resistance to nonpeptide stressors, substantiates our hypothesis that SSD1 mediates relatively specific resistance to relevant host defense effector molecules. Paradoxically, deletion of SSD1 in S. cerevisiae has been on September 13, 2018 by guest

9 1326 GANK ET AL. EUKARYOT. CELL FIG. 5. Influence of SSD1 on C. albicans virulence in the murine model of hematogenously disseminated candidiasis. Male BALB/c mice were injected via the tail vein with blastospores of C. albicans in 0.3 ml of phosphate-buffered saline. Each strain was injected into 9 or 10 mice per group per experiment, and the mice were monitored for survival three times daily for 14 days. Animals still surviving at day 14 were censored at that time point. The experiment was repeated two times and the results were combined. Strain key: E, DAY185 (wild type);, APR 2 (ssd1 /ssd1 - null mutant); Œ, APR 2comp (ssd1 /ssd1 - ::SSD1 complemented). The asterisk indicates a significant difference from the parent or complemented strain (P 0.05). associated with increased lethality in the murine model (39). Mice inoculated with an S. cerevisiae SSD1 null mutant rapidly developed a sepsis-like condition. While this result superficially implicates SSD1 as a negative virulence factor, equally high inocula of wild-type C. albicans can produce this effect (33). Furthermore, proinflammatory cytokines were elevated in mice inoculated with the S. cerevisiae SSD1 null mutant. However, there was no evidence of infection (e.g., tissue burden or proliferation) due to the null mutant or its wild-type counterpart. Also, in the prior study, the loss of SSD1 in S. cerevisiae corresponded with a loss of cell wall integrity and abnormal -glucan composition compared to what was seen for the wild type (39). Thus, it is likely that the absence of SSD1 in S. cerevisiae yields defective cell wall integrity and composition that resulted in sepsis-like toxicity. Moreover, the difference in virulence levels between strains of C. albicans and S. cerevisiae that lack SSD1 suggests that this gene may have distinct functions in the two organisms. Further investigation of C. albicans SSD1 is ongoing and should clarify our understanding of these putative differences. The mechanism(s) through which SSD1 contributes to antimicrobial peptide resistance in C. albicans or other fungi is unclear. In plant fungal pathogens such as Colletotrichum and Magnaporthe, SSD1 orthologues are critical for protection against antimicrobial defenses (35). However, the mechanisms by which these orthologous genes function have not been elucidated. Likewise, little is known regarding the functions of SSD1 in human pathogens such as Candida. The present studies suggest that the pathway(s) by which SSD1 mediates resistance to host defense peptides is distinct from global stress adaptations, such as oxidative stress, phospholipid perturbation, or ergesterol disruption. In S. cerevisiae, an SSD1 analogue is involved in resistance to a plant host defense protein, osmotin (13); suppresses certain splicing mutants (20); posttranscriptionally regulates gene expression (15); and may be activated individually or in combination by the PKC1, MPT5 (11, 15), TOR (30), and ACE (17) signal transduction pathways. Chen and Rosamond (5) demonstrated that C. albicans SSD1 expressed in an S. cerevisiae null ssd1 background can rescue multiple mutations linked to stress response and cell wall integrity. The mechanisms by which SSD1 suppresses such mutations are not known; however, Ssd1p has significant homology to fungal protein phosphatases (34) and may bind to RNA (36). Important studies from the Edgerton laboratory suggest that Ssa1p/Ssa2p (19) and TRK1 (2, 38) serve in respective sensor and ion channel roles involved in C. albicans susceptibility to his-5. Based on present and prior studies, we hypothesize that SSD1 mediates resistance to host antimicrobial peptides by regulating cell wall and/or membrane adaptive modification. Consistent with this hypothesis, cytoplasmic membrane and cell wall adaptation are important mechanisms of antimicrobial peptide resistance in bacterial pathogens (44 47). Thus, the potential functions of SSD1 and its putative target genes are under investigation to gain new insights into mechanisms by which Candida may resist or circumvent molecular host defenses. In summary, the current findings indicate that SSD1 is integral to C. albicans resistance to host defense peptides, a phenotype that appears to enhance the virulence of this organism in vivo. These results provide new insights into the mechanisms by which C. albicans survives in the face of innate immunity. For example, an increase in resistance to host defense peptides, a decrease in host elaboration of such peptides, or a combination of these conditions would be expected to enhance the likelihood of opportunistic infections due to C. albicans or other fungi. Moreover, SSD1 appears to be distinct from global stress responses and mediates resistance to specific antimicrobial peptides. Thus, host defenses that protect against commensal versus pathogenic C. albicans likely involve antimicrobial peptides that function in specific host contexts (45). ACKNOWLEDGMENTS We are grateful to Deborah Kupferwasser for excellent technical assistance. The insights of Aaron Mitchell, Theodore White, and Richard Calderone are greatly appreciated. We thank Thea Bordenave- Sande, who participated in this project through the Hanley Memorial Pomona College Summer Scholar Program, in the Division of Adult Infection Diseases, Harbor-UCLA Medical Center. This project was conducted at the Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center. These studies were conducted with support in part by grants from the National Institutes of Health (AI [Y.F.], AI [J.E.E.], AI [S.G.F.], and AI and AI [M.R.Y.]). REFERENCES 1. Alonso-Valle, H., O. Acha, J. D. Garcia-Palomo, C. Farinas-Alvarez, C. Fernandez-Mazarrasa, and M. C. Farinas Candidemia in a tertiary care hospital: epidemiology and factors influencing mortality. Eur. J. Clin. Microbiol. Infect. Dis. 22: Baev, D., A. Rivetta, S. Vylkova, J. N. Sun, G. F. Zeng, C. L. Slayman, and M. Edgerton The TRK1 potassium transporter is the critical effector for killing of Candida albicans by the cationic protein, Histatin 5. J. Biol. Chem. 279: Braff, M. H., A. Bardan, V. Nizet, and R. L. Gallo Cutaneous defense mechanisms by antimicrobial peptides. J. Investig. Dermatol. 125: Brand, A., D. M. MacCallum, A. J. Brown, N. A. Gow, and F. C. Odds Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus. Eukaryot. Cell 3: Chen, C. Y., and J. Rosamond Candida albicans SSD1 can suppress multiple mutations in Saccharomyces cerevisiae. Microbiology 144:

10 VOL. 7, 2008 CANDIDA RESISTANCE TO HOST DEFENSE PEPTIDES Daniels, W., D. D. Glover, M. Essmann, and B. Larsen Candidiasis during pregnancy may result from isogenic commensal strains. Infect. Dis. Obstet. Gynecol. 9: Edgerton, M., S. E. Koshlukova, M. W. Araujo, R. C. Patel, J. Dong, and J. A. Bruenn Salivary histatin 5 and human neutrophil defensin 1 kill Candida albicans via shared pathways. Antimicrob. Agents Chemother. 44: Eggimann, P., P. Francioli, J. Bille, et al Fluconazole prophylaxis prevents intra-abdominal candidiasis in high-risk surgical patients. Crit. Care Med. 27: Fu, Y., S. G. Filler, B. J. Spellberg, W. Fonzi, A. S. Ibrahim, T. Kanbe, M. A. Ghannoum, and J. E. Edwards, Jr Cloning and characterization of CAD1/AAF1, a gene from Candida albicans that induces adherence to endothelial cells after expression in Saccharomyces cerevisiae. Infect. Immun. 66: Fu, Y., G. Rieg, W. A. Fonzi, P. H. Belanger, J. E. Edwards, Jr., and S. G. Filler Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells. Infect. Immun. 66: Gerik, K. J., M. J. Donlin, C. E. Soto, et al Cell wall integrity is dependent on the PKC1 signal transduction pathway in Cryptococcus neoformans. Mol. Microbiol. 58: Gudlaugsson, O., S. Gillespie, K. Lee, et al Attributable mortality of nosocomial candidemia, revisited. Clin. Infect. Dis. 37: Ibeas, J. I., D. J. Yun, B. Damsz, et al Resistance to the plant PR-5 protein osmotin in the model fungus Saccharomyces cerevisiae is mediated by the regulatory effects of SSD1 on cell wall composition. Plant J. 25: Johansen, C., A. Verheul, L. Gram, T. Gill, and T. Abee Protamineinduced permeabilization of cell envelopes of gram-positive and gram-negative bacteria. Appl. Environ. Microbiol. 63: Kaeberlein, M., and L. Guarente Saccharomyces cerevisiae MPT5 and SSD1 function in parallel pathways to promote cell wall integrity. Genetics 160: Klempp-Selb, B., D. Rimek, and R. Kappe Karyotyping of Candida albicans and Candida glabrata from patients with Candida sepsis. Mycoses 43: Kurischko, C., G. Weiss, M. Ottey, and F. C. Luca A role for the Saccharomyces cerevisiae regulation of Ace2 and polarized morphogenesis signaling network in cell integrity. Genetics 171: Lehrer, N., E. Segal, and L. Barr-Nea In vitro and in vivo adherence of Candida albicans to mucosal surfaces. Ann. Microbiol. (Paris) 134B: Li, X. S., M. S. Reddy, D. Baev, and M. Edgerton Candida albicans Ssa1/2p is the cell envelope binding protein for human salivary histatin 5. J. Biol. Chem. 278: Luukkonen, B. G., and B. Séraphin A conditional U5 snrna mutation affecting pre-mrna splicing and nuclear pre-mrna retention identifies SSD1/SRK1 as a general splicing mutant suppressor. Nucleic Acids Res. 27: Marco, F., S. R. Lockhart, M. A. Pfaller, et al Elucidating the origins of nosocomial infections with Candida albicans by DNA fingerprinting with the complex probe Ca3. J. Clin. Microbiol. 37: McKinnon, P. S., D. A. Goff, J. W. Kern, et al Temporal assessment of Candida risk factors in the surgical intensive care unit. Arch. Surg. 136: Miller, L. G., R. A. Hajjeh, and J. E. Edwards, Jr Estimating the cost of nosocomial candidemia in the United States. Clin. Infect. Dis. 32: a.National Committee for Clinical Laboratory Standards Reference method for broth dilution antifungal susceptibility testing of yeasts. Approved standard, 2nd ed. M27-A2. NCCLS, Wayne, PA. 24. Nizet, V., T. Ohtake, X. Lauth, et al Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 414: Nobile, C. J., D. R. Andes, J. E. Nett, F. J. Smith, F. Yue, Q. T. Phan, J. E. Edwards, S. G. Filler, and A. P. Mitchell Critical role of Bcr1-dependent adhesins in C. albicans biofilm formation in vitro and in vivo. PLoS Pathog. 2:e Ouellette, A. J., and M. E. Selsted Paneth cell defensins: endogenous peptide components of intestinal host defense. FASEB J. 10: Pappas, P. G., J. H. Rex, J. Lee, et al A prospective observational study of candidemia: epidemiology, therapy, and influences on mortality in hospitalized adult and pediatric patients. Clin. Infect. Dis. 37: Pittet, D., M. Monod, P. M. Suter, E. Frenk, and R. Auckenthaler Candida colonization and subsequent infections in critically ill surgical patients. Ann. Surg. 220: Ray, T. L., K. B. Digre, and C. D. Payne Adherence of Candida species to human epidermal corneocytes and buccal mucosal cells: correlation with cutaneous pathogenicity. J. Investig. Dermatol. 