Available online at

Transcription

1 674 Available online at Annals of Clinical & Laboratory Science, vol. 45, no. 6, 2015 Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene Ding-Ping Chen 1,2, Ching-Ping Tseng 2,3, Chi-Jui Lin 1, Wei-Ting Wang 1, and Chien-Feng Sun 1,4 1 Department of Laboratory Medicine, Chang Gung Memorial Hospital, Taoyuan County, 2 Department of Medical Biotechnology and Laboratory Science, College of Medicine, Chang Gung University, Taoyuan County, 3 Molecular Medicine Research Center, Chang Gung University, Taoyuan County, and 4 Department of Pathology, School of Medicine, Chang Gung University, Taoyuan County, Taiwan Abstract. In the case of blood type B 3 with typical mixed-field agglutination of RBCs in the presence of anti-b or anti-ab antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mrna splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B 3 protein, and is concomitant with a decrease in B 3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cdna encoding A1 gene with exon 3 deletion. The cdna was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A 1 cdna by flow cytometry analyses. The expression of A antigen in A 1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A 1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B 3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. Keywords: point mutation, RNA splicing, exon 3 skipping, site-directed mutagenesis, mixed field. Introduction The ABO blood group discovered by Karl Landsteiner is, without doubt, the most important blood group system in transfusion medicine. The molecular genetic basis of the human ABO blood group system was elucidated by Yamamoto et al. in 1990, who first characterized the respective nucleotide sequences of the three major alleles (A1, B and O) of the ABO locus [1,2]. Other than the common ABO alleles, numerous alleles with a weak A or B antigen expression on red blood cells (RBCs) have been identified. The phenotypes of A 3, A x, A el, cis-ab, B 3, B x, B el, and B(A) have been defined serologically [3,4], and most of the A and B suballeles responsible for the formation of the ABO blood subgroups have been identified [5,6]. Some of these minor alleles have mutation(s) in the Address correspondence to Ding-Ping Chen, Assistant Professor, Department of Laboratory Medicine, Chang-Gung Memorial Hospital, Taoyuan County, 333, Taiwan; phone: ext. 8364; e mail: a12048@adm.cgmh.org.tw coding sequence of the ABO gene, with most of the mutations being single-nucleotide substitution leading to amino acid change. In addition to the point mutation leading to amino acid change, defects in RNA splicing also account for a number of blood types [7]. It is well known that the IVS3+5G A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mrna splicing [8]. The IVS3+5G A splice donor-site mutation skips exon 3 of the B transcript during mrna processing. Furthermore, we used the cell study model to evaluate the mechanism responsible for the mixed-field agglutination of B 3 RBCs. According to one of our prior studies, the B 3 transcript with exon 3 deletions is predicted to encode a protein with 336 amino acids [9]. Because the protein sequences corresponding to exon 3 are located at the transmembrane and, mainly, the stem region, we can infer that the stem region serves as a flexible tether, allowing the catalytic domain to glycosylate carbohydrate groups /15/ by the Association of Clinical Scientists, Inc.

2 Mechanistic evaluation for mixed-field agglutination 675 cannot efficiently transfer 1, 3-D-galactose to the H Table 1. The Primer Sequences for Generating Various protein. However, the occurrence of this phenomenon in the blood type A still needs to be evaluated ABO Alleles cdna. deeply. Primer Sequence Exon2-4-R 5 tccctaacagccatgccaaacaagaccaag3 Exon2-4-F 5 cttggtcttgtttggcatggctgttaggga3 cdna1-f 5 aaggcggaggccgagaccagacg3 cdna1-r 5 cctaggcttcagttactcacaac3 cdna2-f 5 gaattcagccatggccgaggtgttgc 3 cdna2-r 5 tctagaacaacaggacggacaaaggaaacag3 Table 2. The relative A antigen expression for K562, A1 and exon 3-deletion. anti-a K562 A1 exon-3- Relative A (sc-69951) % % deletion antigen % presenting percentage % mean S.D a The data represent the mean ±S.D. (n = 20) for the indicated transfectants. The mean percentage of K562 was used as baseline. The mean percentage of the A antigenexpressing cells obtained from A1 was used as referencesand was defined as 100%. b The relative A antigen presenting percentage was calculated according the exon 3-deletion %. c All data were achieved from 20 times of experiments independently. of membrane bound H determinants [1,10,11]. Therefore, the lack of exon 3 likely produces B3 proteins that are unstable and causes a decrease in B3 protein expression. It is also likely that, due to the short stem region, B3 protein is less flexible and Materials and Methods Materials. Human leukemic K562 cells with homozygous O alleles and surface expression of type H antigens were obtained from American Type Culture Collection (Manassas, VA). The QIAamp RNA Blood Mini Kit was purchased from Qiagen (Valencia, CA). The SuperScript III First-Strand Synthesis System, Zero Blunt TOPO PCR Cloning kit and Lipofectamine 2000 (LF2000) were purchased from Invitrogen (Carlsbad, CA). The pci-neo mammalian expression vector was purchased from Promega (Madison, USA). The sodium butyrate was purchased from Sigma (Saint Louis, MO). The FITC-conjugated anti-blood group A antigen was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Collection of blood specimen from healthy individuals. Typing of ABO blood type was performed using the standard haemagglutination test. The peripheral blood in K 3 -EDTA tubes was obtained from healthy volunteers with the approval of the Chang Gung Memorial Hospital Institute Review Board. All of the assessed individuals belong to the Taiwanese population. The use of a double-blind sampling method, which omits the individuals names, makes the specimens not individually identifiable. RT-PCR and plasmid construction. Total RNAs were extracted from 1 ml of peripheral blood cell suspension (plasma and mononuclear cells) using the QIAamp RNA Blood Mini Kit. Reverse transcription (RT) into complimentary DNA (cdna) was performed using the SuperScript III First-Strand Synthesis System and the oligo (dt)-15 primers. To iterate briefly, the total RNA (5 μg) was subjected to RT reaction (20 μl) containing 2 μl of 10X RT buffer, 2 μl of 0.1 M dithiothreitol, 1 μl of 10 mm dntp, 1 μl of 50 μm poly(dt) primer, 1 μl of 40 U/μl RNaseOUT and 1 μl of 200 U/μl SuperScript III reverse transcriptase. The RT condition was 50 o C for 50 min and 85 o C for 5 min followed by incubation with 1 μl of RNase H for 20 min at 37 o C. The RT mixtures were then subject to PCR in a reaction (50 μl) containing 5 μl of RT product, 5 μl of 10X PCR buffer (20 mm MgCl 2 ), 4 μl of 2.5 mm dntp, 2 μl of 10 μm cdna1- F and cdna1-r primers (Table 1), and 1 μl of Pfu Turbo Hotstart DNA Polymerase (Stratagene). The cycling condition was 3 min at 95 o C for 1 cycle, then 30 sec at 94 o C, 30 sec at 65 o C, and 1 min at 72 o C for 35 cycles, then 10 min at 72 o C for 1 cycle. The 1340 bp PCR product was then subject to nested PCR to amplify a 1191 bp sequence using the primers cdna2-f and

3 676 Annals of Clinical & Laboratory Science, vol. 45, no. 6, 2015 Figure 1. Expression of A1-exon 3 deletion cdna is sufficient to induce typical mixed-field agglutination. The indicated K562 sublines were treated with sodium butyrate to induce erythroid differentiation. The cells were then incubated with anti-a antibody and cell agglutination was observed using a phase contrast microscope. Figure 2. Flow cytometric analysis of the A antigen expression. The indicated cell lines were treated with sodium butyrate for 48 h to induce erythroid differentiation. The cells were then incubated with FITC-conjugated anti-blood group A antigen (Santa Cruz Biotechnology). Flow cytometric analyses were then performed to determine the levels of surface A antigen expression. Representative histograms for the indicated sublines were shown. The FITC-derived fluorescent intensity was displayed on the x-axis on a logarithmic scale and the number of cells on the y-axis. cdna2-r (Table 1) that carried