The retroviral vectors encoding WT human SIRT1 or a mutant of SIRT in which a

Transcription

1 Supporting online material Constructs The retroviral vectors encoding WT human SIRT1 or a mutant of SIRT in which a critical histidine in the deacetylase domain of SIRT1 has been replaced by a tyrosine residue (H363Y) have been described previously (1) and were generously provided by Dr. R.A Weinberg and Dr. H. Vaziri. The retroviral vectors encoding mouse SIRT1 (Sir2α) WT and the mouse SIRT1 mutant in which a critical histidine residue in the deacetylase domain of SIRT1 has been replaced by an alanine residue have been described previously (2) and were generously provided by Dr. S.I. Imai. The constructs encoding the HA-tagged version of WT FOXO3, the active FOXO3 mutant (T32A/S253A/S315A triple mutant) were described previously (3). The mammalian expression vectors encoding the Flag-tagged form of human SIRT1 were generated by sub-cloning SIRT1 WT or SIRT1 mutant PCR fragments into the EcoRI and XbaI site of the pece mammalian expression vector containing the Flag epitope subcloned between the HindIII and the EcoRI site. The Flag-tagged form of FOXO3 was generated by subcloning an EcoRI-XbaI cassette of FOXO3 into the Flag-pECE mammalian expression vector. The retrovirus vectors encoding the Flag-tagged form of FOXO3 active mutant was generated by subcloning an HindIII-XbaI cassette of Flag-FOXO3 into a plxsn retroviral backbone.

2 Cell culture The human embryonic kidney cell line HEK 293T, the Chinese hamster lung fibroblast cell line CCL39 (ATCC), the Rat1 derived cell lines and the mouse embryonic fibroblasts (MEFs) were cultured in DMEM (Gibco) supplemented with 10% FCS (Gibco), antibiotics (50U/ml penicillin and 50 mg/ml streptomycin) and the proper selective drugs (G418 or puromycin) at 37 C in an atmosphere of 95% air, 5% CO2. Cerebellar granule cells were obtained from P6 Long Evans rats and cultured in BME (Sigma) supplemented with 25 mm KCl, 10% heat inactivated calf serum (Hyclone) and antibiotics. In vitro acetylation assays Bacterially expressed GST-FOXO3 was purified according to the Invitrogen protocol. 5 µg of the GST-FOXO3 were incubated with purified recombinant PCAF (Upstate Biotechnology, 500 ng) or with the purified recombinant HAT fragment of p300 (Upstate Biotechnology, 5U) in the presence of acetyl-coa (20 µm) for 1hr at 30 o C. The reactions were performed in a buffer containing 50 mm Tris HCl (ph 8.0), 0.1 mm EDTA, 1 mm DTT, 10% glycerol. The products of the reaction were resolved on SDS-PAGE and analyzed by western-blotting with anti-acetylated lysine antibodies (Cell Signaling and Technology, 1:500). Purification of Flag-FOXO3 from 293T cells 293T cells were seeded at 4x10 6 cells/10 cm plates and were transiently transfected with 20 µg of Flag-FOXO3 constructs using the calcium phosphate transfection method. Two days after transfection, cells were incubated in the absence or in the presence of H 2 O 2

3 (500 µm, 1h). Extracts were obtained by lysing the cells in lysis buffer (50 mm Tris HCl ph8, 100 mm NaCl, 2 mm EGTA, 10 mm NaF, 40 mm βglycerophosphate, 0.4% Triton-X100, 1 mm orthovanadate, aprotinin, 1 mm PMSF, 10 mm nicotinamide, 10 mm TSA). Cell extracts were subjected to immunoprecipitation using agarose beads coupled to the Flag antibody (Sigma). The Flag-tagged FOXO3 was released from the beads by a 1 h incubation with Flag peptide (Sigma, 0.5 mg/ml 1:1 bead volume). In vitro FOXO3 deacetylation assay Purified Flag-FOXO3 was incubated in deacetylation buffer (25 mm Tris HCl (ph 8.0, 137 mm NaCl, 2.7 mm KCl, 1mM MgCl 2 ) in the presence of purified recombinant human SIRT1 (BioMol, 3.5U), in the presence or absence of NAD (Sigma, 60 µm), in the presence or absence of the SIRT1 inhibitor BML-210 (BioMol, 1.5 mm) or the ClassI/II HDAC inhibitor (Trichostatin A (TSA, Sigma, 10 µm) for 1 hr at 30 o C. The reactions were resolved on SDS PAGE and analyzed by western-blotting. Co-immunoprecipitation experiments 293T cells were seeded at 700, 000 cells/35 mm dish and were transfected with 2.5 µg of constructs encoding HA-FOXO3 and 2.5 µg of constructs encoding Flag-SIRT1. One day after transfection, cells were incubated in the presence or absence of various stimuli. Flag-SIRT1 was purified as described above for Flag-FOXO3. The immune complexes were analyzed by western-blotting with anti-ha antibodies. For immunoprecipitation of endogenous proteins, 20x T cells were lysed in the lysis buffer described above. Cell extracts were subjected to immunoprecipitation with a mouse polyclonal antibody to

