ImmunoPET of murine T cell reconstitution post-adoptive stem cell transplant using anti-cd4 and anti-cd8 cys-diabodies

Transcription

1 Supplemental information for: ImmunoPET of murine T cell reconstitution post-adoptive stem cell transplant using anti-cd4 and anti-cd8 cys-diabodies Richard Tavaré, 1* Melissa N. McCracken, 2 Kirstin A. Zettlitz, 1 Felix B. Salazar, 1 Tove Olafsen, 1 Owen N. Witte, 2-5 and Anna M. Wu 1* 1 Crump Institute for Molecular Imaging, Department of Molecular and Medical Pharmacology, David Geffen School of Medicine at University of California Los Angeles (UCLA), Los Angeles, CA, USA; 2 Department of Molecular and Medical Pharmacology, David Geffen School of Medicine at UCLA, Los Angeles, CA, USA; 3 Howard Hughes Medical Institute at UCLA, Los Angeles, CA, USA; 4 Department of Microbiology, Immunology and Molecular Genetics at UCLA, Los Angeles, CA, USA; 5 Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research at UCLA, Los Angeles, CA, USA * Corresponding Authors: Richard Tavaré, PhD, California NanoSystems Institute 4350B, University of California, Los Angeles, 570 Westwood Plaza, Los Angeles, CA , Tel: , Fax: , rtavare@mednet.ucla.edu. Anna M. Wu, PhD, California NanoSystems Institute 4335, University of California, Los Angeles, 570 Westwood Plaza, Los Angeles, CA , Tel: , Fax: , awu@mednet.ucla.edu. TABLE OF CONTENTS I. Materials and Methods a. Determination of V H and V L sequences p. S2 b. Construction of Anti-CD4 and -CD8 Cys-Diabodies p. S3 c. Expression and purification of engineered cdb fragments p. S3 d. Maleimide-Alexa Fluor 488 conjugation p. S4 e. CD4 depletion p. S5 f. Flow cytometry p. S5 g. MicroPET imaging p. S5 h. Biodistribution p. S6 i. Data analysis p. S6 II. References p. S6 III. Tables S1

2 IV. a. Table S1. Ex vivo biodistribution of anti-cd4 89 Zr-malDFO-GK1.5 cdb in wild type, CD4-blocked, and CD4 depleted mice. P. 7 b. Table S2. Ex vivo biodistribution of anti-cd8 89 Zr-malDFO-2.43 cdb in wild type and CD8-blocked mice. P. 8 c. Table S3. Ex vivo biodistribution of anti-cd4 89 Zr-malDFO-GK1.5 cdb and anti-cd8 89 Zr-malDFO-2.43 cdb in the HSC model. P. 9 Figures a. Figure S1. Size exclusion chromatography of maldfo conjugated GK1.5 cdb. P. 10 b. Figure S2. Anti-CD cdb characterization. P. 11 c. Figure S3. Monitoring inguinal lymph node mass increase over time post-hsc transplant. P. 12 MATERIALS AND METHODS: Determination of V H and V L sequences from the GK1.5 hybridoma The GK1.5 hybridoma was obtained from ATCC (catalog number TIB-207) and cultured in DMEM plus 10% FetalPlex (Gemini Bio-Products) and Pen/Strep (Gibco). The parental antibody is rat anti-mouse CD4. RNA isolation, RT-PCR and sequence validation performed as previously described (1). Briefly, RNA was isolated from hybridomas grown in culture using the Quick-RNA MicroPrep TM (Zymo Research) according to the manufacturers instructions. Freshly isolated RNA was immediately used for reverse transcription-pcr (RT-PCR) using a combination of primers published in Dubel, S., et al (2). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) according to the manufacturers instructions. RT-PCR products were run on 1% Trisacetate-EDTA (TAE)-agarose gels. Bands of the correct size were extracted using the Qiagen Gel extraction kit and ligated using TOPO TA Cloning kit (Invitrogen) by following the supplier s instructions. Competent DH5α E.Coli (Invitrogen) were transformed with ligations and the resulting colonies were selected for miniprep isolation (Invitrogen) of plasmid DNA for subsequent sequencing. Sequences were analyzed with BLAST for V H or V L homology. Sequences were verified by three identical recovered sequences from at least two different experiments. V H and V L sequences exist for GK1.5 S2