an Eco RI and an Xba I site at the 5'-end, respectively. The PCR product was cloned into the pcr4blunt-topo vector by a Zero Blunt TOPO PCR Cloning kit. The sequences of the PCR insert were validated using the BigDye Terminator v3.1 Cycle Sequencing Kit and were subsequently cloned into the pci-neo mammalian expression vector. The plasmids containing cdna of the common alleles A101 was produced from the A cdna. Site-directed mutagenesis. The Exon 3 deletion of A1 gene cdna was generated by site-directed mutagenesis. A101 cdna was used as the template to generate two PCR products. First, a 118 bp DNA fragment of exon 1-4 without exon 3 was amplified by the primer pair cdna1-f and exon 2-4R. Then a 975 bp DNA fragment of exon 2-7 skipping exon 3 was obtained by PCR using the primers exon2-4f and cdna1-r. The HotStart pfu DNA polymerase was used for the PCR amplification of cdna fragments at the cycling condition of 4 min at 94 o C for 1 cycle, then 30 sec at 94 o C, 30 sec at 58 o C, and 45 sec at 72 o C for 30 cycles, and 10 min at 72 o C for 1 cycle. After purification with QIAquick PCR Purification kit (QIAGEN), the 118 bp and 975 bp PCR products were mixed, and the second PCR was performed using the primers cdna2-f and cdna2-r in the same cycling condition to obtain the A 3 cdna with exon 3 deletion (1134 bp). The 1134 bp PCR product was cloned into the pcr4blunt-topo vector by a Zero Blunt TOPO PCR Cloning kit and the sequences were confirmed by DNA sequencing. The inserted plasmid DNA was subsequently digested with Eco RI and Xba I and inserted into the pci-neo mammalian expression vector. All constructs were validated by nucleotide sequence analysis. Stable transfection. The K562 cells (1x10 6 ) were routinely cultured in 90% Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum, penicillin (50 U/mL) and streptomycin (50 μg/ml), and were transfected with 5 μg of plasmid DNA using LF2000 according to the manufacturer's instructions. The stable clones were selected by antibiotic resistance in the growth medium containing 400 μg/ml of G418 for 2 weeks. The transfectants (3x10 5 ) were stimulated by sodium butyrate to induce erythroid differentiation. Forty-eight hours later, the cells were harvested and subjected to flow cytometry to analyze the A 1 and A 1 with exon 3 deletion antigen expression.

4 Mechanistic evaluation for mixed-field agglutination 677 Table 3. Alleles of the A 3 and B 3 blood group system Allele Nucleotide change(s) Amino acid change(s) Phenotype Authors / Pub Med IDs A G>A D291N A3 Yamamoto F et al. / A G>A; 1061delC V277M; 354fs A3 Barjas-Castro et al. / A C>T L280F A3 Sun et al. / A C>T; 539G>A; P156L; R180H; A3 Svensson et al. / delC 354fs + 21aa A G>A V274M A3 Li et al. / A C>T; 820G>A P156L; V274M A3 Li et al. / A C>T, 745C>T P156L; R249W A3 Li et al. / A308 intron2+3a>g splicing variation A3 Cai et al / A309 1A>G M1V; initiator Met codon A3 Xiaohong Cai; is disrupted; expect an Sha Jin;Dong Xiang. / N-truncated A transferase A T>C; 467C>T; V36A; P156L; A3 1061C>del 354fs + 21aa B A>G; 526C>G; R176G; G235S; L266M; B3 Yamamoto F et al. / C>T; 703G>A; G268A; R352W 796C>A; 803G>C; 930G>A; 1054C>T B A>G; 526C>G; R176G; F216I; G235S; B3 Ogasawara K et al. / T>A; 703G>A; L266M; G268A 796C>A; 803G>C; 930G>A; B A>G; 526C>G; R176G; G235S; B3 Yu et al.; Yazer et al. / 657C>T; 703G>A; L266M; , C>A; 803G>C; G268A + skip exon 3 930G>A; res intron 3 + 5G>A B G>T; 297A>G; D83Y; R176G; B3 Yu et al. / C>G; 657C>T; G235S; L266M; 703G>A; 796C>A; G268A 803G>C; 930G>A; B A>G; 425T>C; M142T, R176G; B3 Yan LX and Xu XG 526C>G; 657C>T; G235S; L266M; 703G>A; 796C>A; G268A 803G>C; 930G>A B306/B 297A>G; 526C>G; R176G; D183N; A1B3 in Cho et al. / (var) 547G>A; 657C>T; G235S; L266M; A101/Bvar 703G>A; 796C>A; G268A or A102/Bvar 803G>C; 930G>A heterozygotes or B in Bvar / O01 heterozygotes B A>G; 410C>T; A137V; R176G; B3 Xu XG, Zhu FM, 526C>G; 657C>T; G235S; L266M; Hong XZ, Yan LX 703G>A; 796C>A; G268A 803G>C; 930G>A B A>G; 526C>G; R176G; G235S; B3 Lee,Y.L.; Park,Y.M.; Lim,A.H.; 657C>T; 703G>A; L266M; G268A; Kwon,S.Y.; Cho,N.S.; Oh,D.J. 796C>A; 803G>C; H313P 930G>A; 938A>C

5 678 Annals of Clinical & Laboratory Science, vol. 45, no. 6, 2015 Table 3 (continued). Alleles of the A 3 and B 3 blood group system Allele Nucleotide change(s) Amino acid change(s) Phenotype Authors / Pub Med IDs B C>T;297A>G; R176G; G235S; B3 Zhang Rong: Chinese Academy 526C>G; 657C>T; L266M; G268A; of Medical Sciences, Institute 703G>A; 796C>A; of Blood Transfusion; e mail: 803G>C; 930G>A; zhang_rong86@126.com B310 28G>A; 297A>G; G10R; R176G; B3 Xiaohong Cai; Sha Jin; 526C>G; 657C>T; G235S; L266M; Dong Xiang. / G>A; 796C>A; G268A; 803G>C; 930G>A splicing of exon1 may accur Flow cytometry analysis. For A antigen detection, K562 cells or the transfectants (6x10 6 ) were washed twice with 1X phosphate-buffered saline (PBS) and were incubated for 60 min at room temperature with FITC-conjugated anti-blood group A antigen (Santa Cruz Biotechnology). After two washes with 1X PBS, the cells were analyzed on a flow cytometer (Cytomics FC500; Beckman Coulter). Two variables, the percentage of antigen-expressing cells and the mean fluorescence intensity (MFI), were used for data analysis. MFI is a relative measurement for the amount of antigen expression on the cell surface. The parental K562 cells were used as a reference control. Agglutination assay. The K562-A1 with exon 3 deletion and K562 control cells (2x10 6 ) were stimulated by sodium butyrate to induce erythroid differentiation. Forty eight hours later, the cells were adjusted to 1x10 6 /ml and reacted with the anti-a antibody (Immucor Gamma, Norcross, GA) to agglutination test. The number of agglutination in a region of 1 mm x 1 mm x 0.1 mm was counted using a hemocytometer. Results Various molecular mechanisms including mutations at the promoter, enhancer and coding sequences have been proposed to explain phenotypic changes for a number of blood types [12-15]. We previously used K562 cells as a cell study model to express B 1 cdna and to investigate ABO antigen expression [7]. In addition, we used the same strategy to stably expressed B 3 cdna under the control of cytomegalovirus promoter, and we determined the effect of B gene exon 3 deletions on surface B antigen expression. This time, we used the same strategy to study if the exon 3 deletions result in mixed-field on blood type A RBCs. At first, the stable lines expressing A 1 or A 1 with exon 3 deletion cdna were treated with sodium butyrate to induce erythroid differentiation, and surface expression of A antigen was measured by the binding of FITC-conjugated anti-blood group A antigen (Santa Cruz Biotechnology) followed by flow cytometry analysis. As shown in Figure 1 and Figure 2, the parental K562 cells and the cells transfected with control vector did not express A antigen. In contrast, A antigen expression was increased in the stable cell line that expressed A 1 or A 1 with exon 3 deletion cdna. The relative percentage of the A antigen expressing cells was determined by comparing the levels of A antigen expression in the A 1 and A 1 with exon 3 deletions sublines. The parental K562 cells that did not express A antigen were used as the negative control, whereas the stable cell line expressing A 1 cdna served as a positive control; the percentage of antigen expressing cells for A 1 was set at 100%. Accordingly, the relative percentage of the A antigen expression for the cells of A 1 with exon 3 deletion was 59.9% of A 1 (Table 2). To further delineate the expression levels of the A antigen in the A 1 and A 1 with exon 3 deletions sublines, the MFI that represents the total A antigen expression was also compared. We found that the MFI for the A 1 with exon 3 deletion was lower than for A 1. These data thereby demonstrate that the exon 3 deletion of the A allele causes a decrease in surface A antigen expression. Mixed-field agglutination is a typical B 3 phenotype when reacted with the anti-b antibody. In the past, we have demonstrated that the B 1 with exon 3 deletion protein alone is sufficient to cause mixed-field agglutination. Under the same theory, we have demonstrated that the A 1 with exon 3 deletion protein alone is sufficient to cause mixedfield agglutination in this study.

6 Discussion According to the NCBI data bank, ten A 3 and ten B 3 alleles have been identified and characterized (Table 3) [16]. Most A 3 and B 3 alleles are resulted from point mutations. As to A 3 alleles among Taiwanese, an individual was shown to harbor an A gene containing a nucleotide change of 838C T, which predicts an amino acid alteration of Leu280Phe in the encoded A transferase [17]. Interestingly, the mixed-field in Taiwan B 3 was the result of IVS3+5 G>A mutation in the B gene, which destroys the consensus of the splice donor site leading to exon 3 skipping during mrna splicing. To further confirm that the exon 3 deletion will result in mixed-field, we use the A template as a model to study if the phenomenon still appears on the A template. On the other hand, we have previously proposed two inter-relative mechanisms that cause a decrease in B surface antigen expression and ultimately mixed-field agglutination phenotype of B 3. One is the IVS3+5G>A mutation of B gene, which causes cryptic splicing error and produces at least 7 alternative splicing types. More than 99% of the splicing transcripts do not produce functional proteins; less than 1% of the splicing transcripts with exon 3 deletions are predicted to generate functional B 3 protein. The other mechanism is that the B 3 protein only has about half of the normal B function. Together, these two interactive mechanisms account for the weak B antigen expression and ultimately cause the typical mixed-field agglutination of B 3. Therefore, we want to know which mechanism is the primary cause of mixed-field. The results indicate that exon 3 deletion can result in mixed field not only in blood type B but also in blood type A, although rarely. It is important to notice that the mutations, which have been reported among A 3, are around the exon 6 to exon 7 regions. As for B 3, the mutations are around the exon 1~6 region. The situations also explain why exon 3 deletions are rarely seen in blood type A. When the exon 3 deletion mutation occurs in blood type A, the titer is only decreased by one-third instead of one-half according to this study's results. Hence, even with exon 3 deletion in blood type A, the influence resulted from this deletion may be ignored. In conclusion, the hypothesis that exon 3 deletions lead to mixed-field was confirmed by this study. Mechanistic evaluation for mixed-field agglutination Acknowledgment This work was supported by the Grant NSC B- 182A-005 from the National Science Council, Taiwan. The excellent consulting assistance and sample resources from blood bank of Chang-Gung Memorial Hospital are gratefully acknowledged. References Yamamoto F, Marken J, Tsuji T, White T, Clausen H, Hakomori S. Cloning and characterization of DNA complementarytohumanudp-galnac: Fucα1 2Galα1 3GalNAc transferase (histoblood group A transferase) mrna. J Biol Chem 1990; 265: Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular genetic basis of the histo-blood group ABO system. Nature 1990; 345: Issitt PD, Anstee DJ: Applied Blood Group Serology, 4th edn. Durham, NC, Montgomery Scientific Publications, Chester MA, Olsson ML. The ABO blood group gene: a locus of considerable genetic diversity. Transfuse Med Rev 2001; 15: Yip SP. Sequence variation at the human ABO locus. Ann Hum Genet 2002; 66: Ogasawara K, Yabe R, Uchikawa M, Saitou N, Bannai M, Nakata K, Takenaka M, Fujisawa K, Ishikawa Y, Juji T, Tokunaga K. Molecular genetic analysis of variant phenotypes of the ABO blood group system. Blood 1996; 88: Chen DP, Tseng CP, Wang WT, Sun CF. Use of cell study models to confirm the weak ABO phenotypes caused by point mutations among Taiwanese. Ann Clin Lab Sci 2011; 41: Yu LC, Two YC, Chou ML, Chang CY, Wu CY, Lin M. (2002) Molecular genetic analysis for the B3 allele. Blood 2002; 100: Chen DP, Tseng CP, Wang WT, Sun CF. Genetic and mechanistic evaluation for the mixed-field agglutination in B3 blood type with IVS3+5G>A ABO gene mutation. PLoS ONE 2012; 7(5):e Seltsam A, Blasczyk R. Missense mutations outside the catalytic domain of the ABO glycosyltransferase can cause weak blood group A and B phenotypes. Transfusion 2005; 45: Paulson JC, Colley KJ. Glycosyltransferases. Structure, localization, and control of cell type-specific glycosylation. J Biol Chem 1989; 264: Irshaid NM, Chester MA, Olsson ML. Allele-related variation in minisatellite repeats involved in the transcription of the blood group ABO gene. Transfus Med 1999; 9: Kominato Y, Tsuchiya T, Hata N, Takizawa H, Yamamoto F. Transcription of human ABO histo-blood group genes is dependent upon binding of transcription factor CBF/NF-Y to minisatellite sequence. J Biol Chem 1997; 272: Yu LC, Chang CY, Twu YC, Lin M. Human histo-blood group ABO glycosyltransferase genes: different enhancer structures with different transcriptional activities. Biochem Biophys Res Commun 2000; 273: Kominato Y, Hata Y, Takizawa H, Tsuchiya T, Tsukada J, Yamamoto F. Expression of human histo-blood group ABO genes is dependent upon DNA methylation of the promoter region. J Biol Chem 1999; 274: fcgi?cmd=bgmut/systems_alleles&system=abo 17. Sun CF, Yu LC, Chen DP, Chou ML, Twu YC, Wang WT, Lin M. Molecular genetic analysis for the Ael and A3 alleles. Transfusion 2003; 43: