Emergence and persistence of integron structures harbouring VIM genes in the Children s Memorial Health Institute, Warsaw, Poland,

Transcription

1 Journal of Antimicrobial Chemotherapy (2009) 63, doi: /jac/dkn512 Advance Access publication 18 December 2008 Emergence and persistence of integron structures harbouring VIM genes in the Children s Memorial Health Institute, Warsaw, Poland, Jan A. Patzer 1, Timothy R. Walsh 2, Janis Weeks 2, Danuta Dzierżanowska 1 and Mark A. Toleman 2 * 1 Department of Clinical Microbiology and Immunology, The Children s Memorial Health Institute, Warsaw, Poland; 2 Department of Medical Microbiology, University of Cardiff, Cardiff CF14 4XN, UK Introduction Received 18 August 2008; returned 3 October 2008; revised 24 November 2008; accepted 24 November 2008 Objectives: The aim was to perform a genetically detailed study of the emergence of metallob-lactamase (MBL) genes in Pseudomonas spp. in the Children s Memorial Health Institute over a 9 year period. Methods: Carbapenem-resistant Pseudomonas spp. isolates were collected from 1998 to 2006 and screened for MBL production. MBL-positive isolates were further investigated by a combination of genetic techniques including PCR, genomic location experiments using pulsed-field gel electrophoresis (PFGE) of I-Ceu1, S1 and SpeI digests, and sequencing. Results: Of the 20 MBL-containing Pseudomonas isolates collected from 1998 to 2006, 16 Pseudomonas aeruginosa isolates contained an identical class 1 integron structure. Two P. aeruginosa isolates contained the bla VIM-2 gene, and two Pseudomonas putida isolates harboured the bla VIM-4 gene cassette in different integron structures. PFGE analysis indicated that all bla VIM-4 -containing P. aeruginosa isolates were closely related, whereas the P. putida isolates were not. All MBL genes in this study were chromosomally encoded, and all isolates harboured only one class 1 integron. The bla VIM-2 isolates were clonal, and the genetic structure supporting the bla VIM-2 gene was found in an identical chromosomal position. Conclusions: MBL gene emergence in this hospital has paralleled a 6-fold increase in carbapenem usage. We have found an increase in MBL gene diversity, MBL host organisms and MBL genetic support structures in the hospital over the 9 year study period. There is also compelling evidence of the persistence of individual strains in the hospital throughout the study period. This suggests that once MBL genes have emerged in a hospital environment, they are difficult to remove. Keywords: metallo-b-lactamases, class 1 integrons, VIM-2, VIM-4 Among the various b-lactamases, the genetically mobile metallo-b-lactamases (MBLs) are the most versatile, able to hydrolyse all b-lactams except the monobactams. 1 In the last decade, the emergence and dissemination of mobile MBL genes have been extensively documented and are thought to be driven by the regional consumption of extended-spectrum cephalosporins and/or carbapenems. 2 Several families of mobile MBLs have been documented ( including IMP, VIM, SPM, GIM, SIM, AIM and NDM (M. A. Toleman, unpublished results) that vary considerably in amino acid sequence. Bacterial isolates producing the VIM MBL, especially VIM-2, are widespread and found in many countries. 3 All genes encoding IMP, VIM, SIM-1 and GIM-1 enzymes are found as gene cassettes within integron structures, whereas the genes encoding SPM-1, AIM-1 and NDM-1 are found to be associated with ISCR elements. The combination of these gene acquisition systems together with genetic vectors such as plasmids and conjugative transposons has enabled MBL genes to disseminate among Gram-negative pathogens. 4 In Poland, MBLs were initially described in Our previous studies also identified VIM-4-producing Pseudomonas aeruginosa strains recovered from hospitalized children in Warsaw. 6 A further countrywide study of P. aeruginosa isolates in identified 38 isolates with MBL genes, comprising eight different integron structures. 7 Here, we describe a longitudinal study of MBL genes in Pseudomonas species over a... *Corresponding author. Tel: þ ; tolemanma@cardiff.ac.uk # The Author Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please journals.permissions@oxfordjournals.org