4 FOXO3 that was generated by injecting purified GST-FOXO3 to mice or a control preimmune mouse serum at the same total protein concentration. The immune complexes were analyzed by western-blotting with anti-sirt1 antibodies (Upstate Biotechnology, 1:2000). Acetylation of endogenous FOXO3 WT or SIRT1 -/- MEFs were seeded at 750, 000 cells/10 cm plates. 5 days later, MEFs were incubated in the presence of TSA (5 µm) for 2 hours. Cells were lysed in the lysis buffer described above. Cell extracts were subjected to immunoprecipitation with the mouse polyclonal antibody to FOXO3 described above. The immune complexes were analyzed by western-blotting with anti-acetyl lysine antibodies (Cell Signaling and Technology, 1:300). Alternatively, cell extracts were subjected to immunoprecipitation with the anti-acetyl lysine antibodies (Cell Signaling and Technology) and the immunecomplexes were analyzed by western-blotting with rabbit polyclonal antibody to FOXO3. RT-PCR analysis The expression of endogenous p27 and BIM was determined by reverse transcription of total RNA followed by PCR analysis. Total RNA was extracted using RNASTAT-60 (TEL-TEST) and was purified further on Qiagen RNA purification columns. 2 µg of total RNA was reverse transcribed by extension of oligodt primers using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer s protocol. PCR of the cdna was performed using Taq Polymerase (Promega) with the following pairs of primers:

5 Rat p27 (forward): TTGCCCGAGTTCTACTACAGACCCC Rat p27 (reverse): TTCCTCATCCCTGGACACTGCTC Rat BIM (forward): TCCCTACAGACAGAATCGCAAGAC Rat BIM (reverse): TCCTGAGACTGCCTTATGGAAGCC Rat GAPDH (forward): TCCATGACAACTTTGGCATCGTGG Rat GAPDH (reverse): GTTGCTGTTGAAGTCACAGGAGAC The PCR program used was: 2 min at 94 C, followed by 30 cycles (30 s at 94 C, 30 s at 68 C, 1 min at 72 C), followed by 10 min extension at 72 C. A PCR reaction was also performed on total RNA that had not been reverse-transcribed to control for the absence of genomic DNA in the RNA preparation. The products of the PCR reactions were resolved on a 2.5% agarose gel. Real time PCR analysis The expression of endogenous GADD45 in WT or SIRT1 -/- MEFs was determined by reverse transcription of total RNA followed by real time PCR analysis. Total RNA was extracted using RNA extraction kit (Qiagen). 2 µg of total RNA was reverse transcribed by extension of oligodt primers using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer s protocol. Real time PCR was performed on an ABI cycler using Sybr green (ABI) with the following pairs of primers: Mouse GADD45-1 (forward): AGACCGAAAGGATGGACACG Mouse GADD45-1 (reverse): TGACTCCGAGCCTTGCTGA Mouse GADD45-2 (forward): AGCAAGGCTCGGAGTCAGC Mouse GADD45-2 (reverse): ACGTTGAGCAGCTTGGCAG

6 Mouse BIM1 (forward): CGGATCGGAGACGAGTTCA Mouse BIM1 (reverse): TTCAGCCTCGCGGTAATCA Mouse BIM2 (forward): CGCAAGCTTCCATACGACAGT Mouse BIM2 (reverse): TCCTGTGCAATCCGTATCTCC Mouse HPRT (forward): GCCTAAGATGAGCGCAAGTTG Mouse HPRT (reverse): TACTAGGCAGATGGCCACAGG The experiments were conducted in triplicate and the results were expressed as 2 (-(Gadd45 number of cycles-hprt number of cycles)). A PCR reaction was also performed on total RNA that had not been reverse-transcribed to control for the absence of genomic DNA in the RNA preparation. We verified that the products of the real time PCR reactions resolved in a single band on 2.5 % agarose gels. Retroviral infection 293T cells were co-transfected with the retroviral constructs together with plasmids encoding the Gag, Pol, and Env proteins of the MLV retrovirus. 20 hours after transfection, 0.45 µm filtered conditioned medium from infected 293T cells was incubated with WT or SIRT1 -/- MEFs, or with Rat1 cells expressing TM-ER in the presence of 8 µg/ml of polybrene. Three successive rounds of infections were performed at 12h intervals and the infected cells were selected for their resistance to G418 (Invitrogen, 2 µg/ml) for one week.

7 BrdU incorporation Rat1 fibroblast-derived cell lines were seeded onto glass coverslips in 12-well plates at a density of 70, 000 cells/well. One day later, cells were incubated in the presence or absence of 4-hydroxytamoxifen (4-OHT, 500 nm) for 24 hours, and in the presence of BrdU (100 µg/ml) for the last 4 hours. WT or SIRT1 -/- MEFs were seeded onto glass coverslips in 12-well plates at a density of 45, 000 cells/well. 48 hours later, MEFs were incubated in the presence of BrdU for 4 hours. Cells were fixed in 4% formaldehyde for 15 min, permeabilized with 0.4% Triton X100 for 30 min, and incubated with 2N HCl for 10 min at 37 C. Non-specific antibody binding sites were blocked by incubation with PBS containing 8%BSA and 10% goat serum. Coverslips were then incubated with primary antibody (anti-brdu 1/500) for 2 hours, and washed five times with PBS. Coverslips were then incubated for one hour with a secondary antibody (goat anti-rat alexa: 1:350) and for 5 min with Hoechst. Coverslips were mounted in Aquamount and examined under epifluorescent illumination. For quantification, more than 1000 cells/coverslip were scored for BrdU incorporation. References for supporting online material: 1. H. Vaziri et al., Cell 107, (2001). 2. J. Luo et al., Cell 107, (2001). 3. A. Brunet et al., Cell 96, (1999).

8 Supplemental Figure 1 HA-FOXO3 - - Flag-PCAF H 2 O 2 : IP: Flag PCAF WB: HA-FOXO3 HA-FOXO3 Flag-PCAF PCAF and FOXO3 interact in response to oxidative stress stimuli: 293T cells were co-transfected with HA-FOXO3 and Flag-PCAF. Flag-PCAF was immunoprecipitated and the immune-complexes were analyzed for the presence of HA- FOXO3 by western-blot experiments using the anti-ha antibody (top panel). The levels of expression of HA-FOXO3 in the cell extracts were analyzed with the anti-ha antibody (middle panel). The levels of immunoprecipitated Flag-PCAF were analyzed with the anti- Flag antibody (bottom panel).

9 Supplemental Figure 2 A K242 K259 K271 K290 K569 Nt DNA binding NES Ct B S90 S284 S294 S300 S413 S425 T427 S574 _ UV H 2 O 2 HS P -T32 FOXO3 P -S413 FOXO3 Total FOXO3 P -S473 Akt FOXO3 phosphorylation and acetylation sites: (A) 293T cells expressing Flag-tagged FOXO3 WT were stimulated with stress stimuli. Flag-FOXO3 was purified and FOXO3 tryptic peptides were subjected to tandem mass spectrometry. FOXO3 peptides were analyzed for the presence of phosphate or acetyl groups. NES: nuclear export sequence. (B) 293T cells were stimulated with different stress stimuli (UV: ultraviolet radiation; HS: heat shock). The phosphorylation levels of endogenous FOXO3 at Thr32 (a residue which is phosphorylated by Akt) and Ser 413 (a residue which is phosphorylated in response to stress stimuli) and the phosphorylation levels of endogenous Akt at Ser 473 were analyzed by western-blot using phosphospecific antibodies.

