CRISPR 101: Optimizing Your Gene Editing Experiments

Transcription

1 CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager

2 Agenda 1 Technology Overview 2 Experimental Decisions 3 Example Workflow 4 Lucigen and Epicentre Products for Gene Editing

3 Gene Editing Technology Overview

4 What is CRISPR? Clustered Regularly Interspaced Short Palindromic Repeats Bacterial adaptive immunity Type II CRISPR-Cas Cas9 Type V CRISPR-Cas Cpf1 (Cas12a) Jiang F and Doudna JA. Annu. Rev. Biophys. 46: (2017)

5 CRISPR Applications Disease Modeling Industrial Biotechnology Trait Development CRISPR Applications Drug Discovery Pathway Engineering A B C

6 How Does an Engineered CRISPR System Work? Necessary Components Nuclease RNA-Guided Endonuclease (RGEN), like Cas9 and Cpf1 Guide short RNA sequence(s) forms ribonucleotide protein (RNP) complex with RGEN Target DNA sequence complementary to portion of guide RNA contains protospacer adjacent motif (PAM) on non-target strand

7 How Does the Guide RNA Find the Target DNA? Cas9 Configuration Target protospacer complementary sequence 3 PAM site SpCas9: NGG 5 3 non-target strand target strand crrna tracrrna

8 How Can CRISPR Insert, Delete or Inactivate DNA? DNA Repair Mechanisms

9 Experimental Decisions Desired Outcome Nuclease Choice Guide Options Delivery

10 Experimental Decisions Desired Outcome

11 Desired Outcome CRISPR Loss of Function Gain of Function Genome-wide Screen NHEJ HDR NHEJ HDR CRISPRa CRISPRa CRISPRi Base Edit Base Edit CRISPRi

12 Desired Outcome Genome Wide Screen Forward Genetic Screen guide library* lentiviral delivery GeCKO Shalem O., et al. Science 343(6166): (2014) KO via NHEJ (GeCKO) CRISPRa/i *

13 Desired Outcome CRISPRa/i Transcriptional control activation Dead Cas9 Gene interference (repression) single, multiple target(s), genome wide* Repressors dcas9 KRAB Activators VP64 p65 VPR Suntag SAM *

14 Desired Outcome Base-Edit C:G to T:A Multiple versions PAM specificities: SpCas9 SaCas9 LbCpf1 (Cas12a) A:T to G:C Adenine Base Editors (ABEs) Komor A.C., et al. Nature 533(7603): (2016)

15 Experimental Decisions Nuclease Choice

16 Choice of CRISPR Nucleases Loss of Function Gain of Function Genome-Wide Screen Cas9 WT S. pyogenes (NGG PAM) S. aureus (NNGRRT PAM) Cas9 Nickase with two guide RNAs D10A (cuts the target strand) H840A (cuts non-target strand) High fidelity Cas9 SpCas9 HF1 (Kleinstiver et al., Nature 2016) espcas9 (Slaymaker et al., Science 2016) Cpf1 (Cas12a) WT Acidaminococcus Lachnospiracea Knock-out SpCas9 Activation dcas9 fusions Specialized guides Repression dcas9 dcas9 fusions

17 Cas9 Cpf1 vs. NGG PAM TTTV PAM Cas9 Cpf1 Whyyou Care? Guide RNA crrna ~30nts tracrrna ~60nts 40 nt Cpf1 guide RNA is easier to synthesize Location of Cut proximal to PAM, edit may destroy PAM distal from PAM, edit may not destroy PAM re-cutting may increase frequency of HDR because target can be recut Type of Cut blunt DSB staggered DSB staggered DSB might assist the NHEJmediated insertion of donor Off-Targets guide dependent, Cpf1 reported to have fewer Fewer Off-targets is better!

18 wild-type Streptococcus pyogenes Cas9 c-terminal NLS and c-terminal 6xHis tag 10 mg/ml >95% pure by SDS-PAGE Low endotoxin: <10 EU/mg by LAL assay no detectable RNase, endonuclease or exonuclease activity no detectable DNA contamination functionally tested Control Kit also available controls for in vitro and in vivo assays

19 CRISPRcraft S.p. Cas9 Nuclease Control kit Control Kit Does NOT Include Enzyme Materials to confirm enzyme function (in vitro) Positive controls for gene editing (in vivo) Component Use with in vitro Assays Use with in vivo Assays Cas9 Control Human HPRT cr:tracrrna 10X RGEN Buffer Control HPRT Substrate DNA Human HPRT Forward / Reverse PCR Primers Supply own crrna for in vitro guide screening (user-supplied target also required). Use control HPRT cr:tracrrna and PCR primers in vivo for experimental verification.

20 Experimental Decisions Guide Format, Design, and Source

21 Experimental Decisions Guide Format (Cas9 relevance only) ~97 nts crrna ~30 nts tracrrna ~60nts

22 Experimental Decisions Guide Design Mismatches are sometimes tolerated leading to off target editing.

23 Experimental Decisions Guide Design Lots of online resources! Resource On-target score Off-target score Guide design is important! crispr.mit.edu CHOP-CHOP ATUM grna Design Tool CRISPOR e-crisp rgenome Benchling * Provides off-target sequence information combined score* combined score * * * *

24 Experimental Decisions Guide Design General Guidelines Ensure that the crrna sequence is complementary to the target DNA sequence. Guide design is important! The NGG PAM site is located in the non-target strand and is directly 3 to the crrna sequence. The PAM site is not contained within the crrna sequence. AAAGUAUCAGAAAGGAACCC CTCCATTTCATAGTCTTTCCTTGGGTGTGTT GAGGTAAAGTATCAGAAAGGAACCCACACAA..-5 PAM HPRT +Control crrna HPRT Target DNA

25 Experimental Decisions Guide Source Guide Generation Choice Advantages Disadvantages in vitro transcription cheap large quantities time synthesis least hands-on time high purity standards most expensive option cloned cheapest option DNA delivery method time

26 AmpliScribe T7-FLASH Transcription Kit Quick, High-Yield RNA Synthesis Fast: maximal RNA yields in 30 minutes High Yields: >1nmole short transcripts from only 1 μg of template DNA in 30 minutes Flexible: templates with T7 promoters including linearized vectors, PCR products, cdna, and dsdna oligos Scalable: Reactions can be scaled to quickly produce milligram amounts of RNA. Size of RGEN Guide RNA High Yields of Very Short Transcripts (>26 bases) RNA Transcript Size RNA Yield* (µg) RNA Yield* (pmoles) 26 bases bases bases bases kb kb * Yields from 30 min reaction, 1 μg template. Increasing rxn temp, time, & template amounts will increase yield

27 AmpliScribe T7-FLASH Transcription Kit Efficient, Economical Solution single guide RNA with Ampliscribe T7 promoter crrna tracrrna 38133AS sgrna 1/100 dilution 38129S 38117AS 37865S M 1. Use overlapping oligos 2. Create double stranded oligo with T4 polymerase 3. Produce RNA with Ampliscribe Flash Transcription kit 10% TBE-Urea Source AmpliScribe T7-FLASH Transcription Kit Average cost of sgrna/nmol $1-4 synthesis $

28 Experimental Decisions Repair Template

29 Experimental Decisions Repair Template Things to consider: single stranded double stranded size of homology arms

30 Experimental Decisions Delivery Format and Method

31 Experimental Decisions Delivery Format Delivery Advantages Disadvantages DNA (plasmid delivery) mrna Protein cheapest method standard DNA transfection, or viral transduction good for hard-to-transfect cell lines cheap IVT generation of guide and RGEN standard RNA transfection, or microinjection no integration ( footprint-free ) controlled delivery levels active immediately after delivery fast degradation reduces off-target effects no integration ( footprint-free ) many options for delivery speeds workflows - no cloning lag in expression (>12 hrs) expression not easily regulated CRISPR DNA may randomly integrate higher off-target effects some lag in peak expression more expensive than DNA lower delivery efficiency in hard-totransfect cell lines most expensive option

32 Experimental Decisions Delivery Method Cell Culture DNA, RNA or RNP delivery via lipid-based transfection DNA, RNA, or RNP delivery via electroporation DNA delivery via viral transduction Plants DNA delivery via Agrobacterium DNA or RNP delivery via particle bombardment Embryos DNA, RNA, or RNP via microinjection

33 Gene Editing Workflow Example

34 Gene Editing Workflow Example Example Knock-out: via NHEJ Nuclease: CRISPRcraft S.p. Cas9 Nuclease Guide: single guide format Ampliscribe TM T7-FLASH transcription kit Delivery: RNP Lipid-based transfection method Detection: EMC assay with T7E1

35 Gene Editing Workflow Example QuickExtract TM RNP complex + cells Basic Steps: 1. Deliver RNP to cells, incubate. 2. Harvest and extract gdna. 3. Analyze transfected cell pool for presence of edited cells. 4. Sort or select edited cells (optional). 5. Isolate clonal populations and analyze. isolate clones

36 Gene Editing Workflow Example QuickExtract TM RNP complex + cells Basic Steps: 1. Deliver RNP to cells, incubate. 2. Harvest and Extract gdna. 3. Analyze transfected cell pool for presence of edited cells. 4. Sort or select edited cells (optional). 5. Isolate clonal populations and analyze. isolate clones

37 Gene Editing Workflow Example Optimizations

38 Gene Editing Workflow Example Optimizing RNP Delivery (lipid-based reagents) Critical optimizations: Transfection reagent Transfection reagent volume RNP concentration Nuclease to guide ratio RNP concentration Transfection reagent volume Potential optimizations: Cell number at time of transfection Incubation time following transfection

39 Gene Editing Workflow Example Optimizing Target Site Amplification PCR-based Mutation Detection Assays Endonuclease Mismatch Cleavage (EMC) Assay (T7E1) Next-Gen Sequencing Gel electrophoresis Tracking of Indels by Decomposition (TIDE) Indel Detection by Amplicon Analysis, or IDAA Requires optimized PCR amplification of the target mutation site from genomic DNA Restriction Fragment Length Polymorphism

40 Gene Editing Workflow Example Optimizing Target Site Amplification

41 Gene Editing Workflow Example Optimizing EMC Assay PCR Heteroduplex Incubation with T7E1 Only T7E1 cleavable WT/WT WT/Mutant Mutant/Mutant WT/Mutant Guidelines amplicon size bp single amplicon target site within the amplicon resolvable products Resolve fragments Parent fragment Digest fragments Calculate % gene modification based on relative intensities of fragments

42 Gene Editing Workflow Example Optimizing EMC Assay Over Digestion incubation time too long Too much T7E1 Too little DNA Under Digestion incubation time too short Too little T7E1 Too much DNA Fraction Cleaved [T7E1] kept constant 250ng 175ng 100ng 50% 120 minutes 60 minutes 30 minutes Mass of Duplex edited samples negative controls edited samples negative controls Over Digestion Appropriate DNA:T7E1 ratio and incubation time

43 Gene Editing Workflow Example Optimizing EMC Assay FailSafe TM PCR System Buffers are compatible with T7E1 FailSafe TM PCR System Buffers Phusion Buffer A B C D E F G H I J K L HF P F1 F2

44 Gene Editing Workflow Example QuickExtract TM RNP complex + cells Basic Steps: 1. Deliver RNP to cells, incubate. 2. Harvest and Extract gdna. 3. Analyze transfected cell pool for presence of edited cells. 4. Sort or select edited cells (optional). 5. Isolate clonal populations and analyze. isolate clones

45 Gene Editing Workflow Example Harvesting and Extraction Burst and Amplify Heat at 65 C for 15 minutes and 95 C for 15 minutes

46 Gene Editing Workflow Example Detection by EMC Assay 1. Harvest and Lyse Cells Add QuickExtract TM Solution to cells Heat 65 C 15 mins 95 C 15 mins PCR-ready DNA 2. PCR Check for Clean Target Amplicon 3. Detection T7EI Assay Results

47 Gene Editing Workflow Example High-throughput Experiments Various Guides within HPRT Target Nuclease Titration TransIT-X2 Optimization % gene modification % gene modification guide 1 guide 2 guide 3 guide 4 - Control CRISPRcraft S.p. Cas9 Nuclease (nm) % gene modification Cells Only reagent volume (µl)

48 Lucigen and Epicentre Products for Gene Editing

49 Lucigen and Epicentre Products for Gene Editing RGEN Enzymes and Controls AsCpf1 Nuclease, 10 mg/ml Product Cat No. Custom Quote CRISPRcraft S.p. Cas9 Nuclease (120 µg, 400 µg) , -2 Now Available CRISPRcraft Cas9 Nuclease Control Kit In vitro Transcription Kit for Guide RNA Synthesis AmpliScribe T7-Flash Transcription Kit (25 rxn, 50 rxn) DNAExtraction Kits for PCR-Based Mutation Detection QuickExtract DNA Extraction Solution QuickExtract Plant DNA Extraction Solution ASF3257, ASF3507 QE09050 QEP70750 PCR System for PCR-Based Mutation Detection FailSafe PCR Systems FS99060 Competent Cells for lentiviral guide RNA library generation Endura Electrocompetent Cells , -2

50 Questions? Lucigen Technical Support Lucigen Tech Support (608) am 5 pm CDT Product Manager Beth Frey Product Manager bfrey@lucigen.com Thank You for Listening In Today!