83: Reinke, A., S. Anderson, J. M. McCaffery, et al TOR complex 1 includes a novel component, Tco89p (YPL180w), and cooperates with Ssd1p to maintain cellular integrity in Saccharomyces cerevisiae. J. Biol. Chem. 279: Sanchez, A. A., D. A. Johnston, C. Myers, J. E. Edwards, Jr., A. P. Mitchell, and S. G. Filler Relationship between Candida albicans virulence during experimental hematogenously disseminated infection and endothelial cell damage in vitro. Infect. Immun. 72: Selsted, M. E., and A. J. Ouellette Mammalian defensins in the antimicrobial immune response. Nat. Immunol. 6: Spellberg, B., A. S. Ibrahim, J. E. Edwards, Jr., and S. G. Filler Mice with disseminated candidiasis die of progressive sepsis. J. Infect. Dis. 192: Sutton, A., D. Immanuel, and K. T. Arndt The SIT4 protein phosphatase functions in late G 1 for progression into S phase. Mol. Cell. Biol. 11: Tanaka, S., K. Yamada, K. Yabumoto, S. Fujii, A. Huser, G. Tsuji, H. Koga, K. Dohi, M. Mori, T. Shiraishi, R. O Connell, and Y. Kubo Saccharomyces cerevisiae SSD1 orthologues are essential for host infection by the ascomycete plant pathogens Colletotrichum lagenarium and Magnaporthe grisea. Mol. Microbiol. 64: Uesono, Y., A. Toh-e, and Y. Kikuchi Ssd1p of Saccharomyces cerevisiae associates with RNA. J. Biol. Chem. 272: Voss, A., R. J. Hollis, M. A. Pfaller, R. P. Wenzel, and B. N. Doebbeling Investigation of the sequence of colonization and candidemia in nonneutropenic patients. J. Clin. Microbiol. 32: Vylkova, S., X. S. Li, J. C. Berner, and M. Edgerton Distinct antifungal mechanisms: beta-defensins require Candida albicans Ssa1 protein, while Trk1p mediates activity of cysteine-free cationic peptides. Antimicrob. Agents Chemother. 50: Wheeler, R. T., M. Kupiec, P. Magnelli, C. Abeijon, and G. R. Fink A Saccharomyces cerevisiae mutant with increased virulence. Proc. Natl. Acad. Sci. USA 100: Wilson, R. B., D. Davis, and A. P. Mitchell Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181: Yeaman, M. R., A. S. Ibrahim, J. E. Edwards, Jr., A. S. Bayer, and M. A. Ghannoum Thrombin-induced rabbit platelet microbicidal protein is fungicidal in vitro. Antimicrob. Agents Chemother. 37: Yeaman, M. R., D. Cheng, B. Desai, et al Susceptibility to thrombininduced platelet microbicidal protein is associated with increased fluconazole efficacy against experimental endocarditis due to Candida albicans. Antimicrob. Agents Chemother. 48: Yeaman, M. R., S. S. Soldan, M. A. Ghannoum, J. E. Edwards, Jr., S. Filler, and A. S. Bayer Resistance to platelet microbicidal protein results in increased severity of experimental Candida albicans endocarditis. Infect. Immun. 64: Yeaman, M. R., K. D. Gank, A. S. Bayer, and E. P. Brass Synthetic peptides that exert antimicrobial activities in whole blood and blood-derived matrices. Antimicrob. Agents Chemother. 46: Yeaman, M. R., and N. Y. Yount Mechanisms of antimicrobial peptide action and resistance. Pharmacol. Rev. 55: Yeaman, M. R., and N. Y. Yount Code among chaos: immunorelativity and the AEGIS model of antimicrobial peptides. ASM News 71: Yount, N. Y., and M. R. Yeaman Multidimensional signatures in antimicrobial peptides. Proc. Natl. Acad. Sci. USA 101: Yount, N. Y., and M. R. Yeaman Immunocontinuum: perspectives in antimicrobial peptide mechanisms of action and resistance. Protein Pept. Lett. 12: Yount, N. Y., K. D. Gank, Y. Q. Xiong, et al Platelet microbicidal protein 1: structural themes of a multifunctional antimicrobial peptide. Antimicrob. Agents Chemother. 48: Yount, N. Y., and M. R. Yeaman Structural congruence among membrane-active host defense polypeptides of diverse phylogeny. Biochim. Biophys. Acta 1758: