The Activity of Glycopeptide Antibiotics Against Resistant Bacteria Correlates with their Ability to Induce the Resistance System

Transcription

1 Supplemental Material for The Activity of Glycopeptide Antibiotics Against Resistant Bacteria Correlates with their Ability to Induce the Resistance System Min Jung Kwun, Hee-Jeon Hong# Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom Running Title: Structure-Activity Study of Glycopeptide Derivatives #Address correspondence to Hee-Jeon Hong, 1

2 EXPERIMENTAL SECTIONS Antibiotics, bacterial strains, growth conditions, and MIC determination All chemo-enzymatically synthesized glycopeptide derivatives used for this study were kindly provided by Daniel Kahne and his coworkers. Except where described here, media and culture conditions were as given previously (1). For the MIC test, vancomycin-resistant S. coelicolor wild type (M600) and vancomycin-sensitive S. coelicolor ΔvanRS (J3201) were used (2). Approximately 10 5 spores of each S. coelicolor strain were germinated by heat shock treatment in 5 ml of TES buffer (0.05 M, ph8) at 50 C for 10 min, then diluted with an equal volume of germination medium (1% (w/v) Difco yeast extract, 1% (w/v) Difco casamino acids, 0.01 M CaCl 2 ) and incubated with shaking at 37 C for 2-3 h. The culture broth was centrifuged for 1 min at 4,000 g, and the pellet was resuspended in 1 ml of NMMP liquid medium. 10 μl of germinated spores were then inoculated in 140 μl of NMMP liquid medium containing the antibiotic under test at a range of concentrations in 96-well plates. After overnight shaking incubation at 30 C, MIC values were determined by visual inspection of growth over the range of antibiotic concentrations. RNA preparation and quantitative real time PCR (qrt-pcr) RNA preparation and qrt-pcr were performed according to method described previously (3, 4). For RNA preparation, 0.5 ml of germinated spores of S. coelicolor M600 in NMMP as described above were inoculated in 25 ml NMMP liquid medium and grown to mid-log phase (~0.5 at OD 600 ). 5 ml of the first sample was taken as non-induced control (0 min). Immediately after the first sample was taken, final concentration of 10 μg/ml antibiotic was added to the culture broth and samples were taken in 30 min time intervals up to 90 min (30 min, 60 min, 90 min). As soon as the 5 ml of sample broth was taken, the sample was centrifuged for 10 s at 4,000 g and the prepared cell pellet was resuspended into 10 ml of RNA protect bacteria solution (Qiagen). After 5 min incubation at room temperature, the sample was centrifuged again for 10 s at 4,000 g and the supernatant was discarded. The obtained pellet can be store for up to 1 month at -80 C until for use. For RNA preparation, cell pellet was resuspended in 1 ml of ice-cold Kirby mix and sonicated twice for 4-5 s each, then extracted with 0.8 ml of phenol-chloroform (ph8.0) by vortexing. Samples were re-extracted with phenol-chloroform (ph8.0) and nucleic acids were precipitated at -20 C using 0.3 M sodium acetate (ph6.0) and an equal volume of isopropanol. After centrifugation, nucleic acids pellet was washed with 70% ethanol, dissolved in DNase I buffer, then treated with 5 units of 2

3 DNase I at 37 C for 30 min. Samples were extracted with phenol-chloroform (ph8.0) and pecipitated again as described above. After centrifugation, RNA pellets were dissolved in RNasefree distilled water and stored at -80 C. Primers for prt-pcr analysis of vanh and sige transcription were designed using Primer3 ( The primer pairs used for this study were as follows: for vanh, 5 - ACGAGAATCACGGTTTACGG (qvanh-f) and 5 -CTTGTGGTCAATGCTTATGC (qvanh-r); for sige, 5 -CTGATGGACGTCCTGAAGGT (qsige-f) and 5 -GTCTCCTCCGTCGACATCTG (qsige-r). The qrt-pcr analyses were performed using 2.5 μg of total RNAs. Each RNA sample was subjected to RNase-free DNaseI treatment (Invitrogen, amplification grade) in a 20 μl reaction volume. For cdna synthesis, 8 μl of the DNaseI-treated RNA was used as template in a 20 μl reaction volume employing Superscript III First Strand Synthesis Supermix (Invitrogen). PCR cycling was performed at 25 C for 10 min, 42 C for 120 min, 50 C for 30 min, 55 C for 30 min and then 85 C for 5 min. Each PCR product was then treated with RNaseH and diluted 100 times in DNase-free distilled water. 2.5 μl aliquots of each cdna sample were subjected to prt-pcr analysis in total 25 μl reaction volumes with SYBR GreenER qpcr Supermix (Invitrogen) according to the manufacturer s instructions. Each 25 μl reaction solution contained 12.5 μl of SYBR GreenER qpcr Supermix, 250 nm Rox, 200 nm of forward and reverse primers and 3 μl of 40% DMSO. qrt-pcr cycling was performed in a 7300 Real Time PCR System (Applied Biosystems) at 50 C for 2 min, 95 C for 10 min, followed by 30 cycles of 95 C for 15 s and 57 C for 1 min. The results were analysed using 7300 system SDS Software (version 1.4, Applied Biosystems). qrt-pcr determinations were performed in triplicate on each RNA sample and average abundances used. To simplify the pattern of induction for vanh and sige by each glycopeptide compound tested, the data shown in Fig. 3 was normalized relative to the level of expression at time 0 which was defined as 1. 3

4 SUPPLEMENTARY TABLES TABLE S1 Copy number of sige obtained from qrt-pcr (average and standard deviation (stdev) of triplicate measurements). Compounds Group 1 Group 2 Group 3 Group 4 Damaged Glycopeptide Derivatives Time 0 min 30 min 60 min 90 min 1a average 2.36E E E E+05 stdev b average 2.24E E E E+05 stdev c average 1.92E E E E+05 stdev d average 2.10E E E E+05 stdev 9.46E E e average 1.99E E E E+05 stdev f average 1.93E E E E+05 stdev g average 2.04E E E E+05 stdev a average 2.32E E E E+05 stdev b average 2.26E E E E+05 stdev c average 2.00E E E E+05 stdev d average 2.26E E E E+05 stdev a average 1.72E E E E+05 stdev b average 1.76E E E E+06 stdev c average 1.88E E E E+05 stdev d average 2.24E E E E+05 stdev e average 2.26E E E E+05 stdev f average 2.12E E E E+05 stdev E E E+05 3g average 2.14E E E E+06 stdev a average 1.99E E E E+06 stdev 3.26E E b average 1.83E E E E+06 stdev c average 1.69E E E E+06 stdev d average 2.10E E E E+06 stdev D-1a average 2.15E E E E+05 stdev D-4a average 2.02E E E E+05 stdev D-3f average 1.63E E E E+05 stdev E E E+04 D-4d average 2.08E E E E+05 stdev

5 TABLE S2 Copy number of vanh obtained from qrt-pcr (average and standard deviation (stdev) of triplicate measurements). Compounds Group 1 Group 2 Group 3 Group 4 Damaged Glycopeptide Derivatives Time 0 min 30 min 60 min 90 min 1a average 1.37E E E E+05 stdev 3.89E E E E+04 1b average 1.02E E E E+05 stdev c average 1.57E E E E+05 stdev d average 5.76E E E E+05 stdev e average 5.99E E E E+04 stdev f average 1.73E E E E+04 stdev g average 1.54E E E E+05 stdev a average 9.71E E E E+05 stdev b average 1.06E E E E+05 stdev c average 1.63E E E E+05 stdev d average 5.83E E E E+05 stdev a average 1.10E E E E+03 stdev b average 9.49E E E E+02 stdev c average 1.16E E E E+03 stdev d average 5.35E E E E+02 stdev e average 5.10E E E E+02 stdev f average 5.95E E E E+02 stdev 1.64E g average 5.40E E E E+02 stdev 1.47E a average 1.27E E E E+03 stdev 2.20E E E b average 9.64E E E E+02 stdev c average 1.03E E E E+03 stdev d average 6.83E E E E+02 stdev D-1a average 8.62E E E E+02 stdev D-4a average 6.89E E E E+02 stdev D-3f average 6.85E E E E+02 stdev D-4d average 8.67E E E E+02 stdev

6 REFERENCES 1. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA Practical Streptomyces genetics. The John Innes Foundation, Norwich. 2. Hong H-J, Hutchings MI, Neu JM, Wright GD, Paget MS, Buttner MJ Characterisation of an inducible vancomycin resistance system in Streptomyces coelicolor reveals a novel gene (vank) required for drug resistance. Mol. Microbiol. 52: Kwun MJ, Novotna G, Hesketh AR, Hill L, Hong H-J In vivo studies suggest that induction of VanS-dependent vancomycin resistance requires binding of the drug to D-Ala-D-Ala termini in the peptidoglycan cell wall. Antimicrob. Agents Chemother. 57: Hesketh A, Kock H, Mootien S, Bibb M The role of absc, a novel regulatory gene for secondary metabolism, in zinc-dependent antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 74: