Chapter 14 From Gene to Protein

Transcription

1 Chapter 14 From Gene to Protein Metabolim Teache U About Gene Metabolic defect tudying metabolic dieae uggeted that gene pecified protein alkaptonuria (black urine from alkapton a.k.a. homogentiic acid ) PKU (phenylketonuria) each dieae i caued by non-functional enzyme A B C D E 1 Gene 1 Enzyme Hypothei Beadle & Tatum Compared mutant of bread mold, Neuropora fungu created mutation by X-ray treatment X-ray break inactivate a gene wild type grow on minimal media ugar + required precuror nutrient to yntheize eential amino acid mutant require added amino acid each type of mutant lack a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene Beadle & Tatum Neuropora Experiment So What i a Gene? One gene one enzyme all protein are coded by gene but not all protein are enzyme One gene one protein each protein ha it own gene but many protein are compoed of everal polypeptide One gene one polypeptide but many gene only code for One gene one product but many gene code for more than one product

2 Defining a Gene Defining a gene i problematic becaue one gene can code for everal protein product, ome gene code only for, two gene can overlap, and there are many other complication. gene Elizabeth Pennii, Science 2003 The Central Dogma How do we move information from to protein? trancription tranlation protein gene polypeptide 1 polypeptide 2 polypeptide 3 replication From nucleu to cytoplam Where are the gene? gene are on chromoome in nucleu Where are protein yntheized? protein made in cytoplam by riboome How doe the information get from nucleu to cytoplam? meenger riboe ugar N-bae uracil intead of thymine U : A C : G ingle tranded m, r, t, i. nucleu trancription Trancription Trancribed trand = template trand untrancribed trand = coding trand Synthei of complementary trand trancription bubble Enzyme that facilitate the building of : polymerae Trancription Initiation polymerae bind to promoter equence on Role of promoter 1. Where to tart reading = tarting point 2. Which trand to read = template trand 3. Direction on = alway read 3' 5'

3 Trancription Elongation polymerae unwind ~20 bae pair at a time read 3 5 build 5 3 (the enzyme govern the ynthei!) No proofreading 1 error/10 5 bae many copie hort life not worth it! Trancription Trancription Termination polymerae top at termination equence m leave nucleu through pore Prokaryote v. Eukaryote Genetic Difference between prokaryote & eukaryote time & phyical eparation between procee proceing GC hairpin turn Trancription in Eukaryote only 1 prokaryotic enzyme 3 eukaryotic polymerae enzyme polymerae I only trancribe r gene polymerae I I trancribe gene into m polymerae I I I only trancribe r gene each ha a pecific promoter equence it recognize Eukaryotic Pot-trancriptional Proceing Primary trancript eukaryotic m need work after trancription Protect m from -ae enzyme in cytoplam add 5' G cap add polya tail Edit out intron eukaryotic primary m trancript 5' 5' cap G PPP CH 3 exon = coding (expreed) equence mature m trancript m intron = noncoding (inbetween) equence A pre-m pliced m 3'

4 Primary Trancript Proceing m protecting from RNae in cytoplam add 5 cap add polya tail remove intron Protecting 5 cap added G trinucleoide (G-P-P-P) protect m from RNae (hydrolytic enzyme) 3 poly-a tail added A protect m from RNae (hydrolytic enzyme) help export of from nucleu AUG UGA UTR UTR Dicing & Splicing m Pre-m m edit out intron intervening equence plice together exon expreed equence In higher eukaryote 90% or more of gene can be intron no one know why yet there a Nobel prize waiting Splicing Enzyme nrnp mall nuclear + protein Spliceoome everal nrnp recognize plice ite equence cut & pate a ribozyme ome m can plice itelf a enzyme Ribozyme a enzyme Sidney Altman Thoma Cech ale U of Colorado Splicing Detail No room for mitake! editing & plicing mut be exactly accurate a ingle bae added or lot throw off the reading frame AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Ap Ly Gly Hi AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Val Arg STOP

5 Colonie High AP Biology Alternative Splicing Alternative m produced from ame gene when i an intron not an intron different egment treated a exon Dicovery of Split Gene Richard Robert NE BioLab Philip Sharp MIT adenoviru common cold light chain Structure of Antibodie heavy chain antigen-binding ite light chain variable region light chain How do vertebrate produce million of antibody protein, if they only have a few hundred gene coding for thoe protein? By rearrangement & omatic mutation vertebrate can produce million of B & T cell m antibody rearrangement of V B cell membrane antigen-binding ite heavy chain antigen-binding ite of differentiated B cell C chromoome of undifferentiated B cell C J D B cell The Trancriptional Unit (gene?) enhancer b 20-30b 3' polymerae TATA promoter TAC UTR tranlation tart trancription tart exon trancriptional unit intron tranlation top ACT UTR trancription top 5' 3' pre-m 5' 3' GTP mature m AAAAAAAA 5' Prokaryote v. Eukaryote Genetic Prokaryote in cytoplam circular chromoome naked no intron eukaryotic Eukaryote in nucleu exon = coding (expreed) equence linear chromoome wound on hitone protein intron v. exon intron = noncoding (inbetween) equence

6 From Gene to Protein trancription m leave nucleu through nuclear pore nucleu m cytoplam tranlation protein riboome protein yntheized by riboome uing intruction on m Tranlation in Prokaryote Trancription & tranlation are imultaneou in bacteria i in cytoplam no m editing needed How Doe Code for Protein m TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? protein Met Arg Val An Ala Cy Ala Cracking the Code Nirenberg & Matthaei determined 1 t codon amino acid match UUU coded for phenylalanine created artificial poly(u) m added m to tet tube of riboome, t & amino acid m yntheized ingle amino acid polypeptide chain phe phe phe phe phe phe How can you code for 20 amino acid with only 4 nucleotide bae (A,U,G,C)? Tranlation Codon block of 3 nucleotide decoded into the equence of amino acid m Code for Protein in Triplet m protein TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? Met Arg Val An Ala Cy Ala m code for protein in triplet CODONS!

7 The Code! For ALL life! tronget upport for a common origin for all life Code i redundant everal codon for each amino acid Start codon AUG methionine Stop codon UGA, UAA, UAG m t amino acid How are Codon Matched to Amino Acid? 3' 5' TACGCACATTTACGTACGCGG 5' 3' AUGCGUGUAAAUGCAUGCGCC UAC 3' 5' Met GCA CAU Arg Val codon anti-codon trancription cytoplam tranlation protein t Structure Clover leaf tructure anticodon on clover leaf end amino acid attached on 3' end nucleu Loading t Aminoacyl t ynthetae enzyme which bond amino acid to t endergonic reaction ATP AMP energy tored in t-amino acid bond untable o it can releae amino acid at riboome Riboome Facilitate coupling of t anticodon to m codon organelle or enzyme? Structure riboomal (r) & protein 2 ubunit large mall

8 Riboome P ite (peptidyl-t ite) hold t carrying growing polypeptide chain A ite (aminoacyl-t ite) hold t carrying next amino acid to be added to chain E ite (exit ite) empty t leave riboome from exit ite Building a Polypeptide Initiation bring together m, riboome ubunit, protein & initiator t Elongation Termination Elongation: Growing a Polypeptide Termination: Releae Polypeptide Releae factor releae protein bond to A ite bond water molecule to polypeptide chain Now what happen to the polypeptide? Protein Targeting Signal peptide addre label ex. tart of a ecretory pathway Detination: ecretion nucleu mitochondria chloroplat cell membrane cytoplam Putting it all together