10 Supplemental Figure 3 SIRT1: WT KO 1 IP: Acetyl-K WB: FOXO3 Tubulin kd Acetylation of FOXO3 in SIRT1 -/- MEFs. MEFs derived from WT or one line of littermate SIRT1 -/- embryos (KO 1 ) were incubated in the presence of TSA for 2 hours. Endogenous acetylated proteins were immunoprecipitated with antibodies to acetylated lysine (Upstate Biotechnology) and the presence of FOXO3 in the immune-complex was assessed by western-blot with the antibody to FOXO3 (top panel). The presence of acetylated proteins in the samples was assessed by western-blot with an antibody to tubulin (control). The molecular size markers (kd) are indicated on the right.

11 Supplemental Figure 4 4 control SIRT1 WT Luciferase/ Renilla (Fold) * 0 Active FOXO3: - + SIRT1 inhibits FOXO-dependent induction of a reporter construct under the control of a portion of the Fas ligand promoter. Fibroblasts were co-transfected with WT SIRT1 (WT) or with a the SIRT1 deacetylase-defective mutant (control), together with constructs encoding the pece empty vector (-) or the active mutant of FOXO3 (T32A/S253A/S315A active mutant, +) and a luciferase reporter construct under the control of the portion of the Fas ligand promoter containing three FOXO responsive elements. The data represent the mean and error bars of 4 independent experiments conducted in duplicate. *: statistical significance (p<0.05, ANOVA).

12 Supplemental Figure 5 - SIRT1 SIRT1 Ectopically expressed SIRT1 Endogenous SIRT1 control Generation of SIRT1 stable cell lines. Rat1 fibroblasts expressing FOXO3-ER, and infected with a control retrovirus (-) or a retrovirus encoding WT mouse SIRT1 (SIRT1) were analyzed for SIRT1 expression by western-blotting with an antibody to SIRT1 (top panel). The total level of protein expression was assessed using a control antibody (anti-mek1) (control panel).

13 Supplemental Figure 6 A BrdU incorporation (% of control) SIRT1 WT SIRT1 KO LY treatment (hours) B 20 Apoptotic Cells (%) H 2 O 2 : SIRT1: WT KO WT Cell cycle progression and cell death in SIRT1 -/- MEFs (A) Three independent lines of WT MEFs and three independent lines of SIRT1 -/- MEFs were stimulated with LY for various length of time and were incubated with BrdU for the last 4 hours of LY treatment. BrdU incorporation was measured by immunostaining and BrdU positive cells were counted. The data represent the mean and error bars of one to four repeats in three different lines of WT or SIRT1 -/- MEFs. (B) WT MEFs and SIRT1 -/- MEFs were stimulated with H 2 O 2 for 1 hour and incubated for 5 more hours in serum containing media. Apoptosis was assessed by TUNEL staining. The data presented represent the mean and error bars of three independent experiments. Similar results were obtained in another line of SIRT1 -/- MEFs. KO

14 Supplemental Figure 7 control A - H2O2: p IP: Flag-FOXO3 WB: p53 p53 Flag FOXO3 B BrdU 0.6 Incorporation (Fold) p53: +/+ +/+ -/- -/SIRT1: (A) Interaction between p53 and FOXO3 in response to oxidative stress 293T cells were co-transfected with a control empty vector (control) or a vector encoding p53, together with a vector encoding Flag-FOXO3. Cells were stimulated for 1h with 500 µm H2O2. FlagFOXO3 was immunoprecipitated with the Flag antibody and the immune-complex was analyzed by western-blot analysis using an antibody directed against p53. (B) SIRT1 induced cell cycle arrest in p53 -/- MEFs p53 +/+ or p53 -/- MEFs were infected with a control retrovirus (-) or a retrovirus expressing WT SIRT1 (+). BrdU incorporation was measured by immunostaining and BrdU positive cells were counted. Similar results were obtained in another line of p53 -/- MEFs.