2 Patzer et al. P. putida 283/02 bla VIM-4/VIM-4rpt oxa-2 orfd P. putida 229/03 bla VIM-4/VIM-4rpt aadb oxa-2 orf4 orfd P. aeruginosa 414/03 bla VIM-2 P. aeruginosa 89/04 bla VIM-2 9 year period ( ), documenting the emergence of new types of MBL and integron structures, and also the long-term persistence of individual isolates in the Children s Memorial Hospital, Warsaw, Poland. Materials and methods P. aeruginosa 266/03, ,61-06, , P. aeruginosa isolates from previous study (11 isolates ) Bacterial strains and serotyping Eighteen P. aeruginosa and two Pseudomonas putida strains used in this study were recovered from a variety of specimens obtained from patients hospitalized at the Children s Memorial Hospital, Warsaw, during Eleven isolates were previously partially characterized, 6 and nine further isolates were collected from in this study. In addition, isolate , which was the first MBL-containing isolate detected in Poland, 5 was also further characterized. The isolates were identified by standard laboratory methods. P. aeruginosa isolate 303 known to have a plasmidencoded VIM-2 gene (M. A. Toleman, unpublished results) was used as a control of genetic location. Antimicrobial susceptibility testing and detection of MBLs MICs were determined using the agar dilution method on Mueller Hinton II agar (BD Microbiology Systems, Cockeysville, MD, USA), as recommended by the CLSI. 8 Detection of MBLs Phenotypic screening involved Etest MBL strips (AB BIODISK, Solna, Sweden) and hydrolysis experiments with and without preincubation with 20 mm EDTA. PCR screening for integron variable regions, MBL genes and DNA sequencing Primers used to detect the various MBL genes and integron variable regions are as described previously. 9 PCR analysis was carried out using Extensor Taq polymerase (Thermo Fisher Scientific). bla VIM-4/VIM-4rpt bla VIM-4/VIM-4rpt Figure 1. Schematic of class 1 integrons in Polish isolates. Open boxes depict open reading frames with arrows indicating the direction of their transcription. Ellipses represent the attachment site, where gene cassettes are inserted into the class 1 integron. Open circles represent the 59 base elements of each individual gene cassette. Sequencing was determined using Perkin-Elmer Biosystems 377 DNA sequencer. Pulsed-field gel electrophoresis (PFGE) and genomic location experiments PFGE was performed as described previously for SpeI digests. 10 For S1 (Invitrogen, Paisley, UK) and I-Ceu1 (New England Biolabs, Hitchin, UK) digests, plugs were washed once in 1 ml of 0.1 TE for 30 min, followed by two 30 min incubations in 1 ml of S1 or I-Ceu1 buffer. Fresh buffer was then added (0.5 ml), and I-Ceu1 was added at a concentration of 20 U per plug or S1 at 0.3 U per plug. I-Ceu1 digests were performed at 378C overnight (16 h) or 45 min for S1. All gels were run at 6 V/cm with an angle of 1208 and pulses from 5 to 45 s for 20 h at 148C against a Lambda ladder PFG marker (New England Biolabs). In-gel hybridization Pulsed-field gels were photographed and dried on blotting paper (Whatman GB004) for 5 h at 508C. The gel was then re-hydrated, denatured (0.5 M NaOH, 1.5 M NaCl, 30 min) and neutralized (0.5 M Tris HCl, ph 7.5, 1.5 M NaCl, 30 min) before incubation overnight at 658C in pre-hybridization solution and probed with a bla VIM-4 probe. 32 P labelling The probe (1 kb) was prepared by PCR with custom-designed primers VIM162F (GTCTACATGACCGCGTCTGT) and bla VIM-1R (CAAAAGTCCCGCTCCAACGA), using P. aeruginosa DNA as template and labelled with 32 P dctp (Redivue, GE Healthcare, Amersham, UK) using a Prime-it II Random Primer Labelling Kit (Stratagene, Amsterdam, the Netherlands). Gels were hybridized overnight at 658C, washed with 2 SSC/0.1% SDS and then 0.1 SSC/0.1% SDS for 30 min before autoradiography. Accession numbers Sequences determined are listed in the EMBL database under the accession numbers FM179465, FM179466, FM and FM

