PARADOXICAL GROWTH TO CASPOFUNGIN IN Candida albicans IS ASSOCIATED WITH MULTIPLE CELL WALL REARRANGEMENTS AND

Transcription

1 AAC Accepts, published online ahead of print on 2 December 2013 Antimicrob. Agents Chemother. doi: /aac Copyright 2013, American Society for Microbiology. All Rights Reserved PARADOXICAL GROWTH TO CASPOFUNGIN IN Candida albicans IS ASSOCIATED WITH MULTIPLE CELL WALL REARRANGEMENTS AND DECREASED VIRULENCE Cristina Rueda, Manuel Cuenca-Estrella and Oscar Zaragoza 1. Mycology Reference Laboratory, National Center for Microbiology, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain. Keywords: Paradoxical growth; caspofungin; Candida; chitin; -1,3-glucan; virulence Short title: Caspofungin affects Candida morphology and virulence (1) Address for correspondence: Oscar Zaragoza. Mycology Reference Laboratory. National Centre for Microbiology. Instituto de Salud Carlos III. Carretera Majadahonda-Pozuelo, Km2. Majadahonda Madrid, Spain. Phone: ozaragoza@isciii.es. 1

2 16 ABSTRACT In the last decade echinocandins have emerged as an important family of antifungal drugs because its fungicidal activity against Candida spp. Echinocandins inhibit the enzyme -1,3-D-glucan synthase, encoded by the FKS genes, and resistance to echinocandins is associated with mutations in this gene. In addition, echinocandin exposure can produced paradoxical growth, defined as the ability to grow at high antifungal concentrations, but not at intermediate. In this work, we have demonstrated that paradoxical growth of Candida albicans in the presence of caspofungin is not due to antifungal degradation or instability. Media with high caspofungin concentrations recovered from wells where C. albicans showed paradoxical growth inhibited the growth of a C. krusei reference strain. Cells exhibiting paradoxical growth at high caspofungin concentrations showed morphological changes as enlarged size, abnormal septa and absence of filamentation. Chitin content increased from the minimal inhibitory concentration to the high caspofungin concentrations. Despite of the high chitin levels, around 23% of cells died after the treatment with caspofungin indicating that chitin is required, but not sufficient to protect the cells from the fungicidal effect of caspofungin. Moreover, we found that after paradoxical growth, the cells exposed β-1,3-glucan. Cells grown at high caspofungin concentrations had decreased virulence in the invertebrate host Galleria mellonella. Cells grown at high caspofungin concentration also induced a pro-inflammatory response in murine macrophages compare to control cells. Our work highlights important aspects about fungal 2

3 39 40 adaptation to caspofungin and although this adaptation is associated with reduced virulence, the clinical implications remain to be elucidated. 41 3

4 42 INTRODUCTION Candidemia is a frequent disease among immunosuppressed patients caused by opportunistic fungal pathogens from the genus Candida. Candida albicans is the most abundant species found in invasive candidiasis, although an increase of other non-albicans Candida species has been described in the last years (1, 2). Echinocandin administration constitutes the main treatment for this disease. Currently three echinocandins drugs, caspofungin (CAS), micafungin and anidulafungin, are available for clinical practice. These antifungals are fungicidal against most Candida species, and are effective against Candida isolates that are resistant to other antifungals (3). Echinocandins are lipopeptides that inhibit the activity of -1,3-D-glucan synthase, which is encoded by FKS genes (4). Resistance to echinocandins has been described at low frequency. The main resistance mechanism is associated with mutations in two regions of the FKS gene, denominated hot spot regions (HS). These mutations result in proteins with reduced affinity for the antifungal (2, 5-7). But in addition, there are other situations in which the yeasts can grow in the presence of the antifungal. In particular, paradoxical growth (PG, also known as Eagle effect) is observed in vitro and occurs when the cells can grow in the presence of high antifungal concentrations, but remain fully susceptible at intermediate-low concentrations (8). Paradoxical growth to echinocandins has been observed in Candida albicans, C. parapsilosis, C. krusei, C. tropicalis, and C. dubliniensis (8-14). This phenomenon is echinocandin and species specific. Paradoxical growth is mainly observed in the 4

5 presence of caspofungin (10). This phenomenon has been studied mainly for caspofungin with the objective to clarify the mechanisms involved and possible clinical implications (8, 15-19). Paradoxical growth is associated with activation of the salvage pathways and changes in cell morphology and cell wall rearrangements (15, 19, 20). During PG, there is an increase in chitin content, which suggests a rescue mechanism against caspofungin (15, 19-23). The clinical relevance of paradoxical effect is still unclear, and it is not even known if this is an in vitro phenomenon related to antifungal instability. In the present work we demonstrate that PG is a consequence of adaptation mechanism to high CAS concentrations and is not related to lack of activity of the antifungal. Moreover, we show that PG is associated with decreased virulence in the invertebrate host, Galleria mellonella, which gives insights about the clinical relevance of this phenomenon. 5

6 79 MATERIALS AND METHODS Strains and growth conditions. To study the presence and reproducibility of PG, thirty-four clinical C. albicans isolates obtained from blood samples were obtained from the yeast collection of the Mycology Reference Laboratory of the Spanish National Centre for Microbiology. These strains have been characterized by morphological features and by molecular identification after sequencing the ITS1-5.8s-ITS2 region from the ribosomal DNA (24). For experiments relative to paradoxical growth a strain exhibiting paradoxical growth, CL-8102, was selected from the clinical isolates cited above. Additionally, two American Type Culture Collection strains, C. krusei ATCC 6258 and C. parapsilosis ATCC 22019, were used as controls. Isolates were grown in Sabouraud Dextrose Agar (SAB, OXOID LTD, Basingstoke, Hampshire, England) plates at 30ºC and experiments were carried out after growth one colony isolate from the original culture for 24h at 35ºC. Antifungal susceptibility. Minimal inhibitory concentrations (MIC) for caspofungin (CAS) were determined for all C. albicans isolates following the reference procedure for testing fermentative yeasts established by the AFST-EUCAST(25-27), using RPMI medium at ph 7.0 buffered with morpholinepropanesulfonic acid (MOPS) and supplemented with 2% glucose. Caspofungin was used at a concentration range between 0.03 and 16 mg/l. Optical density (OD) of the plates was determined after 24 and 120 hours (h), and MIC value was determined by 50% reduction of growth respect to the drug-free growth control after 24 hours of growth. Paradoxical growth after 120 h of incubation was confirmed when a 6

7 significant increase in cell growth (OD increase 0.2 related to the MIC value) was observed in CAS concentrations that were at least two concentrations above the MIC. Antifungal susceptibility tests were performed twice in a lapse of time to study the reproducibility of paradoxical effect. In some experiments, 50% serum was added to the AFST plates. In these cases, the cells were not suspended in water, but in human serum (SIGMA-Aldrich, St. Louis, US), and 100 µl of the serum were added to the wells containing the RPMI and the different caspofungin concentrations (2x). Time-Kill curves (TKC). Caspofungin was tested at concentrations of 0.25, 0.5, 1, 2, 4 and 8 mg/l for C. albicans isolates CL8102 (exhibiting paradoxical growth) and CL8104 (susceptible strain without paradoxical growth). Time-kill curve method was adapted from standard methods (28-30). Briefly, the cells were inoculated in Sabouraud solid medium and incubated overnight at 35 o C. Then, a suspension was prepared in PBS at approximately 10 5 cells/ml. One hundred µl of this sample were placed in microdilution plates which contained different CAS concentration (2x) which were prepared as described above. The plates were incubated at 35 o C, and 10 µl aliquots from each well were removed after 0, 5, 24 and 120 h. After 1/100 and 1/10,000 dilutions, 50 µl aliquots were placed on SAB plates and incubated at 35 o C for 48 h. Fungicidal activity was considered to be achieved when colony number decreased 3-log 10 (99.9%) compared to the starting inoculum (30). Results were confirmed in two separate experiments on different days. 7

8 Determination of the stability and activity of caspofungin after its use in antifungal susceptibility testing. The following experiments were carried out to exclude the possibility that paradoxical growth is due to a loss of activity of the drug at high doses during the antifungal susceptibility testing. First, the influence of the incubation temperature on echinocandins activity was determined by preincubation of microdilution plates for 120 h at 35 o C. The plates were then inoculated with x 10 5 CFU/mL and MIC values were determined after 24 h of incubation at 35 o C by duplicate. As control, MIC was determined using microdilution plates that were stored at -80 o C. In other experiments, microdilution plates were inoculated with C. albicans CL8102 strain, as described above, and incubated for 120 h. Paradoxical growth was determined by measuring the OD at 530 nm. The content of the well was transferred to 1.5 ml eppendorf tubes and the media were centrifuged twice at 12,000 rpm for 5 min in a bench centrifuge. The pellets were discarded and the media were placed in microdilution wells. In some experiments, these media were supplemented with 2% glucose. The plates were inoculated with the reference strain C. krusei ATCC 6258 ( x 10 5 cells/well), and OD at 530 nm was measured after incubation of the plates for 24h at 35 o C. To measure the ph of the media, 5 µl were placed on universal indicator paper ph 1-14 (NAHITA, I.C.T., S.L., Spain). To confirm that the growth on these plates was due only to C. krusei ATCC 6258 and not to residual C. albicans from the initial incubation, cells from wells were placed on CHROM agar (CHROMagar, Paris, France) for 48h at 30 o C. 8

9 Growth curves. Growth curves were performed in microdilution plates with caspofungin concentrations between 0.03 to 16 mg/l in RPMI medium. An initial inoculum of x 10 5 cells/ml was used. In addition control wells without antifungal and sterile control were added. ODs at 540 nm were recorder each hour for 72 hours. Growth curves were adjusted to Gomperzt model using GraphPad Prism Software, version 5.0. Latency period defined as the time needed to reach the basal OD and start exponential growth. DNA sequence analysis of FKS1 hot-spot regions (HS). The DNA sequence of the HS from the CaFKS1 gene was obtained as described previously (5). Briefly, genomic DNA was extracted from individual colonies using the phenol-chloroform protocol (31) and purified using Chroma SPIN + TE 200 columns (Clontech Laboratories, Becton Dickinson, Madrid, Spain). Hot spot regions were amplified with the forward (F) and reverse (R) primers (1 µm) 5 TTTATTCAAATTCTTGCC3 (HS1-F), 5 AATGCCATGATGAGAGGTGG3 (HS2-F), 5 GGAATGCCATTGTTATTTCC3 (HS1-R), and 5 GGTACAGTTTCTCATTGGCA3 (HS2-R). PCRs were performed with 5 ng/ml of DNA as follows: initial 15 min at 94ºC, 30 cycles of 95 o C for 30 s, 54 o C for 45 s, and 72 o C for 2 s, with a final extension step at 72 o C for 7 min. PCR products were purified with the enzymatic mix EXOSAP (Promega, Madison, Wi, US). Purified PCR fragments were sequenced on both strands using 1 µm HS-F and HS-R primer, and the Big Dye Kit (Applied Biosystems, Life Technologies Ltd., Paisley, UK) to perform sequence reactions. Sequences were assembled and edited using 9

10 the SeqMan II and EditSeq Lasergene software programs (DNAstar, Madison, WI, US) Estimation of chitin content in the cell wall. To study the chitin accumulation on cell wall in response to different CAS concentrations, cells were stained with 10 mg/l of Calcofluor White (CFW) (SIGMA-Aldrich, St. Louis, US) at 37 o C for 30 min and washed twice with PBS before examined. Pictures were taken with the same exposure time for all the samples using Leica Application Suite program (LAS). Mean fluorescence intensities were calculated for at least 20 individual cells for each condition using ImageJ software (NIH) ( In addition, cells growing with CAS 8 mg/l were stained with wheat germ agglutinin conjugated to Alexa 594 (WGA) (Molecular Probes, Life Technologies Ltd., Paisley, UK) which is a lectin that specifically binds to sialic acids and -1,4-Nacetylglucosamine oligomers which are the main chitin components (32). In these experiments, mortality was also evaluated using SYTOX Green Dead Cell Stain (Molecular Probes, Life Technologies Ltd., Paisley, UK). Briefly, cells were stained after caspofungin treatment with 30 nm of SYTOX Green Dead Cell Stain for 20 min at RT to identify dead cells. Then, the samples were washed twice with PBS and fixed with 4% paraformaldehyde for 40 min at RT. Cells were stained with 5 mg/l of WGA at 37 o C for 60 min. Cells were then washed twice with PBS and stained with 10 mg/l of CFW at 37 o C for 30 min. Samples were then washed with PBS and 6 µl aliquots were placed on glass slides and examined under a Leica DMI 3000B fluorescence microscope. Fluorescence pictures were taken and analyzed as described above. 10

11 Detection of -1,3-glucan by immunofluorescence. To evaluate the distribution and cell wall content of -1,3-glucan, we performed an indirect immunofluorescence with monoclonal antibodies to this polysaccharide (33). β-1,3- glucans are localized in the inner layer of the cell wall so they are inaccessible for the Abs. For this reason, in regular cells, no signal is detected using this approach. So as controls, and to unmask this polysaccharide, in some experiments, the cells were heated at 99ºC for 30 min. The cells were fixed with 4% of paraformaldehyde at room temperature for 40 min and washed with PBS. Then, the cells were suspended in PBS containing 1% of bovine serum albumin (BSA) for 30 min and incubated with 5 µg/ml of mouse IgG monoclonal antibody to -1,3-glucan (Biosupplies Australia Pty Ltd, Bundoora Victoria, Australia) for 1h at 37 o C. Then cells were washed with PBS three times and incubated with 10 µg/ml of goat antimouse IgG TRITC (SouthernBiotech, Birmingham, Alabama, US) for 1h at 37 o C in darkness. Cells were washed three times with PBS and aliquots of 6 µl were placed on glass slides and visualized by Leica DMI 3000B fluorescence microscope. Morphological characterization of yeast cells after growth in the presence of caspofungin. Caspofungin susceptibility testing of C. albicans CL8102 strain was performed as described above. The plates were incubated for 120 h, and the cells recovered from the wells were concentrated in 10 µl of distilled H 2 O. Aliquots of 6 µl were placed on glass slides and observed by light microscopy using the 40x objective. Images were digitally recorded using LAS program. Cellular volumes 11

12 from at least 20 cells were calculated using the spheroid equation V= b is the length and a is the width of the cell. b 2 a, where Time-lapse recording and video processing. Candida albicans cells at a final concentration of x10 5 cells/well were suspended in a microdilution plate well containing 2 and 8 µg/ml of CAS in RPMI medium as described above. The plate was placed under a Leica DMI 4000B microscope which had a temperatureregulated chamber adjusted to 37 o C. Pictures were taken every 3 min for around 17 h using the 20x objective. The videos generated by the Leica software were exported as AVI documents and processed with ImageJ software (NIH) ( Virulence in Galleria mellonella. To investigate the virulence of C. albicans grown after growth at high caspofungin concentrations, CL-8102 strain was incubated in Sabouraud liquid Medium supplemented with 8 mg/l of CAS for 48h at 30 o C with moderate shaking. This strain was grown in parallel in the same medium without antifungal. The cultures were washed twice with sterile PBS and suspended in 2 ml of PBS containing ampicillin (20 µg /ml) (AMP/PBS). Since cells grown in the presence of high CAS concentrations aggregated, it was not possible to determine its concentration in a haemocytometer or by CFU enumeration. For this reason, we used two different methods to adjust the cell density and to prepare the inoculum: optical density measurement and XTT reduction by living cells. First, we calculated the correlation between OD and cell density in control cells. We determined the optical density (OD) at 530 nm of 12

13 suspensions of control cells grown in the absence of CAS. In parallel, we counted the cell density of this sample using an Automated Cell Counter TC 10 (BIO-RAD). In this way, a correlation between OD and cell number was established. This correlation was used to estimate the concentration of cells grown in presence of CAS. We prepared suspensions of these cells in PBS and measured its OD. Then the cell density was extrapolated according to the next formula: Estimated Concentration of cells grown in CAS=(OD cells grown in CAS x concentration control cells)/ OD control cells. Because treatment with CAS may alter the viability of C. albicans cells, the metabolic activity of the cells was also estimated using an independent method based on the reduction of XTT by the cells (34). Briefly, serial dilutions of control cells and CAS incubated cells from 6.25x10 5 to 1.56x10 5 cells were prepared in 50 µl of sterile PBS and placed in 96-wells plates. The cell density of cells grown in CAS was calculated as described above. As background controls, the same number of cells previously inactivated by incubation at 80 o C for 45 min were used. Then 50 µl of 2x solution of XTT (1 mg/ml)/ Menadione (50 µm) were added to the wells, and the mix was incubated at 37 o C for 1 hour. Absorbance was measured at 405 nm in an automated microtiter plate reader. Mitochondrial activity was calculated as follows: first OD of death cells by heat were subtracted to OD of alive cells and then the relation between OD of caspofungin incubated cells and control cells was determined. Propidium iodide (PI) staining (SIGMA Aldrich, St Louis US) was performed to correlate with XTT results. Viable and dead cells were determined after incubation with 2.5 mg/l of PI at room temperature in dark. Then 13

14 cells were washed with PBS and aliquots of 6 µl were placed onto glass slides and examined using a microscope equipped with fluorescence Survival assays were performed using G. mellonella as model host (35, 36). The larvae (Alcotan, Valencia, Spain) were selected by weight ( mg). Larvae with dark spots on the cuticle were discarded. Two yeast inoculum concentrations prepared in PBS supplemented with 20 µg/ml of ampicillin (AMP) were chosen as follows: a high dose inoculum of 1.5x10 6 and 10 6 cells per larva and a low range inoculum 7.5x10 5 and 5x10 5 cells per larva. Each infection group contained 20 larvae. As controls 10 larvae without inoculum and 10 larvae inoculated with PBS were used. The inoculum (10 µl) was injected directly in the haemolymph through the last pro-legs using a 10 µl Hamilton syringe. Larvae were incubated at 37 o C and the number of dead larvae was scored daily. Determination of larvae melanization. Larva melanization was evaluated as a parameter of the immune response elicited by G. mellonella after infection (36-39). Briefly, 8 larvae per group were infected with selected inoculum described above. After 30 minutes, the haemolymph was obtained by apical incision with a scalpel and diluted 1:10 with cold sterile PBS immediately. To avoid residual cells, samples were centrifuged at 5,000 rpm for 5 min, and OD was determined at 405 nm. As a basal control larvae inoculated with AMP/PBS were used. Histopathological analysis of infected G. mellonella. Larva histology was performed as described in (40). Three larvae per group were longitudinal sectioned and fixed for 24h in 4% buffered formalin and dehydrated with increasing 14

15 concentrations of ethanol (70%, 80%, 90%, 96% and 100%). The samples were then treated with xylene and paraffin embedded. Tissue sections of 5 microns were stained with periodic acid Schiff (PAS) and sections examined with a Leica DMI 3000B microscope. Macrophage response. Mice (CD1, male, Charles River Lab. International, Inc., Massachusetts, US) were sacrificed at 4 weeks of age, and primary macrophages were isolated after several washes of the peritoneal cavity with 1% Streptomicin in PBS using a Pasteur pipette. Then cells were washed with 1% Streptomicin in PBS and counting using a haemocytometer. Cells were plated in 96-well plates at 10 5 cells per well and culture in feeding medium, which contained Dulbecco s modified Eagle s medium (Lonza, Verviers, Belgium) supplemented with 10% heat inactivated fetal bovine serum (FBS; HyClone-Perbio, Life Technologies Ltd., Paisley, UK), 10% NCTC medium (Sigma-Aldrich, Steinheim, Germany), and 1% nonessential amino acids (Sigma-Aldrich, Steinheim, Germany). Cells were incubated at 37ºC in a 5% CO 2 -enriched atmosphere overnight to allow macrophage adherence. Then, the wells were washed with the same medium to discard non-adherent cells. Macrophages were infected with yeasts grown in presence of caspofungin 8 mg/l in RPMI. As control, yeasts grown in absence of caspofungin were used. Prior to infection, yeasts were inactivated with paraformaldehyde 4% to prevent macrophage killing by yeast before the end of the experiment. Macrophages were infected in a ratio of 1:1 and 2:1 yeast per cells and incubated at 37ºC in a 5% CO 2 overnight. Then the supernatants were collected, and cytokines were determined using the Mouse Cytokine/Chemokine 15

16 Magnetic Bead Panel Kit coupled with Luminex instrumentation (Millipore Corp., Missouri, US). Minimum Detectable Concentrations: IFN-γ, 1.1 pg/ml; IL-6, 1.1 pg/ml; IL-10, 2.0 pg/ml; IL-12, 3.9 pg/ml; IL-17, 0.5 pg/ml and TNF-α, 2.3 pg/ml Statistical analysis. Statistical analyses were performed with GraphPad Prism, version 5 Project (GraphPad Software, San Diego, CA). Differences in chitin cell content were determined using t test. For in vivo experiments, Log Rank Test was used for comparative survival and ANOVA Test to compare melanization. Difference between cytokine productions was determined by ANOVA test and "Bonferroni's Multiple Comparison Test". Downloaded from on September 15, 2018 by guest 16

17 317 RESULTS Reproducibility of paradoxical growth. In initial studies, we observed the presence of paradoxical growth in CAS susceptibility testing plates, defined as growth in the presence of high concentrations of the antifungal, and absence of growth at the intermediate concentrations. Although this effect was visible after 24 hours of growth, it was more evident after longer incubation times ( h). We decided to characterize this phenomenon in detail. We first studied the presence and reproducibility of paradoxical growth to CAS in thirty five clinical isolates by performing AFST in two different experiments. In both experiments, all the isolates presented MIC values between 0.12 to 0.5 mg/l. The proportion of strains that showed paradoxical growth was 38% (13 out 34) and 29% (10 out of 34 strains) in the two experiments. This data indicated that paradoxical growth to CAS is a frequent and reproducible phenomenon among C. albicans isolates. Confirmation of CAS activity during paradoxical growth. To further characterize paradoxical growth, we chose a C. albicans isolate (CL8102) which was able to grow as much as control cells at high CAS concentrations in all the experiments performed (more than 50). First, we wanted to discard that paradoxical growth was due to inactivation or precipitation of CAS at high concentrations. For this purpose, we performed two different experiments. First, we pre-incubated the microdilution plates for 120 hours at 35 o C before inoculating them with the yeasts. We observed that in these conditions, MIC values to one representative strain from C. albicans, C. parapsilosis and C. krusei were not 17

18 significantly affected (Table 1) and it was only one dilution higher when compared to the control plate not preincubated at 35 o C, indicating that long time incubations did not affect the activity of the antifungal and that compound did not precipitate on well-bottoms. In addition paradoxical growth of C. albicans CL-8102 strain was confirmed in preincubated microdilution plates (data not shown). We then wanted to investigate if after growth of the yeast at high CAS concentrations, the antifungal left in the wells was still active, or if in contrast, it had lost its activity. For this purpose, we performed antifungal susceptibility testing, and after confirming the presence of paradoxical effect after 120 h of incubation (Figure 1A), we collected the media from the wells. We used these media to perform AFST of another yeast species, C. krusei, which is susceptible to caspofungin and easily differentiated from C. albicans in CHROM agar plates (C. albicans, green, C. krusei, pink). Since the media used in this experiment came from wells previously inoculated with C. albicans, it was possible that nutrient deprivation might influence the CAS activity. For this reason, we supplemented the media with fresh 2% glucose. We found that the susceptibility of C. krusei in the media where C. albicans had been incubated was not significantly different from that obtained in fresh plates, and there was only an increase in the MIC value of 1 dilution (Figure 1B and 1C). Moreover, the media which contained the highest CAS concentrations (8 and 16 mg/l) and in which C. albicans exhibited paradoxical growth were still effective to completely inhibit the growth of C. krusei (Figure 1B). To discard that paradoxical growth was a consequence of ph changes after yeast growth, we determined the ph of the media using paper strips. All media presented ph

19 comparable with the ph of RPMI medium measured as control (ph 7), indicating that PG did not correlate with ph changes. Addition of human serum (50%) inhibited the paradoxical growth of the C. albicans CL8102 strain (data not shown) Reversibility of paradoxical growth. We then investigated if paradoxical growth was reversible or if in contrast it was a permanent trait. So after growing the cells at high CAS concentration, we passaged them to regular Sabouraud plates without antifungal two times, and then measured its antifungal susceptibility to CAS. As shown in figure 1D, growth at high CAS concentration did not result in a permanent resistant phenotype, since the passage strains showed the same antifungal susceptibility profile as the control strain. To confirm this result, we sequenced the HS from the FKS1 gene of cells that grew at high CAS concentrations, and found that in these cells there were not any mutations in these HS regions (data not shown). Paradoxical growth is associated with changes in morphology and growth rate. We analyzed if the morphology of the cells was affected by the presence of CAS. Cells treated with sub-inhibitory CAS concentrations showed similar size compared to the growth control (cell volume around 200 µm 3 ). In contrast, increasing concentrations of CAS resulted in the appearance of a new population of cells with a larger size. Highest volumes were found starting at 4 mg/l of CAS, where cells increased the cellular volume up to 600 µm3 (Figure 2A) We then studied if the growth characteristics were affected depending of CAS concentration. With this purpose we first performed growth curves (Figure 2B). 19

20 Control cells rapidly induced hyphae formation and showed a short latency period (3.94 ± 0.49 h, see supporting video 1 and figure 2B). At high CAS concentrations (8 mg/l), the latency period was of ± 0.16 h, which was a 3.5 times higher compared to the growth control. This delay in the latency period did not impair the final growth of the yeasts, since the cells were able to reach a final OD which was almost the one obtained in control cells not exposed to caspofungin (Figure 2B). However, in vivo imaging demonstrated that growth at high CAS concentrations was different from the growth of control cells. Paradoxical growth at CAS 8 mg/l resulted in absence of hyphae formation, increase in cell size and clump formation due to defects in cell separation after budding (see supplemental video 2). As expected, intermediate concentrations (0.12 to 2 mg/l) exhibited absence of growth (Figure 2B), and only a few cells were able to divide for a few rounds (supplemental video 3). In addition, the studies with in vivo time-lapse imaging confirmed a delay in cell generation time. Cells treated with 2 and 8 mg/l of CAS exhibited a delay in bud emergence (4 and 2 times, respectively) directly correlated with CAS concentration (Figures 2C, 2F and 2I and supporting videos) On the other hand, image processing of cells incubated with 8 mg/l of CAS showed that those cells with increased size previously observed in morphological studies are the original mother cells (see white arrows from Figure 2I to 2K and supporting video 2). As a result, the differences in cell size observed during paradoxical growth may be dependent of the cell age. We also confirmed that the groups of cells characteristics during paradoxical growth are linked between them at the site of the initial mother-bud neck. Despite this, the explosion of cells 20

21 included in the aggregated did not influence the viability of the cells that were attached to it (see arrows on supplemental video 2) Caspofungin killing activity. We studied if CAS was still fungicidal in strains that exhibited PG, or if in contrast, in these strains, CAS did not kill the cells and behaved as a fungistatic agent. For this purpose, we performed time killing curves (TKC). We found that low and intermediate CAS concentrations had a strong fungicidal effect against this strain, similar to the killing effect found in strains which did not exhibit PG to (data not shown). Chitin accumulation as a response to caspofungin. Increase in chitin content has been correlated with paradoxical effect (7, 15, 17, 19, 21, 23). To investigate if CAS may influence chitin synthesis in our conditions, we used CFW staining. Chitin increased when CAS was added to the medium. This happened, not only at high CAS concentrations, but also at concentrations around the MIC. In contrast, CAS concentration below the MIC did not have any effect in chitin synthesis and remained similar to the growth control (Figure 3). We also examined whether an increase of the chitin content was sufficient to rescue the cells from the caspofungin killing effect. Changes in chitin content were studied with two different specific dyes, CFW and wheat germ agglutinin (WGA), and viability was visualized using the SYTOX staining (see material and methods). We found that there were around 23% (40 of 176 cells) of dead cells with high chitin content (Figure 4A to 4F). This finding suggested that chitin accumulation was not sufficient to produce the survival of a significant proportion of the cells. 21

22 ,3-Glucan detection. The presence of -1,3-glucan in C. albicans cells grown with high CAS concentrations was detected using an indirect immunofluorescence with specific monoclonal antibodies of this polysaccharide. In control cells, -1,3- glucans are localized in the inner layer of the cell wall so they are inaccessible for the Abs, and in consequence no fluorescence signal was found in these cells (Figure 4G). Control basal cells heat-treated unmasked -1,3-glucans with a uniform distribution over the cell wall (Figure 4H). Strikingly, when the cells grew in the presence of high CAS concentrations, a clear dotted labeling around the cell wall was observed, suggesting that in these conditions, the cells synthesized this polysaccharide (Figure 4I). Similar stain pattern was observed when cells exhibiting paradoxical growth received heat-treatment to unmask -1,3-glucans (Figure 4J). Sytox Green Stain revealed the presence of dead cells with -1,3- glucans on the cell wall (see arrows in figure 4I and 4J). This finding may suggests the presence of other compensatory mechanism implicated in cell adaptation. Virulence of C. albicans after growth in the presence of CAS. To investigate if cells grown at high CAS concentrations had affected their virulence, we performed survival experiments using as model host the lepidopteran Galleria mellonella which has been shown to be a feasible model to study fungal virulence (35, 36, 40). Since cells grown in the presence of CAS aggregated, we selected the inoculum sizes based on the metabolic activity of the cells and on the absorbance of the cell suspensions (see M&M). Candida albicans cells grown for 48 h in the presence of CAS (8 mg/l) showed a metabolic activity about 1.5 times lower compared to control cells (data not shown). This difference was considered to 22

23 compare the viability of larvae infected with C. albicans cells grown with or without caspofungin. Previous to inoculation of the larvae, adaptation to caspofungin and paradoxical growth was confirmed microscopically by the presence of cell clumps with enlarged size. Candida albicans grown under regular conditions (48h in Sabouraud liquid) were virulent in G. mellonella, and 100% of larvae infected with 10 6 cells per larva died after 2 days. In contrast, 40% of larvae infected with 1.5x10 6 cells grown in 8 mg/l CAS survived after 7 days. In case of larvae inoculated with 7.5x10 5 cells exhibiting PG, 50% were able to survive throughout the experiment. (p< in case of 1.5x10 6 CAS cells/ larva vs 10 6 control cells/larva, figure 5A and p= for 7.5x10 5 CAS cells/larva vs 5x10 5 Control cells/larva, figure 5B). During the inoculation of larvae, we observed that those infected with cells grown in presence of CAS (8 mg/l) melanized after few minutes of inoculation, so we decided to confirm melanization by measuring the optical density of the haemolymph. Significant differences (p<0.0001) between cells grown in CAS and control cells were observed after 30 minutes of infection (Figures 5C). To study the evolution of the infection, we performed histopathological analysis of larvae infected with control cells and cells grown in CAS 8 mg/l (6). At the beginning of the infection (30 minutes after infection), larvae infected with control cells (5x10 5 cells/larva and 10 6 cells/larva) presented a large number of hemocytes closed to the yeast cells, but melanization was not observed (Figures 6A and 6B). In contrast, larvae infected with cells grown in CAS 8 mg/l presented accumulation of hemocytes and even some of them appeared surrounding the clumps of cells 23

24 forming melanotic capsules (Figures 6C and 6D). At this time melanization at the infection sites was also observed in these larvae. After 1 day of infection, the larvae infected with the highest inoculum of control cells (10 6 cells per larva) showed a disseminated infection and hyphal formation (see arrow in Figure 6E), but a low number of melanotic capsules. In case of the lowest inoculum, 5x10 5 cells per larva, histological sections showed the presence of multiple melanotic capsules that surrounded budding yeasts (Figure 6F). In contrast, most of the larvae infected with cells grown in CAS showed melanotic capsules after day 1 of infection, independently of the inoculum size (Figure 6G). Interestingly, we observed budding cells with the regular morphology inside the capsules (Figure 6H). Hyphal development was also observed in the sections of larvae infected with cells grown in CAS (see arrow signaling in Figure 6G), although the number of hyphae found was significantly low compared to the hyphae found in larvae infected with control cells. Macrophage response. We also investigated if cells grown at high CAS concentration produced immune responses in the same way as control cells. For this purpose, we grew the cells in the presence or absence of CAS, and inactivated them by incubation in p-formaldehyde. Then we exposed them to primary murine peritoneal macrophages and measured cytokine production. Cells grown in presence of high caspofungin doses induced a greater pro-inflammatory response than untreated cells. This response was characterized by a significant increase (p<0.05) of pro-inflammatory cytokines as TNF-α, IL-17, IL-12 and IFN-γ (Figure 7). 24

25 In addition, yeast cells grown at high CAS concentration induced lower levels of anti-inflammatory cytokines (IL-10) compared to control cells

26 502 DISCUSSION Since paradoxical growth to caspofungin of Candida spp was first observed (8), different explanations have been given for this phenomenon. Paradoxical growth can be interpreted in two different ways: 1) Paradoxical growth is due to activation of adaptive pathways in response to high, but not low CAS concentrations, or 2) Caspofungin inactivates at high concentrations, allowing the growth of the cells. Our work has confirmed that in conditions of paradoxical growth, the antifungal is not inactivated, and suggests that this process is a consequence of an induction of an adaptive response that yields adaptation to the antifungal. The adaptation is a transient process that occurs only in the presence of the antifungal and when the drug is removed, the cells lose their ability to grow in the presence of CAS. Our results are in agreement with published data (8), that demonstrate that cells that survived at high caspofungin concentration behaved as control cells after antifungal removal. Human serum prevents paradoxical growth (data not shown, and (17)), which can be explained by the high degree of CAS binding to serum proteins. Paradoxical growth to CAS is a relevant phenomenon in C. albicans since it is present in a high proportion of clinical isolates (around 30-40%). In addition, the phenomenon was highly reproducible, although we also found some strains in which this paradoxical growth was experiment dependent. We argue that adaptation to CAS depends on the activation of signaling pathways that induce cell wall salvage mechanisms. The activation threshold for these pathways (i.e., decreased -glucan levels on the cell wall) might vary between strains. So depending on the genetic background, CAS would induce always the salvage 26

27 mechanism in some strains, but in others, it would be variable depending on whether the activation threshold is reached Morphological changes of different Candida species during paradoxical growth with caspofungin have been described. The average perimeter of cells obtained after incubation with 16 mg/l of CAS is significantly higher than control cells (15). In our conditions, we found this response at both high and intermediate CAS concentrations. Since the cells cannot adapt and grow at these last concentrations, this finding suggests that an increase in cell size is not sufficient for cellular adaptation to CAS. This is also in agreement with our time-lapse studies, where we found that many cells with increased size did not survive and finally exploded. Increase of cell size during caspofungin exposure could be a consequence of the inhibition of -1,3-glucan synthesis, that could alter cell shape, mechanical rigidity and resistance to osmotic pressure (15). So far, it is not known if cell enlargement is required for antifungal adaptation or is a consequence of other cellular changes, such as cell wall rearrangements. Adaptation to CAS not only involved cell enlargement, but also budding defects and formation of clumps (15). Interestingly, although the cells remained physically attached, it did affect their individual integrity. So when one cell exploded by action of the caspofungin the adjacent cell continuous alive. During cell division septum is formed by the neck between the mother and the daughter cell. The septum is made in three different stages, and at the latest stage it has a similar composition that the remainder cell wall. Finally, the septum is partially hydrolyzed by a chitinase and cells are separated (41). As a physical barrier, cell wall composition of the secondary septa would explain the 27

28 survival of cells when the adjacent exploited as we could observed in our experiments Chitin up regulation has been described as the main adaptation mechanism involved in paradoxical effect (15, 17, 19, 21, 23). We have confirmed that high CAS concentrations induce chitin accumulation in the cell wall. But our data suggests that chitin accumulation is necessary, but not sufficient for CAS adaptation, since we also found a significant proportion of cells that had high chitin levels but were dead. So paradoxical growth is a consequence of a complex adaptation process where chitin accumulation and other cell wall rearrangements are necessary to overcome the effect of caspofungin. In this context, we observed that after high CAS treatment, the cells had unmasked -1,3-glucans over the cell wall. This is in agreement with previous findings which described that high CAS concentrations reduce (but not remove) -1,3-glucan (15). We hypothesized that chitin accumulation and cell wall rearrangements result in decreased permeability and lower influx of the drug, so the target enzyme would be able to synthesize - 1,3-glucan. However, the presence of this polysaccharide does not restore a wild type phenotype, since it is detected by the mab, in contrast to the situation in regular cells, where -1,3-glucan is not accessible to Ab binding. This result could be explained by a change in the location of the -1,3-glucan or by an increase permeability of the outer layers of the cell wall that allows the penetration of the Ab. In this sense, impermeable molecules as the dectin-1-receptor or anti- -glucan antibody bind to echinocandins treated cells so these molecules unmask -1,3- glucan on the cell wall (7, 25, 42, 43). 28

29 Cells grown in high CAS concentrations have defects in virulence in the host model Galleria mellonella, which can be explained by different mechanisms. First, these cells are unable to form hyphae, which are involved in adhesion, evasion and escape from phagocytic cells (44). In addition, cells grown at high CAS concentrations could have different immunomodulatory properties, since caspofungin could unmask the remaining -1,3-glucan and influence its recognition by the host (42, 43, 45). In agreement, macrophage interactions experiments revealed a strong pro-inflammatory response of this cells probably induced by the unmasked -1,3-glucan. Moreover, the fact that these cells have elevated chitin levels could influence its interaction with the host, since this polysaccharide is also involved in immune recognition (46). In addition, chitin increase had been related to decrease of virulence in murine model (21). In this work, yeast cells with high chitin levels had reduced virulence compared to cells with regular chitin content. Interestingly, CAS treatment of mice infected with cells with high chitin content did not have any effect on short term survival and did not reduce the number of CFUs in the kidney. Moreover, these authors demonstrated that accumulation of chitin resulted in increased probability of acquisition of mutations in the FKS genes that confer resistance to the antifungal, which highlights the clinical consequences of CAS adaptation in vivo. Furthermore, the size of the infective particles may also influence the virulence of these insects. Galleria mellonella lacks an adaptive response but has a welldeveloped innate response. Foreign particles that pass the external barrier of the larva are recognized by hemocytes (granular cells and plasmocytes). At this stage, 29

30 the outcome of the cellular immune response depends on the size of the targets. Small targets are phagocytized, while large targets are encapsulated and attacked by hemocytes (47). Candida albicans cells grown at high CAS concentrations are immediately recognized by hemocytes and encapsulated. Furthermore, these yeast cells are also surrounded by melanin. The enlarged size of the infectious particles would play an important role in the host target recognition. The efficient encapsulation and probably the inactivation of the majority of the cells could explain the increase in the survival of these groups of larvae. Although C. albicans cells with paradoxical growth have reduced virulence, histopathology analysis revealed that these cells were partially able to revert to the basal state after infection, since some hyphae were occasionally found in the larvae. This could explain why the reversibility of the phenotype does not result in a virulence phenotype similar to that of control cells. These results confirmed the reversibility of cells exhibiting paradoxical growth that we had observed previously in in vitro experiments. The significance of the reduced virulence of cells exhibiting paradoxical growth remains to be elucidated, but we think that this finding provides insights into some clinical aspects. First, this finding could explain the failed attempts to reproduce the paradoxical effect in vivo because it could be confused with success in the treatment (7, 9, 48). This finding may also have a special interest in virulence factors as biofilm formation. Candida species can form biofilms in abiotic and biotic surface (49, 50). Interesting Candida cells in biofilms exposed to high caspofungin concentrations exhibit paradoxical growth (50). In this regard, the use of high CAS concentrations in antimicrobial lock therapy should be taking into account (51-53). Paradoxical growth could also increase the probability of the 30

31 appearance of mutations in the FKS genes, as it has been shown in cells with high chitin levels (21), which results in stable resistance and treatment failure. For these reasons, we believe that the presence of paradoxical growth is an issue of concern that could have profound consequences in the outcome of the treatment of infected patients. In summary, we have demonstrated that paradoxical growth to caspofungin is a true adaptation mechanism not explained by antifungal degradation. This growth was associated with multiple cellular changes and cell wall rearrangements. As some cells with high chitin levels were not able to survive at high CAS concentrations, alternative adaptation mechanism should be considered. The diminution of virulence and the capacity of cells exhibiting PG to reverse to the basal shape in G. mellonella host is a relevant finding that could have clinical consequences. It is unlikely that paradoxical growth plays a role during clinical treatment of the patients. First, the caspofungin concentrations required to induce the adaptive response are unlikely to be reached in vivo. Some clinical studies have demonstrated that high caspofungin doses can be tolerated (54, 55), although these studies have not provided any evidence of in vivo paradoxical effect. Moreover, the fact that this adaptation is associated with reduced virulence suggests that these cells do not contribute to the development of an invasive disease. However, there are other conditions in which adaptation to CAS should be considered, such as in biofilms in catheters, where the antifungal concentration is higher than in physiological fluids. Although the role of paradoxical growth in vivo is 31

32 still unclear, the possibility that cells that have survived the CAS treatment and that retain the ability to revert to the basal state warrants future studies Acknowledgements: We thank Dr. Jesus Pla and Elvira Roman for the gift of some reagents. Oscar Zaragoza is funded by the Spanish Ministry for Economics and Competitivity (SAF ). Cristina Rueda has a Sara Borrell contract from the Fondo de Investigaciones Sanitarias (Reference: CD11/00110). Competing interest. The authors have the following interests: In the past 5 years, M.C.E. has received grant support from Astellas Pharma, biomerieux, Gilead Sciences, Merck Sharp and Dohme, Pfizer, Schering Plough and Soria Melguizo SA. He has been an advisor/consultant to Gilead Sciences, Merck Sharp and Dohme, Pfizer, and Schering Plough. He has been paid for talks on behalf of Gilead Sciences, Merck Sharp and Dohme, Pfizer, and Schering Plough. There are no patents, products in development or marketed products to declare REFERENCES 1. Bouza E, Munoz P Epidemiology of candidemia in intensive care units. Int.J.Antimicrob.Agents 32 Suppl 2:S87-S Holt SL, Drew RH Echinocandins: addressing outstanding questions surrounding treatment of invasive fungal infections. Am.J.Health Syst.Pharm. 68: Denning DW Echinocandin antifungal drugs. Lancet 362:

33 Kurtz MB, Douglas CM Lipopeptide inhibitors of fungal glucan synthase. J.Med.Vet.Mycol. 35: Garcia-Effron G, Katiyar SK, Park S, Edlind TD, Perlin DS A naturally occurring proline-to-alanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis accounts for reduced echinocandin susceptibility. Antimicrob.Agents Chemother. 52: Perlin DS Resistance to echinocandin-class antifungal drugs. Drug Resist.Updat. 10: Walker LA, Gow NA, Munro CA Fungal echinocandin resistance. Fungal.Genet.Biol. 47: Stevens DA, Espiritu M, Parmar R Paradoxical effect of caspofungin: reduced activity against Candida albicans at high drug concentrations. Antimicrob.Agents Chemother. 48: Bayegan S, Majoros L, Kardos G, Kemeny-Beke A, Miszti C, Kovacs R, Gesztelyi R In vivo studies with a Candida tropicalis isolate exhibiting paradoxical growth in vitro in the presence of high concentration of caspofungin. J.Microbiol. 48: Chamilos G, Lewis RE, Albert N, Kontoyiannis DP Paradoxical effect of Echinocandins across Candida species in vitro: evidence for echinocandin-specific and Candida species-related differences. Antimicrob.Agents Chemother. 51: Fleischhacker M, Radecke C, Schulz B, Ruhnke M Paradoxical growth effects of the echinocandins caspofungin and micafungin, but not of 33

34 anidulafungin, on clinical isolates of Candida albicans and C. dubliniensis. Eur.J.Clin.Microbiol.Infect.Dis. 27: Marine M, Pastor FJ, Sahand IH, Ponton J, Quindos G, Guarro J Paradoxical growth of Candida dubliniensis does not preclude in vivo response to echinocandin therapy. Antimicrob.Agents Chemother. 53: Stevens DA, White TC, Perlin DS, Selitrennikoff CP Studies of the paradoxical effect of caspofungin at high drug concentrations. Diagn.Microbiol.Infect.Dis. 51: Wiederhold NP, Kontoyiannis DP, Prince RA, Lewis RE Attenuation of the activity of caspofungin at high concentrations against Candida albicans: possible role of cell wall integrity and calcineurin pathways. Antimicrob.Agents Chemother. 49: Bizerra FC, Melo AS, Katchburian E, Freymuller E, Straus AH, Takahashi HK, Colombo AL Changes in cell wall synthesis and ultrastructure during paradoxical growth effect of caspofungin on four different Candida species. Antimicrob.Agents Chemother. 55: Khlif M, Bogreau H, Michel-Nguyen A, Ayadi A, Ranque S Trailing or paradoxical growth of Candida albicans when exposed to caspofungin is not associated with microsatellite genotypes. Antimicrob.Agents Chemother. 54: Shields RK, Nguyen MH, Du C, Press E, Cheng S, Clancy CJ Paradoxical effect of caspofungin against Candida bloodstream isolates is 34

35 mediated by multiple pathways but eliminated in human serum. Antimicrob.Agents Chemother. 55: Soczo G, Kardos G, Varga I, Kelentey B, Gesztelyi R, Majoros L In vitro study of Candida tropicalis isolates exhibiting paradoxical growth in the presence of high concentrations of caspofungin. Antimicrob.Agents Chemother. 51: Stevens DA, Ichinomiya M, Koshi Y, Horiuchi H Escape of Candida from caspofungin inhibition at concentrations above the MIC (paradoxical effect) accomplished by increased cell wall chitin; evidence for beta-1,6-glucan synthesis inhibition by caspofungin. Antimicrob.Agents Chemother. 50: Munro CA, Selvaggini S, de BI, Walker L, Lenardon MD, Gerssen B, Milne S, Brown AJ, Gow NA The PKC, HOG and Ca2+ signalling pathways co-ordinately regulate chitin synthesis in Candida albicans. Mol.Microbiol. 63: Lee KK, Maccallum DM, Jacobsen MD, Walker LA, Odds FC, Gow NA, Munro CA Elevated cell wall chitin in Candida albicans confers echinocandin resistance in vivo. Antimicrob.Agents Chemother. 56: Walker LA, Gow NA, Munro CA Elevated chitin content reduces the susceptibility of Candida species to caspofungin. Antimicrob.Agents Chemother. 57: Walker LA, Munro CA, de BI, Lenardon MD, McKinnon A, Gow NA Stimulation of chitin synthesis rescues Candida albicans from echinocandins. PLoS.Pathog. 4:e

36 White TJ, Bruns TD, Lee SB Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p In Innis MA, Gelfald DH, Sninsky JJ, White TJ (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA. 25. Arendrup MC, Cuenca-Estrella M, Lass-Florl C, Hope W EUCAST technical note on the EUCAST definitive document EDef 7.2: method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for yeasts EDef 7.2 (EUCAST-AFST). Clin.Microbiol.Infect. 18:E246-E Rodriguez-Tudela JL, Arendrup MC, Barchiesi F, Bille J, Chryssanthou E, Cuenca-Estrella M, Dannaoui E, Denning DW, Donnelly JP, Dromer F, Fegeler W, Lass-Florl C, Moore C, Richardson M, Sandven P, Veledraki A, Verweij.P EUCAST definitive document EDef 7.1: method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts. Clin.Microbiol.Infect. 14: Rodriguez-Tudela JL, Donnelly JP, Arendrup MC, Arikan S, Barchiesi F, Bille J, Chryssanthou E, Cuenca-Estrella M, Dannaoui E, Denning DW, Fegeler W, Gaustad P, Klimko N, Lass-Florl C, Moore C, Richardson M, Schmalrek A, Stenderup J, Veledraki A, Verweij.P EUCAST technical note on fluconazole. Clin.Microbiol.Infect. 14: Barchiesi F, Spreghini E, Tomassetti S, Arzeni D, Giannini D, Scalise G Comparison of the fungicidal activities of caspofungin and amphotericin B against Candida glabrata. Antimicrob.Agents Chemother. 49:

37 Clancy CJ, Huang H, Cheng S, Derendorf H, Nguyen MH Characterizing the effects of caspofungin on Candida albicans, Candida parapsilosis, and Candida glabrata isolates by simultaneous time-kill and postantifungal-effect experiments. Antimicrob.Agents Chemother. 50: Klepser ME, Ernst EJ, Lewis RE, Ernst ME, Pfaller MA Influence of test conditions on antifungal time-kill curve results: proposal for standardized methods. Antimicrob.Agents Chemother. 42: Tang CM, Cohen J, Holden DW An Aspergillus fumigatus alkaline protease mutant constructed by gene disruption is deficient in extracellular elastase activity. Mol.Microbiol. 6: Rodrigues ML, Alvarez M, Fonseca FL, Casadevall A Binding of the wheat germ lectin to Cryptococcus neoformans suggests an association of chitinlike structures with yeast budding and capsular glucuronoxylomannan. Eukaryot.Cell 7: Meikle PJ, Hoogenraad NJ, Bonig I, Clarke AE, Stone BA A (1-- >3,1-->4)-beta-glucan-specific monoclonal antibody and its use in the quantitation and immunocytochemical location of (1-->3,1-->4)-betaglucans. Plant J. 5: Zaragoza O, Chrisman CJ, Castelli MV, Frases S, Cuenca-Estrella M, Rodriguez-Tudela JL, Casadevall A Capsule enlargement in Cryptococcus neoformans confers resistance to oxidative stress suggesting a mechanism for intracellular survival. Cell Microbiol. 10:

38 Cotter G, Doyle S, Kavanagh K Development of an insect model for the in vivo pathogenicity testing of yeasts. FEMS Immunol.Med.Microbiol. 27: Fuchs BB, O'Brien E, Khoury JB, Mylonakis E Methods for using Galleria mellonella as a model host to study fungal pathogenesis. Virulence. 1: Bidla G, Hauling T, Dushay MS, Theopold U Activation of insect phenoloxidase after injury: endogenous versus foreign elicitors. J.Innate.Immun. 1: Desalermos A, Fuchs BB, Mylonakis E Selecting an invertebrate model host for the study of fungal pathogenesis. PLoS.Pathog. 8:e Fuchs BB, Mylonakis E Using non-mammalian hosts to study fungal virulence and host defense. Curr.Opin.Microbiol. 9: Mesa-Arango AC, Forastiero A, Bernal-Martinez L, Cuenca-Estrella M, Mellado E, Zaragoza O The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast. Med.Mycol. 41. Cabib E, Roh DH, Schmidt M, Crotti LB, Varma A The yeast cell wall and septum as paradigms of cell growth and morphogenesis. J.Biol.Chem. 276: Wheeler RT, Fink GR A drug-sensitive genetic network masks fungi from the immune system. PLoS.Pathog. 2:e35. 38

39 Wheeler RT, Kombe D, Agarwala SD, Fink GR Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment. PLoS.Pathog. 4:e Berman J Morphogenesis and cell cycle progression in Candida albicans. Curr.Opin.Microbiol. 9: Lionakis MS, Netea MG Candida and host determinants of susceptibility to invasive candidiasis. PLoS.Pathog. 9:e Lenardon MD, Munro CA, Gow NA Chitin synthesis and fungal pathogenesis. Curr.Opin.Microbiol. 13: Lavine MD, Strand MR Insect hemocytes and their role in immunity. Insect Biochem.Mol.Biol. 32: Clemons KV, Espiritu M, Parmar R, Stevens DA Assessment of the paradoxical effect of caspofungin in therapy of candidiasis. Antimicrob.Agents Chemother. 50: Ferreira JA, Carr JH, Starling CE, de Resende MA, Donlan RM Biofilm formation and effect of caspofungin on biofilm structure of Candida species bloodstream isolates. Antimicrob.Agents Chemother. 53: Melo AS, Colombo AL, Arthington-Skaggs BA Paradoxical growth effect of caspofungin observed on biofilms and planktonic cells of five different Candida species. Antimicrob.Agents Chemother. 51: Carratala J The antibiotic-lock technique for therapy of 'highly needed' infected catheters. Clin.Microbiol.Infect. 8:

40 Cateau E, Rodier MH, Imbert C In vitro efficacies of caspofungin or micafungin catheter lock solutions on Candida albicans biofilm growth. J.Antimicrob.Chemother. 62: Cocuaud C, Rodier MH, Daniault G, Imbert C Anti-metabolic activity of caspofungin against Candida albicans and Candida parapsilosis biofilms. J.Antimicrob.Chemother. 56: Betts RF, Nucci M, Talwar D, Gareca M, Queiroz-Telles F, Bedimo RJ, Herbrecht R, Ruiz-Palacios G, Young JA, Baddley JW, Strohmaier KM, Tucker KA, Taylor AF, Kartsonis NA A Multicenter, double-blind trial of a high-dose caspofungin treatment regimen versus a standard caspofungin treatment regimen for adult patients with invasive candidiasis. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 48: Cornely OA, Vehreschild JJ, Vehreschild MJ, Wurthwein G, Arenz D, Schwartz S, Heussel CP, Silling G, Mahne M, Franklin J, Harnischmacher U, Wilkens A, Farowski F, Karthaus M, Lehrnbecher T, Ullmann AJ, Hallek M, Groll AH Phase II dose escalation study of caspofungin for invasive Aspergillosis. Antimicrobial agents and chemotherapy 55:

41 845 FIGURE LEGENDS Figure 1. Characterization of paradoxical growth to caspofungin in C. albicans (A-C) Stability of caspofungin during paradoxical growth of C. albicans. Optical densities at 530 nm obtained after treatment with different CAS concentrations: A, Control susceptibility test of CAS against C. albicans CL8102 (120h); B, optical densities obtained after 24 h incubation of C. krusei ATCC 6258 with medium recovered from microdilution plate wells of figure 1A; C, Control susceptibility test of CAS against C. krusei ATCC 6258 (24h). (D) Reversibility of paradoxical growth. Antifungal susceptibility testing to caspofungin was performed as described in M&M, and after 120 h, cells were recovered from the wells containing the highest CAS concentrations. These cells were passaged several times through Sabouraud agar plates. Susceptibility testing was performed again and results are represented as follows: control cells, ( ); colonies isolated from caspofungin 0.03 mg/l wells, ( ); colonies isolated from caspofungin 0.25 mg/l wells, ( ); colonies isolated from caspofungin 0.5 mg/l wells, ( ); colonies isolated from caspofungin 8 mg/l wells, ( ). Figure 2. Cellular changes during paradoxical growth (A) Distribution of cellular volumes after incubation with different CAS concentrations. Cells from C. albicans CL8102 strain were incubated in AFST plates as described in M&M. After 120 hours, the cells were recovered from the wells, and the volumes were estimated as described in M&M. The graph shows the volume distribution according to each CAS concentration. n.r.c., not recovered enough cells for the study. (B-K) 41

42 Characterization of growth kinetics in the presence of different CAS concentrations. B, growth curves of C. albicans CL8102 strain with different caspofungin concentrations in RPMI medium at 35 o C for 72 hours. (C-K) Time-lapse recording analysis with different caspofungin concentrations: untreated cells (images C to E); cells incubated with 2 mg/l of caspofungin (images F to H) and cells incubated in presence of 8 mg/l of caspofungin (images I to K). Black arrows indicate the bud emergence and white arrows indicate the increasing size of a mother cell treated with high caspofungin concentrations. Figure 3. Cell wall chitin content in C. albicans CL-8102 strain during paradoxical growth. Images represent cells stained with 10 mg/l of Calcofluor White after treatment 96 h with different caspofungin concentrations: A and B, control of growth cells; C and D, caspofungin 0.06 mg/l; E and F, caspofungin 0.25 mg/l; G and H, caspofungin 1 mg/l; I and J, caspofungin 4 mg/l. Quantification of the cell wall chitin is shown in the graph bellow the images (K) and results have been expressed by CFW intensity measured with the Image J program. Statistical differences are shown compared to growth control cells (gc) (*P<0.0001). The scale bar represents 20 µm. Figure 4. Correlation between chitin accumulation and -1,3-glucan exposure with cell survival in C. albicans CL-8102 strain (A-F) Viability of cells with high chitin content. Cells treated with 8 mg/l of caspofungin and untreated cells were stained with different chitin stain to visualized chitin distribution over the cell wall as follows: DIC images (A, treated cells and D untreated cells) and corresponding WGA images (B, treated cells and E, untreated cells) and CFW images (C, treated 42

43 cells and F, untreated cells). Death cell were observed with the mortality stain Sytox Green (see white arrows on images B and C). To visualize chitin in untreated cells, images were taken increasing exposure time as follows: untreated cells, 2 seconds (s) for WGA and 45.9 milliseconds (ms) for CFW and in case of CAS treated cells, 150 ms for WGA and 6.85 ms for CFW. (G-N) Unmasked β-1,3- Glucans in cells treated with high caspofungin concentration. Immunofluorescence with specific Abs to β-1,3-glucans was performed in C. albicans cells with different treatments: G and K, control cells; H and L, heat treated cells; I and M, cells grown with 8 mg/l of caspofungin; J and N, cells grown with 8 mg/l of caspofungin and heat-treated. The scale bar represents 20 µm. Figure 5. Virulence of C. albicans cells pre-grown with high caspofungin concentrations. Cells exhibiting paradoxical growth were obtained from C. albicans CL8102 strain after growing in Sabouraud liquid supplemented with CAS 8 mg/l at 30ºC and shaking for 48 h. Based on metabolic activity survival curves of larva infected with paradoxical cells (pxc) and control of growth cells (cg) were compare as follows: A, 1.5x10 6 pxc per larvae ( ) and 10 6 cg per larvae ( ) (P<0.0001) and B, 7.5x10 5 pxc per larvae ( ) and 5x10 5 cg per larvae ( ) (P=0.0197). C, Measurement of melanization by optical density (405 nm) after 30 minutes of infection revealed significant differences (p<0.0001) between cells grown in CAS and control cells Figure 6. Tissue sections of Galleria mellonella larva infected with paradoxical cells and untreated cells. Larvae were infected with C. albicans CL8102 exhibiting paradoxical growth after incubation with CAS 8 mg/l for 48h 43

44 and as a control untreated cells were used to infect larvae. The panels show PAS staining tissue sections. A and E images show tissue sections of larvae infected with 10 6 control cells; B and F images show tissue sections of larva infected with 5x10 5 control cells; C and G images show tissue sections of larvae infected with 1.5x10 6 paradoxical cells; D and H images, show tissue sections of larvae infected with 7.5x10 5 paradoxical cells. The scale bar represents 20 µm. Figure 7. Macrophage response to cells grown in the presence of caspofungin. Cells of C. albicans CL-8102 pre-grown with high caspofungin concentrations exhibit a stronger pro-inflammatory response compare to untreated cells. After infection of primary macrophages, concentration of the following cytokines was determined: A, TNF-α; B, IL-17; C, IFN-γ; D, IL-12; E, IL-10 and F, IL-6. Asterisks indicate significant statistical differences (p<0.05) between control cells and PG cells. Cytokine concentration below the detection limit is named by the acronym b.d.l. 44

45 929 TABLES Table 1. Effect of preincubation of microdilution susceptibility plates at 35ºC before inoculation with different Candida spp. Caspofungin microdilution plates were preincubated at 35 o C for 120 hours and then they were inoculated with C. krusei ATCC 628, C. parapsilosis ATCC and C. albicans CL These strains were inoculated in parallel in control plates (fresh medium) maintained at - 20 o C. The table represents the MIC values of these strains in control plates (MIC range) and the MICs in plates preincubated at 35 o C in two independent experiments. MICs values in Control Ranges for C. krusei and C. parapsilosis was obtained from multiple AFSTs performed with ATCC strains as controls for clinical diagnosis in our laboratory. For C.albicans CL8102, the control range was estimated from more than 50 AFST performed during this work.. Candida spp. Caspofungin MICs (mg/l) Control Ranges Pre-incubation 120h 35ºC C krusei ATCC C parapsilosis ATCC C albicans CL

46

47

48

49

50

51