MICROBIOLOGY ECOLOGY. Monitoring the rumen pectinolytic bacteria Treponema saccharophilum using real-time PCR. Introduction RESEARCH ARTICLE

Transcription

1 MICROBIOLOGY ECOLOGY RESEARCH ARTICLE Monitoring the rumen pectinolytic bacteria saccharophilum using real-time PCR Jing Liu 1, Jia-Kun Wang 1, Wen Zhu 1, Yi-Yi Pu 1, Le-Luo Guan 2 & Jian-Xin Liu 1 1 Institute of Dairy Science, MoE Key Laboratory of Molecular Animal Nutrition, College of Animal Sciences, Zhejiang University, Hangzhou, China; and 2 Department of Agricultural, Food & Nutritional Science, Faculty of Agricultural, Life & Environmental Sciences, University of Alberta, Edmonton, AB, Canada Correspondence: Jian-xin Liu, Institute of Dairy Science, Zhejiang University, 866 Yuhangtang Road, Hangzhou , China. Tel.: ; fax: ; liujx@zju.edu.cn Received 1 June 2013; revised 4 November 2013; accepted 4 November Final version published online 2 December DOI: / Editor: Cindy Nakatsu Keywords pectin; forage; 16S rrna gene; saccharophilum. Introduction Abstract Pectin is a structural but nonfibrous carbohydrate (NFC) present in plant feedstuffs. Pectin and nonstructural carbohydrates are highly digestible and are generally increased in the diet at the expense of neutral detergent fiber to meet the energy demand for lactating dairy cows (NRC, 2001). Alfalfa hay (AH) typically contains 10 15% and up to 20% pectin in the dry matter (Lagowski et al., 1958; Mertens, 2002), whereas grass or corn stover (CS) has pectin contents of < 5% (Waite & Gorrod, 1959; Mullen et al., 2010). Pectin is rapidly degraded in the rumen, yielding acetate and propionate as the primary end products. Therefore, fermentation of pectin does not cause acidosis and other metabolic problems usually occurred with starchy diets (Hatfield & Weimer, 1995). In our previous study, it was observed that dairy cows fed AH as a primary forage source had higher rumen microbial protein yields than those fed CS or Chinese wild rye, and this difference was attributed to the higher NFC content in AH (Zhu et al., 2013). It is speculated saccharophilum is a pectinolytic bacterium isolated from the bovine rumen. The abundance of this bacterium has not been well determined, reflecting the lack of a reliable and accurate detection method. To develop a rapid method for monitoring T. saccharophilum, we performed pyrosequencing of genomic DNA isolated from rumen microbiota to explore the 16S rrna gene sequences of T. saccharophilum candidates. Species-specific primers were designed based on fifteen sequences of partial 16S rrna genes generated through pyrosequencing with 97% or higher similarity with T. saccharophilum DSM2985 along with sequence from type strain. The relative abundance of T. saccharophilum was quantified in both in vitro and in vivo rumen systems with varied pectin-containing forages using real-time PCR. There was a clear association of T. saccharophilum with alfalfa hay, which contains more pectin than Chinese wild rye hay or corn stover. The relative abundance of T. saccharophilum was as high as 0.58% in vivo, comparable with the population density of other common rumen bacteria. It is recognized that T. saccharophilum plays an important role in pectin digestion in the rumen. that pectin, the main NFC component in alfalfa (Martin & Mertens, 2005), might play an important role in microbial protein synthesis. Pectin can be degraded by rumen pectinolytic bacteria, including the most intensively studied species, such as Butyrivibrio fibrisolvens, Prevotella ruminicola, Lachnospira multipara (Gradel & Dehority, 1972), Streptococcus bovis (Ziolecki et al., 1972), and Succinivibrio dextrinosolvens (Bryant & Small, 1956). Some important ruminal cellulose-digesting bacteria, such as Ruminococcus albus and Fibrobacter succinogenes, can also degrade pectin through secreted pectate lyases (Cai et al., 2010). Pectin can also be degraded by a lesser known species, saccharophilum (Paster & Canale-Parola, 1985). Monitoring the population of rumen pectinolytic bacteria could not only facilitate research on the utilization of feed pectin but also improve the understanding of pectin with respect to the rumen micro-ecosystem. Quantitative PCR has been widely used as a rapid and sensitive technique to detect specific microorganisms by targeting DNA using designed specific primer sets and

2 Monitoring rumen pectinolytic bacteria 577 has proven to be a powerful tool for monitoring microbial populations in the complex ruminal ecological environment (Tajima et al., 2001; Klieve et al., 2003; Denman & McSweeney, 2006). Specific primers targeting B. fibrisolvens, P. ruminicola, S. bovis, S. dextrinosolvens, R. albus, and F. succinogenes have been developed in earlier studies (Tajima et al., 2001; Stevenson & Weimer, 2007), but the identification of T. saccharophilum has been reported in only a few studies. Based on the phylogenetic analysis of group-specific 16S rrna gene sequences, Bekele et al. (2011) suggested that T. saccharophilum is an infrequent and minor species in the rumen. As T. saccharophilum has been described as obligate sugar fermenter with remarkable growth supported by pectin (Paster & Canale-Parola, 1985), we hypothesized that the abundance of T. saccharophilum might be highly correlated with a pectin-rich diet, such as AH. Therefore, the aim of this study was to develop a rapid quantitative PCR assay for T. saccharophilum and to examine the possibility of monitoring the T. saccharophilum population in rumen fermentation systems in vitro and in vivo under different dietary conditions. Materials and methods Pectin extraction from forages Pectin from AH, Chinese wild rye hay (CW), and CS was extracted using a chemical method according to Koubala et al. (2008). Briefly, 4 g of each forage dried at 50 C oven for 8 h was treated with 12 ml of 85% ethanol at 70 C for 20 min, followed by filtration through Whatman No. 1 qualitative filter paper (repeated four times). The residues were suspended in 160 ml of 0.25% ammonium oxalate solution (ph 4.6, adjusted with oxalic acid) at 85 C for 1 h. The slurries were filtered through a nylon cloth and squeezed to collect as much liquid as possible. The filtrates were mixed with three volumes of 96% ethanol to precipitate the pectin. Following centrifugation at g for 10 min, the precipitate was washed three times with 100 ml of 70% ethanol and three times with 50 ml of 96% ethanol and finally oven dried at 50 C for 24 h. Ruminal DNA extraction from cows fed different diets Rumen fluid samples were collected from twelve primiparous Chinese Holstein cows ( kg body weight) fed three different diets containing a high proportion of CS, CW, or AH, respectively, according to Zhu et al. (2013). Briefly, all diets were designed with same ratio of forage to concentrate (45 : 55, DM basis) but used different forage sources (%): corn silage 21, CS 19, and AH 5 (dcs); corn silage 19, CW 21, and AH 5 (dcw); and corn silage 19, CW 9, and AH 17 (dah). The cows were fed each diet for 3 weeks, and the rumen fluid was collected on the last day of the experimental period using an oral stomach tube (Shen et al., 2012). C. 200 ml of rumen fluid from each cow was collected before morning feeding to avoid the background influx of bacteria with feed. The samples were stored at 80 C until the DNA was extracted. A total of 2 ml of rumen fluid was used for genomic DNA extraction using the RBB + C method according to Yu & Morrison (2004), and the extracted DNA was quantified using the Qubit dsdna HS Assay Kit (Invitrogen, Eugene, OR) on a Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA). Pyrosequencing exploration of 16S rrna gene sequences Because dcs and dcw had similar pectin contents, only genomic DNA from cows fed dcs (low pectin) and dah (high pectin) was used for PCR amplification and subsequent pyrosequencing to make a cost-effective comparison of the effects of pectin on the target species. The universal bacterial primers 341F and 1073R and the group-specific primers g-trepof and BAC926R (Table 1) were used to amplify the target DNA sequences. The PCRs were performed in a total volume of 50 ll containing 10 ll of 59 GoTaq Reaction Buffer with 1.5 mm MgCl 2, 0.2 mm dntp, 1.25 U GoTaq DNA Polymerase (Promega, Madison, WI), 0.2 lm of each primer and genomic DNA (c. 10 ng). Amplification was performed with an initial denaturation at 94 C for 5 min, followed by 35 cycles of 94 C for 30 s, annealing at the indicated temperature for the primer pair (Table 1) for 30 s and elongation at 72 C for 40 s and a final extension step at 72 C for 5 min. The PCR products were purified using the Wizard â SV Gel and PCR Clean-Up System (Promega) and subsequently quantified on a Qubit 2.0 Fluorometer (Invitrogen). The purified PCR amplicons generated using identical primer sets and treatment conditions were pooled in equimolar amounts for pyrosequencing. Thus, there were 4 groups of samples: BAC_454AHG (Bacteria under dah), BAC_454CSG (Bacteria under dcs), Trep_454AHG ( under dah), and Trep_454CSG ( under dah). To individually identify the samples, a barcode sequence of eight nucleotides unique to each sample was added to the 5 end of the forward primer. The pooled amplicons were subjected to pyrosequencing on a Genome Sequencer FLX Titanium platform (Roche, Nutley, NJ) at Majorbio Bio-Pharm Technology Co., Ltd, Shanghai, China.

3 578 J. Liu et al. Table 1. Primers used in this study Target Primer sequences Annealing temperature ( C) Product size (bp) PCR efficiency (%) Reference Total bacteria TB-F CGGCAACGAGCGCAACCC Denman & McSweeney (2006) TB-R CCATTGTAGCACGTGTGTAGCC Denman & McSweeney (2006) 341F CCTACGGGAGGCAGCAG ND Muyzer et al. (1993) 1073R ACGAGCTGACGACARCCATG On et al. (1998) group bryantii g-trepof GGCAGCAGCTAAGAATATTCC Bekele et al. (2011) BAC926R CCGTCAATTCCTTTGAGTTT Watanabe et al. (2001) T.bry-F AGTCGAGCGGTAAGATTG Tajima et al. (2001) T.bry-R CAAAGCGTTTCTCTCACT Tajima et al. (2001) T. saccharophilum T.s-F GGGACAGGGAATGGTCTCGT * This study T.s-R CCGTCAATTTCTTTGAGTTTCAC This study ND, not detected. *Efficiency values varied between pure plasmid DNA and DNA isolated from rumen fluid spiking with plasmid DNA. The 16S rrna gene sequences obtained from the 454 Titanium pyrosequencing run were sequentially filtered with quality control criteria to remove sequences with sequencing lengths < 150 nt, > 2 mismatches in the forward primer, > 6 homopolymers, or any ambiguous bases. Sequences assigned to the genus using the RDP Classifier (Lan et al., 2012) were further queried using the BLAST program (Altschul et al., 1990) to obtain similarity values. The unique sequences showing 97% or higher similarity with T. saccharophilum DSM2985 (Accession Number NR044745), hereafter referred as candidate sequences, were deposited into the GenBank database under Accession Numbers KF to KF Design and validation of qpcr primers The candidate sequences obtained from pyrosequencing were selected as targets along with the 16S rrna gene from the type strain T. saccharophilum DSM2985. T. bryantii NK4A124, T. bryantii DSM 1788T, and five species ( sp. T, sp. S, sp. CA, zioleckii KT, and succinifaciens DSM 2489) previously reported (Sikorova et al., 2010) to be closely related to T. saccharophilum were considered nontarget species. Specific primer pairs were manually designed and analyzed using OLIGO Primer Analysis Software, version 6.0 (Rychlik & Rhoads, 1989) based on the alignment of target and nontarget species sequences using CLUSTALW (Thompson et al., 1994) with forward and reverse primers targeting positions and in the T. saccharophilum 16S rrna gene sequence, respectively. The specificity of the primers was tested through PCR amplification using genomic DNA isolated from pure cultures of 12 representative rumen bacterial strains, including T. saccharophilum DSM2985, T. bryantii B25, F. succinogenes S85, R. albus 8, R. flavefaciens Y1, P. ruminicola ATCC19189, S. ruminantium HD4, Megasphaera elsdenii B159, Eubacterium ruminantium GA195, S. dextrinosolvens 22B, Succinimonas amylolytica DSM2873, and Ruminobacter amylophilus DSM1361. After validating the specificity of the primers, the PCR products amplified with designed primers from total rumen DNA were cloned and sequenced. Twenty-three positive clones were randomly selected for Sanger sequencing at BGI-Shanghai. The similarities of the obtained sequences to T. saccharophilum were queried using BLAST (Altschul et al., 1990). Unique sequences were deposited in the GenBank database with Accession Numbers KF to KF A phylogenetic tree was constructed to confirm the clone specificity using the neighbor-joining method (Saitou & Nei, 1987) with the Kimura two-parameter model (Kimura, 1980) in MEGA (version 4.0.1; Tamura et al., 2007). The statistical significance of the tree branches was evaluated by bootstrap analysis (Felsenstein, 1985) with 1000 replicates. Estimation of the relative abundance of T. saccharophilum with specific substrates in vitro In vitro fermentation was conducted in 180-mL serum bottles with 90 ml of buffer medium (Theodorou et al., 1994). A total of 30 bottles were used for 10 treatments with three replicates each. The following treatments were used: (1) no substrate added as a blank control, (2) 150 mg pectin (from citrus peel, Fluka Sigma Aldrich, Denmark) as a pectin control, (3) 150 mg corn starch (St) (Aladdin Reagent Company, Shanghai, China) as a starch control, (4) 600 mg AH, (5) 600 mg CW, (6) CW

4 Monitoring rumen pectinolytic bacteria 579 with 150 mg pectin, (7) CW with 150 mg St, (8) 600 mg CS, (9) CS with 150 mg pectin, and (10) CS with 150 mg St. The bottles containing substrates and incubation medium were sealed with butyl rubber stoppers and aluminum caps and then kept at 39 C before use. On the next day following medium preparation, the rumen contents were collected in the morning before feeding and filtered according to Lin et al. (2011). Briefly, representative samples of the total rumen contents (400 g) were manually collected from three rumen-fistulated Hu sheep before morning feeding. All sheep were fed a diet containing CW (1000 g day 1 ), AH (300 g day 1 ), and a concentrate mixture (250 g day 1 ). The composition (% of dry matter) of the concentrate included corn (45%), cotton cake (20%), soybean meal (15%), and wheat bran (15%). The obtained rumen contents were mixed and filtered through four layers of medicinal gauze (1000 lm pore size) into a flask with continuous CO 2 flushing to maintain anaerobic conditions. The flask containing rumen fluid was maintained in a 39 C water bath until further use. Ten milliliters of filtered rumen fluid was injected through the stopper, and the bottles were placed in an incubator at 39 C with shaking. After incubation for 24 h, 2 ml of the fermentation fluid was sampled for DNA extraction using same method as described earlier. Real-time PCR quantification Genomic DNA of R. albus 8 was amplified with the bacterial universal primer set TB-F and TB-R (Table 1), and the plasmid containing this amplicon was used as a standard for the estimation of the total bacterial 16S rrna gene copy number. Similarly, T. saccharophilum DSM2985 genomic DNA was amplified using the newly designed primers, and the cloned product was used as a T. saccharophilum standard. The T. bryantii B25 genomic DNA was amplified using group-specific and T. bryantii-specific primers (Table 1) to construct respective standard. The respective plasmid DNA standard was prepared according to Koike et al. (2007). The copy number of each standard plasmid was calculated based on the DNA concentration and molecular weight of the cloned plasmid. For the standard curve, the plasmid DNA of each respective target was subjected to seven sequential fivefold dilutions. To examine the amplification efficiencies for each primer pair, the fivefold dilution series of the plasmid DNA standard was run along with the samples in triplicate. After plotting the Ct value against the log copy numbers of plasmid DNA from the dilution series, the efficiencies were calculated, and the respective gene copies in the samples were quantified. The relative abundance of the target species was obtained after normalizing the copy number of the 16S rrna gene of target species to that of total bacteria. To verify the accuracy of the developed assay, the amplification efficiencies were compared between the pure plasmid standard of T. saccharophilum and the DNA extracted from the rumen fluid spiked with the same dilution series of plasmid DNA. The comparison was performed on one plate in a single run. Quantitative PCR was performed using a 7500 Real- Time PCR System (Applied Biosystems, Foster City, CA). The assays were set up using the FastStart Universal SYBR Green Master Mix (Roche, Indianapolis, IN). The PCR mixture contained 10 ll of 2X SYBR Green Master Mix, 1 ll of template DNA (10 ng ll 1 ), and 0.3 lm each primer in total volume of 20 ll. The amplification procedure consisted of one cycle of 50 C for 2 min and 95 C for 10 min for initial denaturation, followed by 40 cycles of 95 C for 15 s, and annealing and extension at 60 C for 1 min. Melting curve analysis was performed after amplification to verify the specificity of the real-time PCR. Statistics The statistical analysis of the data was performed by oneway ANOVA, with mean separation using Tukey s studentized range test at a level of significance of 0.05 using the SAS software package (SAS Institute, 2000). Results and discussion Pyrosequencing profile of -like sequences After the barcodes had been trimmed, the average read length of the candidate sequences retrieved from universal and group-specific primers was (mean SD) nucleotides. The numbers of 16S rrna gene sequences identified as genus, T. saccharophilum, and T. bryantii are shown in Table 2. Based on the 97% similarity criterion, a total of 15 T. saccharophilum-like sequences were retrieved in this study (Table 2). Four of the 15 identified sequences were unique sequences, which expanded the available data for T. saccharophilum recognition. Prior to this study, only one 16S rrna gene sequence (accession number HM049827), with 98% similarity to T. saccharophilum, had been deposited in the GenBank database. The lack of T. saccharophilum-like 16S rrna gene sequences in the available databases or published studies has been recognized in recent papers (Sikorova et al., 2010; Bekele et al., 2011). One possible explanation is that the genus was not well discussed due to its relative low

5 580 J. Liu et al. Table 2. Number of sequences identified as members based on 97% similarity obtained from pyrosequencing with different primers and under different fiber source diets Diets dah dcs Target BAC_454 Trep_454 BAC_454 Trep_ saccharophilum bryantii zioleckii KT group Total good quality sequences group was assigned by RDP classifier with default confidence threshold at 80%. dah, TMR containing alfalfa hay as main forage; dcs, TMR containing corn stover as main forage. abundance. A meta-analysis of available data conducted by Sikorova et al. (2010) revealed that the genus represented < 2.4% of total rumen bacteria. Next-generation sequencing platforms, such as 454 pyrosequencing, have been recognized as a more reliable quantitative analysis method than the reproducibilitydubious clone libraries (Acinas et al., 2005). Indeed, next-generation sequencing has been widely used to comprehensively examine the bacterial diversity in ruminal environments (Callaway et al., 2010; Lee et al., 2012; Zened et al., 2013). However, all these studies have focused on the predominating genus in the rumen under particular circumstances. In a previous study on clone library sequencing using group-specific primers (Bekele et al., 2011), none of 313 clones showed 97% similarity with T. saccharophilum. However, with the same primers as used by Bekele et al. (2011) but with different sequencing technology, 5 of 1595 sequences (0.3%) recovered from group-specific amplicons (Trep_454AHG and Trep_454CSG) were assigned to T. saccharophilum in our present study (Table 2). Interestingly, although as a small proportion (90 of sequences) of genus sequences were recovered from universal bacterial amplicons (BAC_454AHG and BAC_454CSG), the number of T. saccharophilum-like sequences (10 out of 90 sequences, 11.1%) was considerably higher than those from Trep_454AHG and Trep_454CSG (Table 2). The discrepancy between the proportions of T. saccharophilum-like sequences found in different primer-associated sequencing sets might reflect PCR (Polz & Cavanaugh, 1998) or cloning (Morgan et al., 2010) biases. The relatively low number of clones sequenced by Bekele et al. (2011) may have led to the exclusion of T. saccharophilum-like sequences. Regardless of the differences in proportion among different primers, both primer sets retrieved more T. saccharophilum-like sequences with a dah diet than with a dcs diet, suggesting that this specific member of might be associated with the digestion of pectin-rich AH. Validation of the specificity and sensitivity of the designed primers Due to low specificity, initial attempts to design T. saccharophilum-specific primers failed. The employment of candidate sequences generated from pyrosequencing facilitated the identification of more specific regions for primer design. When the designed primer pair was tested against 12 pure cultures, amplicons were only observed for the DNA extracted from T. saccharophilum. Eleven of the 23 positive clones sequenced from ruminal amplicons were unique. Phylogenetic analysis of these clones revealed two clusters (Fig. 1): Two clones were closely associated with the type strain, and the remaining clones were closely associated with the candidate sequences. The latter cluster, with no cultivable representatives, suggests the existence of subspecies of T. saccharophilum. The phenomenon of a small cluster represented by the type strain and a large clade dominated by sequences retrieved from culture-independent analysis is consistent with the results of the study of Bekele et al. (2011), who reported that uncultured were more abundant than cultured representatives in the group. The plasmid standard curve of the T. saccharophilum 16S rrna gene was linear from to 213 copies, which correlated with Ct values ranging from 15 to 31, with a slope of (Fig. 2a). The Ct values for the no template controls were generally above 33, and the results in this range were considered negative. Thus, the limit of quantification of the assay is c. 200 copies of the 16S rrna gene per PCR. In the study of Koike et al. (2007), who evaluated the sensitivity of real-time PCR assays for 11 representative rumen bacteria using the serially diluted target 16S rrna gene from respective bacterial species, the corresponded minimum detection limit for each target is in a range from 10 to 100 copies. Similarly, Koike et al. (2010) designed PCR primers targeting 16S rrna genes of uncultured fiber-associated groups U2 and U3 in the rumen, and the lowest detection limit for groups U2 and U3 was found to be 100 copies. Thus, compared with these two studies mentioned earlier, the detection sensitivity in the present study is reasonable and sensitive. The amplification efficiency of the pure plasmid standard was

6 Monitoring rumen pectinolytic bacteria 581 Fig. 1. Phylogenetic analysis of 16S rdna gene sequences generated by saccharophilum primer set from total DNA extracted from rumen content. Eleven sequences of unique clones, eight sequences of known species, one reported clone sequence (HM049827), and 4 unique sequences retrieved from pyrosequencing data are included in the tree. Bootstrap values from 1000 replications are shown at branch points of the tree. The horizontal bars represent nucleotide substitutions per sequence position. (a) Fig. 2. Linearity and detection range of the qpcr using SYBR Green chemistry. (a) Standard curve with amplification efficiency of 99% was generated from plasmid DNA containing partial 16S rrna gene of saccharophilum amplified with T.s-F & R. (b) DNA isolated from rumen fluid (calculated from the above standard curve to contain 548 copies of T. saccharophilum 16S rrna gene) spiked with the same plasmid standard was analyzed, resulting a liner curve with amplification efficiency of 92%. Dots represent the mean values of three analytical replicates, and bars show the standard deviation. (b) similar to that of the spiked ruminal DNA (99% vs. 92%; Fig. 2), indicating that the designed primers specifically amplified the 16S rrna gene of T. saccharophilum, regardless of the presence of nontarget DNA. With either standard plasmids or ruminal genomic DNA as the template, the dissociation curve analysis showed a single

7 582 J. Liu et al. sharp peak with Tm values at 81.5 C (Supporting Information, Fig. S1), satisfying the essential specificity standard for a SYBR Green assay (Denman & McSweeney, 2006). Monitoring the relative abundance of T. saccharophilum under different forages and carbohydrate sources To further determine whether the designed primers can be used to monitor the T. saccharophilum population, we further characterized the abundance of this species under pectin-rich and pectin-poor dietary conditions using in vitro and in vivo rumen systems. The ability of rumenmixed bacterial cultures to ferment pure pectin has been previously reported (Gradel & Dehority, 1972). An early in vitro study also revealed that a considerable proportion of the pectin in alfalfa was digested by mixed cultures (Dehority et al., 1962). Similar to previous results (Waite & Gorrod, 1959; Mertens, 2002; Mullen et al., 2010), the yields of chemical-extracted pectin were 2.8%, 3.7%, and 9.3% for CS, CW, and AH, respectively, indicating a consistently higher pectin content in AH than that in CS or CW when the same extraction conditions are used. Our in vitro fermentation experiment was first conducted to validate the practicability of the designed primers for monitoring the abundance of T. saccharophilum under different pectin contents derived from pure pectin and forages. The population of T. saccharophilum was significantly higher with an AH diet than with CW or CS diets (P < 0.05; Fig. 3). When CW and CS were supplemented with pure pectin, an increase in T. saccharophilum was observed (P < 0.05), suggesting that pectin stimulates the growth of T. saccharophilum. According to Paster & Canale-Parola (1985), who used pure culture, T. saccharophilum grows well on starch ( cell ml 1 yield on 0.2 g 100 ml 1 starch vs cell ml 1 on 0.2 g 100 ml 1 pectin). However, the addition of starch did not introduce a higher population of T. saccharophilum in this study (Fig. 3), in which mixed cultures of rumen fluid were used. Competition is a common interaction among ruminal bacteria (Shi et al., 1997). The different responses of T. saccharophilum to specific carbohydrate substrates observed in pure and mixed culture environments suggest that the ability of T. saccharophilum to compete for pectin might be higher than for starch, but direct evidence is needed to confirm this hypothesis. Furthermore, the relative proportions of the 16S rrna gene copies for T. saccharophilum, T. bryantii, and the genus in the rumen of cows fed different pectin-containing diets were accessed using real-time PCR (Table 3). The relative abundance of T. saccharophilum in the rumen of cows fed the dah diet was higher (P < 0.05) than those in the rumen of cows fed the dcw and dcs diets. This finding is consistent with the results obtained using pyrosequencing techniques, confirming the hypothesis that there is a positive corelationship between T. saccharophilum and AH. The population of the group or T. bryantii was not affected by the diets (P > 0.05), with relative abundances of 2.80% and 0.03% for all diets, respectively, similar to the previous findings (Bekele et al., 2011). Stevenson & Weimer (2007) observed that E. ruminantium, Fig. 3. Relative abundance of saccharophilum 16S rrna gene copies (% of total bacterial 16S rrna gene) among in vitro treatments (AH, CW, CS, Pectin, St). a c Means with different letters differ (P < 0.05). Bars show standard error.

8 Monitoring rumen pectinolytic bacteria 583 Table 3. Relative abundance of target gene copies for specific species (% of total bacterial 16S rrna gene) in the rumen of dairy cows fed on corn stover, Chinese wild rye and alfalfa hay as main forage diet Target saccharophilum bryantii group Diets dah dcs dcw SEM P-value a b b a a a a a a a-b Means within the same row with different superscripts differ (P < 0.05). dah, TMR containing alfalfa hay as main forage; dcs, TMR containing corn stover as main forage; dcw, TMR containing Chinese wild rye grass as main forage. M. elsdenii, Prevotella brevis, R. amylophilus, and S. ruminantium group represented only 0.176%, %, 0.135%, 0.223%, and 0.551% of the total bacteria, respectively, in the rumen of dairy cows. Similarly, Bekele et al. (2010) observed that the relative abundances of R. amylophilus, F. succinogenes, and S. ruminantium were 0.08%, 0.20%, and 0.08% of the total bacteria, respectively, in the rumen of sheep fed a hay diet. Particularly, B. fibrisolvens, S. bovis, and S. dextrinosolvens species, previously recognized as pectinolytic bacteria (Bryant & Small, 1956; Gradel & Dehority, 1972; Ziolecki et al., 1972), have been reported to represent only (Stevenson & Weimer, 2007), 0.020%, and < 0.010% (Bekele et al., 2010) of the total bacteria present in the rumen, respectively. Prevotella ruminicola is widely recognized as one of the most abundant species in the rumen, with a relative abundance ranging from 0.8% to 1.7% (Stevenson & Weimer, 2007; Bekele et al., 2010). However, in an early pure culture-based study, Gradel & Dehority (1972) demonstrated that the ability of the P. ruminicola 23 and D31d strains to degrade and utilize pectin from two mature alfalfa sources was considerably lower than those of B. fibrisolvens, L. multipara, and F. succinogenes. Considering that the quantification methodologies of these two studies were similar to those used in the present study (calculation of the abundances of each target as the fraction out of the total 16S rrna genes copies number) and that the amplification efficiencies of the species mentioned above were within a reasonable range from 90% to 100% (Stevenson & Weimer, 2007; Bekele et al., 2010), the proportion results of species could be compared reasonably among studies. In the current study, the population of T. saccharophilum species, particularly with dah (0.58%), might be comparable or even higher than those of other common rumen bacterial species (Stevenson & Weimer, 2007; Bekele et al., 2010), suggesting that T. saccharophilum might play an important role in pectin digestion. Notably, the relative population sizes evaluated in the present study were based on the fraction of 16S rrna genes and could not be directly correlated with cell numbers, as there exists multiple copies of the 16S rrna gene within the genome of a given bacterium (Crosby & Criddle, 2003; Case et al., 2007). In addition, the relatively long persistence of DNA after cell death (Josephson et al., 1993) could potentially lead to the overestimation of the abundance of bacterial species or communities in DNAbased quantitative analysis, presenting an obstacle for the accurate estimation of bacterial populations. However, the utilization of the DNA-intercalating dye ethidium monoazide bromide to selectively remove the DNA from dead cells of environmental bacterial communities might improve the sensitivity of DNA-based quantification (Nocker & Camper, 2006). As a structural heteropolysaccharide in the primary cell walls of plants, the degradation of pectin also accelerates cellulose and hemicellulose degradation (Van Soest et al., 1991). An in vitro study showed a positive interaction between T. bryantii and F. succinogenes, a cellulolytic bacterium (Stanton & Canale-Parola, 1980). Because both T. bryantii and T. saccharophilum are members of the genus, T. saccharophilum could be implicated in fiber degradation through interactions with cellulolytic bacteria. A culture-based study (Ziolecki et al., 1992) of fructan degradation showed that T. saccharophilum strain S, isolated from sheep rumen, possessed higher fructanolytic activities than S. bovis, P. ruminicola, S. ruminantium, and T. bryantii, suggesting that T. saccharophilum might also play a metabolic role in the degradation of nonstructural carbohydrates. To our knowledge, the present study is the first to evaluate the abundance of T. saccharophilum in the rumen, a species that was previously underestimated. Additional studies are needed to fully elucidate the function and ecological importance of this bacterium. The newly designed primers used in the present study might also be used in further ruminal ecological studies. Conclusions The results obtained in the present study clearly demonstrate that the quantification of T. saccharophilum in vivo and in vitro is possible by real-time PCR using our newly designed primers. These results support our hypothesis concerning the association of T. saccharophilum with AH. The relatively high proportion of T. saccharophilum in the rumen might expand our knowledge of the importance of this bacterium in the rumen, especially for pectin digestion.

9 584 J. Liu et al. Acknowledgements This research was supported by the grants from the National Basic Research Program of China Ministry of Science and Technology (Grant No. 2011CB100801). The authors are thankful to Dr Chris McSweeney at CSIRO Livestock Industries, Australia, for donating the pure rumen bacterial strains used for this study. References Acinas SG, Sarma-Rupavtarm R, Klepac-Ceraj V & Polz MF (2005) PCR-induced sequence artifacts and bias: insights from comparison of two 16S rrna clone libraries constructed from the same sample. Appl Environ Microbiol 71: Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: Bekele AZ, Koike S & Kobayashi Y (2010) Genetic diversity and diet specificity of ruminal Prevotella revealed by 16S rrna gene-based analysis. FEMS Microbiol Lett 305: Bekele AZ, Koike S & Kobayashi Y (2011) Phylogenetic diversity and dietary association of rumen revealed using group-specific 16S rrna gene-based analysis. FEMS Microbiol Lett 316: Bryant MP & Small N (1956) Characteristics of two new genera of anaerobic curved rods isolated from the rumen of cattle. J Bacteriol 72: Cai SC, Li JB, Hu FZ, Zhang KG, Luo YM, Janto B, Boissy R, Ehrlich G & Dong XZ (2010) Cellulosilyticum ruminicola a newly described rumen bacterium that possesses redundant fibrolytic-protein-encoding genes and degrades lignocellulose with multiple carbohydrate-borne fibrolytic enzymes. Appl Environ Microbiol 76: Callaway TR, Dowd SE, Edrington TS, Anderson RC, Krueger N, Bauer N, Kononoff PL & Nisbet DJ (2010) Evaluation of bacterial diversity in the rumen and feces of cattle fed different levels of dried distillers grains plus solubles using bacterial tag-encoded FLX amplicon pyrosequencing. J Anim Sci 88: Case RJ, Boucher Y, Dahllof I, Holmstrom C, Doolittle WF & Kjelleberg S (2007) Use of 16S rrna and rpob genes as molecular markers for microbial ecology studies. Appl Environ Microbiol 73: Crosby LD & Criddle CS (2003) Understanding bias in microbial community analysis techniques due to rrn operon copy number heterogeneity. Biotechniques 34: , 796, 798 passim. Dehority BA, Johnson RR & Conrad HR (1962) Digestibility of forage hemicellulose and pectin by rumen bacteria in vitro and the effect of lignification thereon. J Dairy Sci 50: Denman SE & McSweeney CS (2006) Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol 58: Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: Gradel CM & Dehority BA (1972) Fermentation of isolated pectin and pectin from intact forages by pure cultures of rumen bacteria. Appl Microbiol 23: Hatfield RD & Weimer PJ (1995) Degradation characteristics of isolated and in situ cell wall lucerne pectic polysaccharides by mixed ruminal microbes. J Sci Food Agric 69: Josephson KL, Gerba CP & Pepper IL (1993) Polymerase chain reaction detection of nonviable bacterial pathogens. Appl Environ Microbiol 59: Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: Klieve AV, Hennessy D, Ouwerkerk D, Forster RJ, Mackie RI & Attwood GT (2003) Establishing populations of Megasphaera elsdenii YE 34 and Butyrivibrio fibrisolvens YE 44 in the rumen of cattle fed high grain diets. J Appl Microbiol 95: Koike S, Yabuki H & Kobayashi Y (2007) Validation and application of real-time polymerase chain reaction assays for representative rumen bacteria. Anim Sci J 78: Koike S, Handa Y, Goto H, Sakai K, Miyagawa E, Matsui H, Ito S, & Kobayashi Y (2010) Molecular monitoring and isolation of previously uncultured bacterial strains from the sheep rumen. Appl Environ Microbiol 76: Koubala BB, Kansci G, Mbome LI, Crepeau MJ, Thibault JF & Ralet MC (2008) Effect of extraction conditions on some physicochemical characteristics of pectins from Amelioree and Mango mango peels. Food Hydrocolloids 22: Lagowski JM, Sell HM, Huffman CF & Duncan CW (1958) The carbohydrates in alfalfa Medicago sativa I. General composition identification of a nonreducing sugar and investigation of the pectic substances. Arch Biochem Biophys 76: Lan Y, Wang Q, Cole JR & Rosen GL (2012) Using the RDP classifier to predict taxonomic novelty and reduce the search space for finding novel organisms. PLoS One 7: e Lee HJ, Jung JY, Oh YK, Lee SS, Madsen EL & Jeon CO (2012) Comparative survey of rumen microbial communities and metabolites across one caprine and three bovine groups, using bar-coded pyrosequencing and (1)H nuclear magnetic resonance spectroscopy. Appl Environ Microbiol 78: Lin B, Wang JH, Lu Y, Liang Q & Liu JX (2011) In vitro rumen fermentation and methane production are influenced by active components of essential oils combined with fumarate. J Anim Physiol Anim Nutr 97: 1 9. Martin NP & Mertens DR (2005) Reinventing alfalfa for dairy cattle and novel uses. California Alfalfa and Forage Symposium, Visalia, CA.

10 Monitoring rumen pectinolytic bacteria 585 Mertens DR (2002) Nutritional implications of fiber and carbohydrate characteristics of corn silage and alfalfa hay. California Anim Nutr Conf, Fresno, CA. Morgan JL, Darling AE & Eisen JA (2010) Metagenomic sequencing of an in vitro-simulated microbial community. PLoS One 5: e Mullen CA, Boateng AA, Goldberg NM, Lima IM, Laird DA & Hicks KB (2010) Bio-oil and bio-char production from corn cobs and stover by fast pyrolysis. Biomass Bioenergy 34: Muyzer G, De Waal EC & Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rrna. Appl Environ Microbiol 59: National Research Council (2001) Nutrient Requirement of Dairy Cattle, seventh revised edn. National Academy Press, Washington, D.C. Nocker A & Camper AK (2006) Selective removal of DNA from dead cells of mixed bacterial communities by use of ethidium monoazide. Appl Environ Microbiol 72: On SL, Atabay HI, Corry JE, Harrington CS & Vandamme P (1998) Emended description of Campylobacter sputorum and revision of its infrasubspecific (biovar) divisions, including C. sputorum biovar paraureolyticus, a urease-producing variant from cattle and humans. Int J Syst Bacteriol 48 Pt 1: Paster BJ & Canale-Parola E (1985) saccharophilum sp. nov., a large pectinolytic spirochete from the bovine rumen. Appl Environ Microbiol 50: Polz MF & Cavanaugh CM (1998) Bias in template-to-product ratios in multitemplate PCR. Appl Environ Microbiol 64: Rychlik W & Rhoads RE (1989) A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids Res 17: Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: SAS Institute (2000) SAS User s Guide: Statistics. Version SAS Inst. Inc., Cary, NC. Shen JS, Chai Z, Song LJ, Liu JX & Wu YM (2012) Insertion depth of oral stomach tubes may affect the fermentation parameters of ruminal fluid collected in dairy cows. J Dairy Sci 95: Shi Y, Odt CL & Weimer PJ (1997) Competition for cellulose among three predominant ruminal cellulolytic bacteria under substrate-excess and substrate-limited conditions. Appl Environ Microbiol 63: Sikorova L, Piknova M, Javorsky P, Guczynska W, Kasperowicz A, Michalowski T & Pristas P (2010) Variability of treponemes in the rumen of ruminants. Folia Microbiol (Praha) 55: Stanton TB & Canale-Parola E (1980) bryantii sp. nov., a rumen spirochete that interacts with cellulolytic bacteria. Arch Microbiol 127: Stevenson DM & Weimer PJ (2007) Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl Microbiol Biotechnol 75: Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M & Benno Y (2001) Diet-dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl Environ Microbiol 67: Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: Theodorou MK, Williamsa BA, Dhanoaa MS, McAllana AB & Franceb J (1994) A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 48: Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: Van Soest PJ, Robertson JB & Lewis BA (1991) Symposium: carbohydrate methodology metabolism and nutritional implications in dairy cattle. J Dairy Sci 74: Waite R & Gorrod ARN (1959) The comprehensive analysis of grasses. J Sci Food Agric 10: Yu Z & Morrison M (2004) Improved extraction of PCR-quality community DNA from digesta and fecal samples. Biotechniques 36: Zened A, Combes S, Cauquil L, Mariette J, Klopp C, Bouchez O, Troegeler-Meynadier A & Enjalbert F (2013) Microbial ecology of the rumen evaluated by 454 GS FLX pyrosequencing is affected by starch and oil supplementation of diets. FEMS Microbiol Ecol 83: Zhu W, Fu Y, Wang B, Wang C, Ye JA, Wu YM & Liu JX (2013) Effects of dietary forage sources on rumen microbial protein synthesis and milk performance in early lactating dairy cows. J Dairy Sci 96: Ziolecki A, Tomerska H & Wojciechowicz M (1972) Pectinolytic activity of rumen streptococci. Acta Microbiol Pol A 4: Ziolecki A, Guczynska W & Wojciechowicz M (1992) Some rumen bacteria degrading fructan. Lett Appl Microbiol 15: Supporting Information Additional Supporting Information may be found in the online version of this article: Fig. S1. Dissociation analysis of primers specificity with genomic DNA of rumen fluid as template.