3 (a) Persistence of VIMs in hospital environment Mb 425 kb 140 kb 97 kb 48.5 kb (b) (c) Mb 425 kb kb Figure 2. PFGE and in-gel hybridization results of (a) I-Ceu1-digested plugs, (b) S1-digested plugs and (c) SpeI-digested plugs of the various Pseudomonas isolates collected from 1998 to Numbers refer to the following isolates: 1, P. putida ; 2, P. aeruginosa ; 3, P. putida ; 4, 38-06; 5, ; 6, 61-06; 7, ; 8, 89-04; 9, (isolates 4 9 are all P. aeruginosa collected from 2002 to 2006); 10, P. aeruginosa (plasmid control isolate); 11, P. aeruginosa (initial Polish MBL isolate); 12, ; 13, ; 14, ; 15, ; 16, ; 17, (isolates are all P. aeruginosa isolates collected from 1998 to 2001); 18, Lambda ladder molecular weight marker. 97 kb 48.5 kb 1 Mb 250 kb 130 kb 80 kb 45 kb 35 kb Results Antimicrobial susceptibility testing The results of antimicrobial susceptibility testing of 1358 P. aeruginosa isolates from 2002 to 2006 showed that resistance varied from 13.5% to 18.4% and from 7.3% to 12.4% for imipenem- and meropenem-resistant strains, respectively. Among 228 isolates of imipenem-resistant P. aeruginosa, seven produced MBL as detected using Etest MBL and hydrolysis assays. Additionally, two imipenem-resistant P. putida strains producing MBL were detected. All isolates were also resistant to aminoglycosides, all b-lactams (except aztreonam), and were susceptible to ciprofloxacin (six of nine). Screening for MBL genes and sequence analysis of class 1 integrons Screening by PCR gave a positive result for the presence of the bla VIM genes. This was further confirmed by sequencing to 271

4 Patzer et al. reveal the specific genes present in each variable region and also their order (Figure 1). The majority of the isolates were found to be bla VIM-4 -positive with the unusual bla VIM-4 repeat sequence of 169 bp and two 59 base elements as recorded previously. 6 However, two isolates ( and 89-04) were bla VIM-2 -positive. Isolates , , , , and had an integron identical to the isolates reported previously in this hospital. 6 PFGE analysis and genomic location experiments PFGE analysis of SpeI- and I-Ceu1-digested plugs of the various isolates revealed that the P. putida isolates were unrelated (Figure 2). In contrast, the analysis of P. aeruginosa SpeI-digested isolates harbouring bla VIM-4 revealed that they were very similar throughout the study. Further, pulsed-field gels of all isolates that were digested with I-Ceu1 and S1 and probed with a bla VIM-4 gene (Figure 2) indicated that all genes were chromosomally encoded. This was as compared with the control bla VIM-2 -harbouring isolate, which is resident on a plasmid of 425 kb (Figure 2). Further probing of SpeI-digested plugs indicated that P. aeruginosa bla VIM-4 genes were all encoded on a chromosomal fragment of 80 kb, whereas P. aeruginosa bla VIM-2 isolates were on fragments of 35 kb (Figure 2), which was identical to the first Polish MBL isolate Interestingly, the bla VIM-4 probe hybridized with differently sized SpeI fragments (130 and 45 kb) in the two P. putida isolates, confirming their lack of close identity. Discussion A 4-fold increase in the use of imipenem and meropenem was noted at this hospital during From 2003 to 2006, the use of carbapenems increased further to a value over six times higher than that in 1993 (J. A. Patzer, unpublished results). This was accompanied with an increase in resistance to imipenem from 4.3% in 1998 to 18.4% in During , 11 MBL-producing P. aeruginosa were isolated from children hospitalized on the surgical wards. 