3 (NCBI GenBank AAA and AAA , respectively) and were compared to the sequences from RT-PCR. Furthermore, the V L sequence has been published previously (3). Construction of Anti-CD4 and -CD8 Cys-Diabodies The anti-cd4 GK1.5 cdb construct was designed and assembled as follows: V H, a five amino acid linker (GGGGS), V L, and a C-terminal tag containing a single cysteine for site-specific conjugation and a hexahistidine sequence (AAAGCGGHHHHHH). The cdb cassette was synthesized by GeneArt (Invitrogen) and contains N-terminal AgeI and C-terminal EcoRI restriction sites for subcloning into the mammalian expression vector psectag2 (Invitrogen) with an AgeI site engineered into the vector following the Ig κ- chain leader sequence. Ligation was performed using the T4 DNA Ligase (New England Biolabs). Furthermore, a NotI site was placed after the V L and before the C-terminal Cysand His-Tags. The linker length of the anti-cd Mb in the pee12 vector (1) was reduced from 18 aa (GSTSGGGSGGGSGGGGSS) to 5 aa (GGGGS) using site directed mutagenesis (Agilent Technologies) following the manufacturers protocol using the following primers: forward 5 - GTGACAGTGTCCAGCGGTGGCGGAGGAAGCGACATCCAGCTGACACAGAGC and reverse 5 - TGTCAGCTGGATGTCGCTTCCTCCGCCACCGCTGGACACTGTCACCATCAC. PCR was then used to retain the N-terminal AgeI and introduce a C-terminal NotI site after the V L domain to add the same C-terminal tag as the GK1.5 cdb (AAAGCGGHHHHHH) by restriction digestion and ligation into the psectag2 vector. Expression and purification of engineered cdb antibody fragments 293-F cells (Life Technologies) were cultured in DMEM (Cellgro) plus 10% FetalPlex (Gemini) and 1% non-essential amino acids (Gibco). 1x10 6 cells were seeded in a 6-well plate in 2 ml medium. The next day, cells were washed once with phosphate buffered saline (PBS) and replaced with 1.66 ml of OptiMEM (Gibco). 2.7 µg DNA was added to 166 µl of OptiMEM and, in another tube, 6.7 µl Lipofectamine TM 2000 S3

4 (Invitrogen) was mixed with 166 µl OptiMEM and allowed to incubate for 5 min. The DNA and Lipofectamine dilutions were mixed, incubated for 20 min at room temperature, and the complex was added to the cells. The medium was either left for 48 hours to monitor cdb expression or changed after 6 h to fresh OptiMEM for isolation of a stable cell line expressing the cdb. For stable cell line generation, cells were diluted 1:10 in growth medium and Zeocin (300 µg/ml; InvivoGen) was added the next day. The pool of stably transfected cells was then plated in triple flasks in growth media. When 90% confluent, media was switched to OptiMEM and the supernatant harvested and media changed every 3 to 4 days for 3 weeks. For monitoring transgene expression, supernatant was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by western blot analysis using HisDetector Western Blot Kit (KPL) for detection. Soluble GK1.5 and 2.43 cdbs were purified from cell culture supernatant using NiNTA affinity chromatography (GE Healthcare) using an ÄKTA purifier FPLC. Supernatants were loaded onto the column in the presence of 10 mm imidazole at ph7.5 and eluted with a gradient of 10 to 500 mm imidazole in 50 mm sodium phosphate and 250 mm sodium chloride at ph 7.5. The purified proteins were then dialyzed against PBS using Slide-A-Lyzer dialysis cassettes (MWCO: 10,000, Thermo Scientific) and concentrated with a Vivaspin 20 (MWCO: 10,000, Sartorius). Final protein concentrations were determined by measuring UV absorbance at 280 nm. Purified proteins were analyzed by SDS-PAGE under non-reducing conditions. Native structural size was determined by Superdex 75 size exclusion column (GE Healthcare) using PBS as the running buffer. Maleimide-Alexa Fluor 488 conjugation GK1.5 and 2.43 cdbs were reduced with 15-fold molar excess of tris(2- carboxyethyl)phosphine (TCEP; Pierce) for 30 min at room temperature. A 10-fold molar excess of Alexa Fluor 488 C5-maleimide (Life Technologies; mal488) was then added and allowed to react for 2 h at room temperature. Excess dye was removed using a dye removal kit (Thermo Scientific) or PD-10 desalting columns (GE Healthcare) that were pre-equilibrated with PBS. PD-10 eluted protein was concentrated using Amicon Ultra S4

5 centrifugal filters (0.5 ml and 10 kda MWCO; Milipore) that had been washed once with PBS. Conjugation efficiency was evaluated using the NanoDrop (Thermo Scientific) to calculate the molar ratio of Alexa488 to moles protein. Conjugation efficiency was measured qualitatively by size exclusion chromatography using a Superdex 75 column on an AKTA purifier and SDS/PAGE-Coomassie stain analysis. To detect Alexa488 conjugation to the cdb, the SDS/PAGE gel of the conjugated and unconjugated cdb was placed in an AlphaImager HP transilluminator (Alpha Innotech). CD4 depletion Mice were treated for three consecutive days with 25 mg/kg of anti-cd4 depleting antibody (Clone GK1.5 purchased from UCSF Monoclonal Antibody Core) injected intraperitoneally (200 µl in saline). Two days post-treatment, mice were euthanized and single cell suspensions from the spleen, peripheral blood, thymus and lymph nodes were isolated and stained for flow cytometry as described below. Flow cytometry Flow cytometry was performed on cell suspensions from the spleen, peripheral blood, thymus and lymph nodes. Mashing organs over 75 mm and then 40 mm filters in RPMI plus 5% FBS provided single cell suspensions. Following red blood cell lysis using ACK (Ammonium-Chloride-Potassium) lysis buffer, the cells were stained for one hour on ice, washed with PBS and analyzed using a BD FACSCanto. The following antibodies were used for staining: Alexa488-conjugated 2.43 cdb, Alexa488-conjugated GK1.5 cdb, anti-cd8-pe (clone ), anti-cd8-fitc (clone ), anti-cd4-apc- Cy7 (clone GK1.5), anti-cd4-pe (clone GK1.5), anti-cd45-apc (clone 30-F11), anti- CD45.1-APC (clone A20), and anti-cd45.2-pe (clone 104; all fluorescent Abs from ebioscience). MicroPET imaging 200 µl doses containing MBq (25-35 µci, µci/µg) 89 Zr radiolabeled cdb were prepared in saline and injected i.v. into B/6 mice. At 4, 8 and 20 h post-injection, mice were anesthetized using 2% isoflurane and micropet scans were S5

6 acquired using an Inveon micropet scanner (Siemens) followed by microct scan (ImTek). MicroPET images were reconstructed using non-attenuation or scatter corrected maximum a posteriori (MAP) reconstruction and AMIDE was used for image analysis and display. MicroPET imaging was also performed on mice that were treated with a bolus injection of 3-4 mg/kg non-radiolabeled cdb in combination with the radiolabeled 89 Zr-malDFO-conjugated cdb. MicroPET imaging was also performed on B/6 mice following treatment with a depleting anti-cd4 antibody (see above for depletion protocol). In addition, micropet imaging was performed on mice at 2, 4, and 8 weeks post-hsc transplant. Biodistribution At 22 h post-injection, mice were euthanized, the organs and blood were collected, weighed and the radioactivity was counted. The percent-injected dose per gram of tissue (%ID/g) was calculated using a standard containing one percent of the injected dose. Data analysis. Data values are reported as mean ± SD. Statistical analysis was performed using a two-t led Student t-test. Ex vivo biodistributions of 89 Zr-radiolabeled cdbs in blocked B/6 mice and CD4 depleted B/6 mice were compaired to the wild type B/6 mice individually. MicroPET/CT images are displayed as 2 or 25 mm transverse or coronal maximum intensity projections (MIPs). REFERENCES: 1. Tavaré R, McCracken MN, Zettlitz KA, et al. Engineered antibody fragments for immuno- PET imaging of endogenous CD8+ T cells in vivo. Proc Natl Acad Sci U S A. 2014;111: Dubel S, Breitling F, Fuchs P, et al. Isolation of IgG antibody Fv- DNA from various mouse and rat hybridoma cell lines using the polymerase chain reaction with a simple set of primers. J Immunol Methods. 1994;175: Brady JL, Corbett AJ, McKenzie BS, Lew AM. Rapid specific amplification of rat antibody cdna from nine hybridomas in the presence of myeloma light chains. J Immunol Methods. 2006;315: S6

7 Supplemental Table 1. Ex vivo biodistribution of anti-cd4 89 Zr-malDFO-GK1.5 cdb in wild type, CD4-blocked, and CD4 depleted mice at 22 hr post-injection. Organ Wild Type B/6 (n=3) %ID/g B/6 + CD4-Block (n=4) B/6 + CD4- Depletion (n=4) Blood 0.33 ± ± 0.05* 0.58 ± 0.08 Inguinal LNs 45 ± ± ± 1.1 Axillary LNs 45 ± ± ± 0.67 Mesenteric LNs 46 ± ± ± 0.69 Cervical LNs 56 ± ± ± 1.5 Spleen 30. ± ± ± 0.33 Thymus 2.7 ± ± 0.15* 1.3 ± 0.05* Bone 3.6 ± ± ± 0.36 Stomach 1.6 ± ± ± 0.54 Intestines 3.1 ± ± 0.68* 1.7 ± 0.43* Liver 11 ± ± ± 1.3 Kidneys 117 ± ± ± 18 Heart 1.8 ± ± 0.19* 1.6 ± 0.14 Lungs 2.4 ± ± 0.33* 1.9 ± 0.18* Muscle 0.72 ± ± ± 0.04 Carcass 1.3 ± ± 0.11* 1.0 ± 0.07 Ratios Inguinal LNs:Blood 137 ± ± ± 2.9 Spleen:Blood 91 ± ± ± 1.2 Values are represented as mean ± standard deviation. * p<0.05, p<0.005, p< S7

8 Supplemental Table 2. Ex vivo biodistribution of anti-cd8 89 Zr-malDFO-2.43 cdb in wild type and CD8-blocked mice at 22 hr post-injection. Organ Wild Type B/6 (n=4) %ID/g B/6 + CD8-Block (n=4) Blood 0.61 ± ± 0.15* Inguinal LNs 47 ± ± 1.4 Axillary LNs 44 ± ± 1.4 Mesenteric LNs 35 ± ± 0.65 Cervical LNs 44 ± ± 5.5 Spleen 41 ± ± 1.6 Thymus 5.6 ± ± 0.38 Bone 4.0 ± ± 0.64 Stomach 1.6 ± ± 0.17* Intestines 3.6 ± ± 0.16* Liver 6.2 ± ± 0.68 Kidneys 78 ± ± 5.9 Heart 2.3 ± ± 0.27 Lungs 2.1 ± ± 0.06 Muscle 0.88 ± ± 0.14 Carcass 1.5 ± ± 0.16 Ratios Inguinal LNs:Blood 78 ± ± 4.1 Spleen:Blood 67 ± ± 2.0 Values are represented as mean ± standard deviation. * p<0.05, p<0.005, p< S8

9 Supplemental Table 3. Ex vivo biodistribution at 22 hr post-injection of anti-cd4 89 Zr-malDFO- GK1.5 cdb and anti-cd8 89 Zr-malDFO-2.43 cdb in the HSC model. %ID/g 89 Zr-malDFO-GK1.5 cdb 89 Zr-malDFO-2.43 cdb Organ 2 wk post- HSC Tx (n=4) 4 wk post- HSC Tx (n=3) 8 wk post- HSC Tx (n=3) 2 wk post- HSC Tx (n=3) 4 wk post- HSC Tx (n=4) 8 wk post- HSC Tx (n=3) Blood 0.30 ± ± ± ± ± ± 0.10 Axillary LNs 75 ± ± ± ± ± ± 4.5 Cervical LNs 80. ± ± ± ± ± ± 4.6 Spleen 16 ± ± ± ± ± ± 0.34 Thymus 3.2 ± ± ± ± ± ± 1.9 Bone 4.5 ± ± ± ± ± ± 0.19 Stomach 1.1 ± ± ± ± ± ± 0.22 Intestines 2.9 ± ± ± ± ± ± 0.30 Liver 6.9 ± ± ± ± ± ± 0.46 Kidneys 77 ± ± ± ± ± ± 1.6 Heart 1.5 ± ± ± ± ± ± 0.15 Lungs 2.4 ± ± ± ± ± ± 0.21 Muscle 0.42 ± ± ± ± ± ± 0.02 Carcass 1.0 ± ± ± ± ± ± 0.05 S9

10 % of max absorbance (mau) GK1.5 cdb maldfo- GK1.5 cdb Time (min) Figure S1. Size exclusion chromatography of maleimide-dfo conjugation to anti-cd4 GK1.5 cdb. Reference arrows indicate albumin (66 kda) at 20.8 min, carbonic anhydrase (29 kda) at 24.7 min, and cytochrome C (12.4 kda) at 27.4 min S10

11 A! C! kda - 80 kda - 60 kda - 50 kda - 40 kda - 30 kda - 20 kda - 15 kda - 10 kda - L 1 2 L 1 2 B! 2.43 cdb % of max absorbance (mau) Time (min) 2.43 cdb mal cdb 280 nm mal cdb 488 nm % of max absorbance (mau) maldfo-2.43 cdb Time (min) Figure S2. Anti-CD cdb characterization. (A) SDS/PAGE gel (left panel) of purified 2.43 cdb (Lane 1) and mal488 conjugated 2.43 cdb (Lane 2) for fluorescent flow cytometry binding assays. The UV image (right panel) of the same gel shows mal488 conjugated to 2.43 cdb. Size exclusion chromatography of mal488 (B) and maldfo (C) conjugation to anti-cd cdb demonstrated thiol-specific conjugations did not disrupt the diabody conformation. Reference arrows indicate albumin (66 kda) at 20.8 min, carbonic anhydrase (29 kda) at 24.7 min, and cytochrome C (12.4 kda) at 27.4 min S11

12 2 wk 4 wk Cell number (x105) B!25 Total CD4 CD wk C! 2.5 LN weight (mg) A! wk 4 wk 8 wk 2 wk 4 wk 8 wk Figure S3. Monitoring inguinal lymph node mass increase over time post-hsc transplant. (A) Representative CT scans of C57BL/6 mice at two, four, and eight weeks post-hsc transplant demonstrate inguinal lymph node (white arrow) growth over time. (B) Ex vivo weights of inguinal lymph nodes at two, four and eight weeks post-hsc transplant (n = 8, 8, and16, respectively). (C) Estimated number to total cells, CD4+ T cells, and CD8+ T cells from measured weights (1x106 cells/mg tissue) and flow cytometry analysis of CD4+ and CD8+ T cell percentages at different times post-hsc transplant. S12 THE JOURNAL OF NUCLEAR MEDICINE Vol. 56 No. 8 August 2015 Tavaré et al.