Supplementary Materials for

Transcription

1 Supplementary Materials for ameliorates liver steatosis by decreasing stearoyloa desaturase 1 (S1) abundance and altering hepatic lipid metabolism Fei Xiao, Jiali eng, Yajie Guo, Yuguo Niu, Feixiang Yuan, Junjie Yu, Shanghai hen, Feifan Guo The PF file includes: orresponding author. ffguo@sibs.ac.cn Published 17 May 216, Sci. Signal. 9, ra5 (216) OI: /scisignal.aad8581 Fig. S1. Overexpression of decreases triglyceride content in vivo and in vitro. Fig. S2. Knockdown of by Adsh or sirna increases triglyceride content in vitro. Fig. S3. The effects of on the expression of genes encoding lipidmetabolizing enzymes in muscle and white adipose tissue. Fig. S4. The effects of on lipid metabolism in the liver. Fig. S5. suppresses S1 in vitro and knockdown of and S1 in vivo. Fig. S6. Lack of an interaction between and SREP1. Fig. S7. overexpression attenuates ATF4stimulated increase in S1 mrna and protein abundance in vitro. Fig. S8. ATF4 overexpression exacerbates liver steatosis in db/db mice. Fig. S9. regulates S1 abundance through ATF4. Fig. S1. The effects of on the expression of genes and abundance of proteins related to ER stress and regeneration and on NF activity. Fig. S11. Gene expression in the livers of transgenic mice on an H. Fig. S12. The possible link between and the mtors6k1 pathway. Fig. S13. S6K1 regulates abundance through RE. Table S1. Metabolic parameters in wildtype mice injected or not with Ad. Table S2. Metabolic parameters in wildtype mice injected or not with Adsh. Table S3. Liver and serum fatty acid composition in wildtype mice injected or not with Adsh. Table S4. List of oligonucleotide primer pairs used in RTPR analysis.

2 Ad WT db/db WT db/db SO TG (mg/g protein) 2 1 SO # Figure S1. Overexpression of decreases triglyceride content in vivo and in vitro. (A) abundance was analyzed in the livers of male 57L/6J WT and leptin receptormutated (db/db) mice. ( and ) HepG2 cells were transfected with control vectors or tagged for 48 h and incubated with 2 μm sodium oleate ( SO) or control vehicle ( SO) for 24 h. protein () and triglyceride (TG) contents () were determined. Means ± SEM are representative of at least two independent in vivo experiments, with 5 7 mice in each group in each experiment in (A), or at least three independent experiments in () and (). Statistical significance was calculated using the oneway ANOVA followed by the StudentNewmanKeuls test for the effects of any group compared to the control group ( : p<.5), with compared to without the plasmids expressing in SO treatment group ( # : p<.5) in. A Adsh Adsh Adsh (A.U.) TG (mg/g protein) 2 si si si (A.U.) TG (mg/g protein) Figure S2. Knockdown of by Adsh or sirna increases triglyceride content in vitro. (A to ) HepG2 cells were infected with Adscrambled or Adsh or transfected or not with si for 72 h. protein abundance (top, western blot; bottom, quantitative measurement of protein relative to actin) (A and ) and triglyceride (TG) content ( and ) were determined. Means ± SEM for (A) to () are representative of at least three independent experiments. Statistical significance was calculated using the twotailed Student ttest for the effects of knockdown compared to control group ( : p<.5).

3 AdGFP Ad Lipogenesis Uptake Oxidation Secretion Fas Scd1 Acc1 Srebp1c Me Gpat hrebp Pparr Srebp2 Hmgcs2 d36 Fabp Ppara pt1a Apo ApoE Adscr Adsh Lipogenesis Uptake Oxidation Secretion 2 1 Fas Scd1 Acc1 Srebp1c Me Gpat hrebp Pparr Srebp2 Hmgcs2 d36 Fabp Ppara pt1a Apo ApoE AdGFP Ad Lipogenesis Uptake Oxidation Secretion Fas Scd1 Acc1 Srebp1c Me Gpat hrebp Pparr Srebp2 Hmgcs2 d36 Fabp Ppara pt1a Apo ApoE Adscr Adsh Lipogenesis Uptake Oxidation Secretion 2 1 Fas Scd1 Acc1 Srebp1c Me Gpat hrebp Pparr Srebp2 Hmgcs2 d36 Fabp Ppara pt1a Apo ApoE Figure S3. The effects of on the expression of genes encoding lipidmetabolizing enzymes in muscle and white adipose tissue. (A to ) Male 57L/6J WT mice were injected with AdGFP or Ad, or Adscrambled (Adscr) or Adsh, as indicated. The indicated mrna in the soleus muscle (A and ) and white adipose tissue ( and ) was measured. Means ± SEM in (A) to () are representative of at least two independent in vivo experiments, with 5 7 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Ad or Adsh compared to the control group (: p<.5).

4 Liver lipogenic index (16:/18:2n6) Serum 3H (mm) Adsh Ad Adsh Serum 3H (mm) Fatty Acid Uptake (%) Serum TG (mg/dl) (h) AdGFP Ad E Relative Scd1 mrna (%) F Ad S1 S1 (A.U.) 15 1 Ad Ad 5 G Liver S1 activity (16:1n7/16:) Adscr H Liver S1 activity (18:1n9/18:) Adsh Figure S4. The effects of on lipid metabolism in the liver. (A,,, G and H) Male 57L/6J WT mice were injected with Adscrambled (Adscr) or Adsh, or AdGFP or Ad, as indicated. Mice were analyzed for lipogenic index in (A), serum 3H concentration in (), VLL secretion in (), and S1 activity in (G) and (H). () HepG2 cells transfected with plasmids expressing ( ) or control vector ( ) were analyzed for fatty acid uptake. (E and F) Male db/db mice were injected with AdGFP or Ad and analyzed for Scd1 expression (E) and protein abundance (F). Means ± SEM are representative of at least two independent experiments for (A), () and () to (H) with 5 7 mice in each group in each experiment, or at least three independent experiments for (). Statistical significance was calculated using the twotailed Student ttest for the effects of Ad or Adsh compared to the control group in (A), () and () to (H), overexpression compared to the control group in () (: p<.5). A si S1 A.U si si S1 Adsh AdshS1 S1 Figure S5. suppresses S1 in vitro and knockdown of and S1 in vivo. (A) Primary hepatocytes were transfected with control or sirna. The abundance of and S1 was determined. () Male 57L/6J WT mice were injected with Adscrambled, Adsh, and/or AdshS1, as indicated. Mice were

5 analyzed for and S1 abundance. Means ± SEM are representative of at least three independent experiments in (A), or at least two independent experiments, with 5 7 mice in each group in each experiment in (). Statistical significance was calculated using the twotailed Student ttest for the effects of sirna compared to the control group in A (: p<.5). A SREP1 βgal IP: SREP1 SREP1 IP:SREP1 SREP1 Input SREP1 Input SREP1 Ad SREP1 Adsh SREP1 SREP1 (A.U.) SREP1 (A.U.) Ad Adsh Figure S6. Lack of an interaction between and SREP1. (A) HEK 293T cells were cotransfected with tagged plasmid, SREP1 plasmid, and/or betagalactosidase plasmids for 24 h. Immunoprecipitation (IP) and immunoblotting were performed using the antibodies indicated. () HEK 293T cells were cotransfected with SREP1 plasmid withor without tagged plasmid for 24 h. Immunoprecipitation (IP) and immunoblotting were performed using the antibodies indicated. ( and ) Male 57L/6J WT mice were injected with AdGFP or Ad, or Adscrambled or Adsh, as indicated. SREP1 protein abundance was determined (top, western blot; bottom, quantitative measurements of SREP1 protein relative to actin). Means ± SEMs are representative of at least three independent experiments for (A) and (), and at least two independent experiments, with 5 7 mice in each group in each experiment in () and (). Statistical significance was calculated using the twotailed Student ttest for the effects of Ad or Adsh compared to the control group ( : p <.5).

6 FLAG GFP IP:FLAG Input FLAG FLAG Ad AdATF4 ATF4 S1 Ad AdATF4 ATF4 IgG RE Primers N Primers RE Primers N Primers Input RE Primers N Primers Relative Scd1 mrna (%) Ad AdATF4 # E Ad AdATF4 ATF4 S1 2 1 Ad S1 (A.U.) AdATF4 # Figure S7. overexpression attenuates ATF4stimulated increases in S1 mrna and protein abundance in vitro. (A) HEK 293T cells were cotransfected with FLAGtagged plasmid with or without GFP plasmid for 24 h. Immunoprecipitation (IP) and immunoblotting were performed using the antibodies indicated. () Primary hepatocytes were infected with AdGFP, Ad, and/or AdATF4. S1 protein abundance was assessed. () hip assay was performed in primary hepatocytes infected with AdGFP, Ad, and/or AdATF4, as indicated. Immunoprecipitation was conducted with antiatf4 antibody or control IgG, and PR was amplified from the immunoprecipitates and inputs with primers containing a RE binding site (RE primers) or an negative control, upstream region without a RE binding site (N primers). ( and E) Primary hepatocytes were infected with AdGFP, Ad, and/or AdATF4 for 48 h. Scd1 expression () and S1 protein abundance (E) was assessed (left, western blot; right, quantitative measurement of S1 protein relative to actin). ata were obtained with at least three independent experiments in (A) to (E), are presented as means ± SEM. Statistical significance was calculated using the oneway ANOVA followed by the StudentNewmanKeuls test for the effects of any group compared to the control group ( : p<.5) and to compare Adinfected hepatocytes with Ad and AdATF4infected hepatocytes ( # : p<.5) in () and (E).

7 AdATF4 ATF4 AdGFP AdATF4 Oil Red O AdGFP AdATF4 ATF4 (A.U.) 4 2 H&E Liver TG (mg/g) Liver T (mg/g) Liver FFAs (μmol/g) Serum TG (mg/dl) 2 1 Serum T (mg/dl) Serum FFAs (mmol/l) Figure S8. ATF4 overexpression exacerbates liver steatosis in db/db mice. Male 57L/6J db/db mice injected with AdGFP or AdATF4 were analyzed for ATF4 protein abundance (A), hepatic staining with Oil Red O or HematoxylinEosin (H&E) () (scale bars, 1 μm), liver () or serum () triglycerides (TG), total cholesterol (T), or free fatty acids (FFAs). Means ± SEM are representative of at least two independent experiments, with 5 7 mice in each group in each experiment in (A), (), and (). Images in () are representative of 5 mice in each group. Statistical significance was calculated using the twotailed Student ttest for the effects of AdATF4 compared to the control group (: p<.5). Ad AdATF4 ATF4 S1 Figure S9. regulates S1 abundance through ATF4. Primary hepatocytes were infected with AdGFP, Ad and/or AdATF4. S1 abundance were assessed. Means ± SEMs are representative of at least three independent experiments.

8 Ad pire1α IRE1α pperk PERK pelf2α elf2α Adsh A.U AdGFP Ad pireα pperk peif2α pire1α IRE1α pperk PERK pelf2α elf2α A.U Adscr Adsh pireα pperk peif2α E AdGFP Ad tg1 ip Atf6 Xbp1s AdGFP Ad Pcna yclind1 Hgf Tgf F Adscr Adsh tg1 ip Atf6 Xbp1s Adscr Adsh Pcna yclind1 Hgf Tgf G Luciferase Activity (%) Foxo3a Figure S1. The effects of on the expression of genes and abundance of proteins related to ER stress and regeneration and on NFκ activity. (A to F) Male 57L/6J WT mice were injected with AdGFP or Ad, or Adscrambled (AdScr) or Adsh, as indicated. The abundance of the indicated mrna and the proteins in the liver were determined. (G) Luciferase activity was assessed in HEK293T cells transfected with the plasmids expressing an NFκdriven reporter, tagged, FOXO3a TM, or empty vectors pna3.1 for 24 h. Means ± SEM shown are representative of at least two independent experiments, with 5 6 mice in each group in each experiment in (A) to (F), or at least three independent experiments in (G). Statistical significance was calculated using the twotailed Student ttest for the effects of Ad or Adsh compared to the control group in (A) to (F), the effects of or FOXO3a TM overexpression compared to the control group in (G) (: p<.5). A WT Tg WT Tg H H Fas hop Fas Scd1 Figure S11. Gene expression in the livers of transgenic mice on an H. (A) Fas and hop expression were analyzed in the livers of 57L/6J WT and

9 Tg mice on a normal chow diet. () Fas and Scd1 expression were analyzed in the livers of male 57L/6J WT and Tg mice fed a H. Means ± SEM are representative of at least two independent experiments with 5 7 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Tg compared to control mice (: p<.5). A Ad pmtor Adsh pmtor mtor ps6k1 mtor ps6k1 S6K1 ps6 S6K1 ps6 S6 S6 A.U pmtor ps6k1 ps6 HepG2 AS6K1 HA AdGFP Ad A.U AdshS6K1 AS6K1 pmtor ps6k1 ps6 HepG2 Adscr Adsh ps6 S6K1 S6 (A.U.) AS6K1 (A.U.) 2 1 AdshS6K1 AS6K1 3 # Figure S12. The possible link between and the mtors6k1 pathway. (A and ) Male 57L/6J WT mice were injected with AdGFP or Ad, or Adscrambled (Adscr) or Adsh, as indicated. The phosphorylation of mtor, S6K1 and S6 was determined (top, western blot; bottom, quantitative measurements of pmtor, ps6k1 and ps6 proteins relative to their total protein). ( and ) HepG2 cells were transfected with control vectors or HAtagged constitutively active S6K1 () or infected with Adscrambled (Adscr) or AdshS6K1 (). abundance was determined (top, western blot; bottom, quantitative measurements of protein relative to actin). Means ± SEM shown are representative of at least three independent experiments for () and () or at least two independent experiments for (A) and (), with 57 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Ad or Adsh compared to the control group in (A) and (), AS6K1 compared to the control group in () ( : p<.5). Statistical significance was calculated using the oneway ANOVA followed by the StudentNewmanKeuls test for the effects of any group compared to the control group ( : p<.5), or to compare HepG2 cells infected with AS6K1 and AdshS6K1 compared to cells infected with AdshS6K1 only ( # : p<.5) in ().

10 #2 sire #2 sire reb tg1 AS6K1 #1 sire HA RE AS6K1 #2 sire S6K1 RE (A.U.) AS6K1 #2 sire # Figure S13. S6K1 regulates abundance through RE. (A) Primary hepatocytes transfected or not with RE sirna were analyzed for tg1 expression. ( and ) abundance was determined in primary hepatocytes transfected with RE sirna and AS6K1. Means ± SEM are representative of at least three independent experiments. Statistical significance was calculated using the twotailed Student ttest for the effect of RE sirna compared to the control group in (A), (: p<.5), or oneway ANOVA followed by the StudentNewmanKeuls test for the effects of any group compared to control group (: p<.5), or to compare hepatocytes transfected with RE sirna and AS6K1 to those transfected with AS6K1 only ( # : p<.5) in ().

11 Table S1 Metabolic parameters in WT mice injected with or without Ad Parameter Ad Ad Food intake (g) 5.14± ±.41 ody Weight (g) 27.63± ±.38 Liver weight / body weight (%) 7.24± ±.1 White adipose tissue weight / body weight (%).74±.5.85±.8 Soleus muscle weight / body weight X 1 2 (%) 4.75± ±.32 lood glucose (mg/dl) 156.± ±4.71 Serum Insulin (ng/ml).26±.2.21±.1 Table S1. Metabolic parameters in wildtype mice injected or not with Ad. Male 57L/6J WT mice were injected with AdGFP or Ad. Means ± SEM shown are representative of at least two independent in vivo experiments, with 5 7 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Ad compared to the control group (: p<.5). Table S2 Metabolic parameters in WT mice injected with or without Adsh Parameter Adsh Adsh Food intake (g) 4.64± ±.33 ody Weight (g) 25.29± ±.46 Liver weight / body weight (%) 8.54± ±.18 White adipose tissue weight / body weight (%).41±.4.45±.1 Soleus muscle weight / body weight X 1 2 (%) 4.42± ±.18 lood glucose (mg/dl) ± ±3.32 Serum Insulin (ng/ml).33±.2.6±.11 Table S2. Metabolic parameters in wildtype mice injected or not with Adsh. Male 57L/6J WT mice were injected with Adscrambled or Adsh. Means ± SEM shown are representative of at least two independent in vivo experiments, with 5 7 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Adsh compared to the control group (: p<.5).

12 Table S3 Liver and serum fatty acid composition in WT mice injected with or without Adsh Fatty acid Liver Serum Adsh Adsh P Adsh Adsh P 14:.16±.1.2± ±.2.3± :.9±.3.7± ±.1.1± : 2.35± ± ± ± :1n9.38±.3.43± ±.4.44± :1n7 1.9± ± ± ± :.29±.4.23± ±.1.2± : 13.91± ± ± ± :1n9 1.49± ± ± ± :1n7 2.38± ± ± ± :2n ± ± ± ± :3n3.5±.3.45± ±.5.77± :3n6.21±.2.22± ±.2.25± :.37±.2.42± ±.1.36±.1.7 2:1n9.43±.1.47± ±.6.46± :2n6.38±.1.33± ±.1.26± :3n6 1.85± ± ± ± :4n6 14.1± ± ± ± :5n3.89±.3.94± ± ± :.33±.3.36± ±.2.24± :4n6.28±.3.27± ±.1.19± :5n6.21±.4.2± ±.2.18± :5n3.67±.6.82± ±.4.51± :6n ± ± ± ± :.16±.1.14± ±.1.11± :.28±.2.3± ±.2.17± :1n9.34±.1.27± ±.6.3± Table S3. Liver and serum fatty acid composition in wildtype mice injected or not with Adsh. Male 57L/6J WT mice were injected with Adscrambled or Adsh. Means ± SEMs shown are representative of at least two independent in vivo experiments, with 57 mice in each group in each experiment. Statistical significance was calculated using the twotailed Student ttest for the effects of Adsh compared to the control group (: p<.5).

13 List of oligonucleotide primer pairs used in RTPR analysis Table S4 Target Gene Forward Primer (5 3 ) Reverse Primer (5 3 ) MmuGapdh TGTGTGTGTGGATTGA TGTTAATTTTGAT Mmutg1 GGTTAGTTGTATTGATA TGGGTGTGTAAT MmuFas AGGTGGTGATAGGGTATGT TGGGTAATATAGAGAG MmuScd1 GGATAATTGGTGTA AGGGAAAAGGATATT MmuAcc1 TGAAGATGATGAGAGAAAG TGGAGAGAAAA MmuSrebp1c GGAGATGGATTGAATT GGGGGAAGTATGT MmuMe GGGTTATTTTTG TTTGTATGATTTGAAATTTT MmuGpat AGAAGTTGGTATAT TGTGTGGGTGATTGTGA MmuPparγ TGGTTGATGAATAA GAGGTTTTTGAGGAAT Mmuhrebp TATTATGTGTA AAGGGGTTGTTGTTTGG MmuSrebp2 GTTGAATTTTAT AGATGATAGTGA MmuHmgcs2 GGTGTGTTAATGGAGA AAAGGATTAAGAGG Mmud36 TGGTAAGAGTAGAAA AGTTATTTAGA MmuFabp ATGAATTTGGAAGTA GGTTGGGAGATAT MmuPparα TTGTGGGTATGTTTG AATATGTAGGGTA Mmupt1a GGAAGTGTGGAGATA TGTTGATTGTAAGT MmuApo GTGGGTAGATTTA TAAGTATTTTGTTTG MmuApoE GTGGGTGAGAGTTT TGGTAGTTTTGTGTGAT MmuAtf4 MmuTrb3 Mmuhop MmuS6k1 Mmuip MmuXbp1s MmuXbp1t MmuAtf6 MmuPcna Mmuyclind1 MmuHgf MmuTgf Mmureb TGAAAGGAAGTGTTGG TGTTTGGGATAA AGGAGAGGGAAA GTGGGATTTGTGTA ATTGGGGAATATTT TGAGTGAATAGGTGAG TGGGGGTTGTGAGTG GGTAAGATGTGTT TTTGAGGAGTGAT AGAGTTAGAAAGATT ATGTGGGGGAAAATTTG ATTGGGTAGTGGGTG GAAGAAGAGAGGAAGAGA TGGAGAAATGAGGTTTAA AGTTGTTTAAGT TTGGAGAGGAGGGTTT TGGGATTGGAAAT ATGAA TAGAGT GTATGGGAAGATGTTTGG GTATGGGAAGATGTTTGG GTGTGATATAAGGAAAGG GGAGAGTGAGAGAGTAT ATAATAGAGGAAA GGATGGGAATGAAGAG AAGGTGATAATGAGGAAG TTTTGTGTTGTT Table S4. List of oligonucleotide primer pairs used in RTPR analysis.