6 In this study, we collected a further nine MBL-positive Pseudomonas spp. Overall, there was a decrease in MBL prevalence from 7.2% of imipenem-resistant P. aeruginosa isolates possessing an MBL in to 3.25% from 2002 to The majority of the P. aeruginosa isolates had identical resistance gene arrays to those previously isolated. However, two harboured the MBL gene bla VIM-2. An identical MBL bla VIM-4 was also found in two unrelated P. putida species. The genomic location of MBL genes is largely unknown, with very few publications indicating whether they are encoded on plasmids or resident on the chromosome. To address this, we developed an in-gel hybridization strategy and combined this with the PFGE of S1- and I-Ceu1-digested plugs. This strategy was successful in determining that all the MBL genes in this hospital were on the chromosome of their hosts. All P. aeruginosa isolates harbouring bla VIM-4 were clearly related, with very similar PFGE SpeI profiles, indicating that the same strains have been present in the hospital for 9 years. This result was also confirmed by their position on an identical 80 kb SpeI chromosomal fragment. The bla VIM-2 -harbouring isolates were clonal, and the bla VIM-2 gene was located on a 35 kb SpeI fragment, an identical position to the same gene found on the first MBL-harbouring isolate found in Poland, which may suggest relatedness. Only one class 1 integron could be detected in each isolate, an arrangement that probably severely limits the spread of the MBL gene cassettes. This may explain the low prevalence of this resistance mechanism during the time span of this study. However, the chromosomal position and the limited number of integrons in the strains are excellent factors for long-term maintenance of the MBL resistance cassettes. It, therefore, appears that these particular isolates are particularly suited for long-term persistence. In summary, this paper documents the first genetically detailed longitudinal study of MBL gene emergence in a single institution and indicates that individual MBL-harbouring strains can persist for extended periods probably due to MBL gene fixation on the chromosome of their host organisms. Funding M. A. T. was funded by the EC through COBRA contract LSHM-CT and internal funding from Cardiff University. J. A. P. was funded by the Children s Memorial Health Institute, Warsaw. Transparency declarations All authors: none to declare. References 1. Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect 2002; 8: Lee K, Lee WG, Uh Y et al. VIM- and IMP-type metallo-blactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis 2003; 9: Walsh TR, Toleman MA, Poirel L et al. Metallo-b-lactamases: the quiet before the storm? Clin Microbiol Rev 2005; 18: Yan JJ, Ko WC, Chuang CL et al. Metallo-b-lactamase-producing Enterobacteriaceae isolates in a university hospital in Taiwan: prevalence of IMP-8 in Enterobacter cloacae and first identification of VIM-2 in Citrobacter freundii. J Antimicrob Chemother 2002; 50: Walsh TR, Toleman MA, Hryniewicz W et al. Evolution of an integron carrying bla VIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program. J Antimicrob Chemother 2003; 52: Patzer J, Toleman MA, Deshpande LM et al. Pseudomonas aeruginosa strains harbouring an unusual bla VIM-4 gene cassette isolated from hospitalized children in Poland ( ). J Antimicrob Chemother 2004; 53: Fiett J, Baraniak A, Mrowka A et al. Molecular epidemiology of acquired-metallo-b-lactamase-producing bacteria in Poland. Antimicrob Agents Chemother 2006; 50:

5 Persistence of VIMs in hospital environment 8. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically. CLSI, Wayne, PA, USA, Toleman MA, Biedenbach D, Bennett D et al. Genetic characterization of a novel metallo-b-lactamase gene, bla IMP-13, harboured by a novel Tn5051-type transposon disseminating carbapenemase genes in Europe: report from the SENTRY worldwide antimicrobial surveillance programme. J Antimicrob Chemother 2003; 52: Patzer JA, Dzierzanowska D. Increase of imipenem resistance among Pseudomonas aeruginosa isolates from a Polish paediatric hospital ( ). Int J Antimicrob Agents 2007; 29: