Hepadnavirus Reverse Transcription Initiates within the Stem-Loop of the RNA Packaging Signal and Employs a Novel Strand Transfer

Transcription

1 JOURNAL OF VIROLOGY, June 1994, p X/94/$ Copyight 1994, Ameican Society fo Micobiology Vol. 68, No. 6 Hepadnavius Revese Tansciption Initiates within the Stem-Loop of the RNA Packaging Signal and Employs a Novel Stand Tansfe JOHN E. TAVIS,' SILVIA PERRI,' AND DON GANEM1,2,3* Depatments of Micobiology and Immunology' and Medicine2 and Howad Hughes Medical Institute,3 Univesity of Califomia San Fancisco, San Fancisco, Califomia Received 27 Decembe 1993/Accepted 16 Febuay 1994 Replication of the hepadnavius genome occus by evese tansciption of an RNA pegenome and is mediated by the vial polymease; the polymease is also equied fo packaging of the pegenome though inteaction with the RNA packaging signal, e. Pevious wok suggested that evese tansciption of minus-stand DNA initiates within the sequence element DR1 (diect epeat 1) and that disuption of DR1 activates a cyptic initiation site in a downsteam copy of. Howeve, using active duck hepatitis B vius polymease expessed in a yeast Ty vecto system, we demonstate that synthesis of minus-stand DNAs with 5' ends at DR1 equies the stem-loop of, wheeas the poduction of DNAs mapping to E does not equie DR1. Mutations at that emove homology between and DR1 eliminate evese tanscipts with 5' ends in DR1, and estoing homology at DRI to a mutant patially estoes DNAs mapping to DR1. Insetions of one nucleotide into the bulge egion of the stem-loop incease the length of minus-stand DNA whose 5' ends map to DRI by one nucleotide. Thus, vey shot minus-stand pimes ae initiated within E, athe than in DR1 as peviously supposed; they ae then tansfeed to a fou-nucleotide homology in DR1. Tansfe was also obseved in vivo duing eplication of duck hepatitis B vius in avian cells; in this case, tansfe is fom the 5' copy of to the 3' copy of DR1. This minus-stand tansfe eaction is likely to be a geneal featue of all hepadnaviuses. The hepadnaviuses ae unique among the animal DNA viuses in that they eplicate though evese tansciption of an RNA intemediate (19). The evese tansciption mechanism of these viuses is highly distinctive and diffes in many impotant espects fom the well-established paadigm of RNA-diected DNA synthesis found in etoviuses and many etotansposons. Fo example, hepadnaviuses employ a potein athe than a trna pime fo the fist (minus)-stand DNA synthesis; second (plus)-stand piming involves the cleavage and tanslocation of a capped RNA pime, and the esulting DNA poduct is cicula athe than linea (eviewed in efeences 8 and 13). Despite limited sequence homologies to its etovial countepats, the hepadnavius polymease (P) is also vey distinctive. P itself is the pime fo minus-stand synthesis (3, 5, 21) and, unlike othe evese tansciptases, is equied fo packaging of the RNA pegenome into the vial coes (2, 9). Thus, a fulle undestanding of hepadnavius eplication should contibute impotantly to ou undestanding of the divesity of RNA-diected DNA synthesis. In this epot, we examine the natue of minus-stand initiation in the duck hepatitis B vius (DHBV). The cuent view of this pocess is outlined in schematic fom in Fig. 1. The RNA template fo the eaction is a teminally edundant RNA of 3.3 kb that is geneated by ead-though tansciption fom the cicula vial DNA. Included in the teminal edundancy ae two impotant cis-acting motifs: (i) c, an RNA stem-loop stuctue equied fo RNA packaging (10, 11, 15); and (ii) diect epeat 1 (DR1), a 12-nucleotide (nt) element thought to be impotant in minus-stand initiation. As noted above, pegenomic RNA encapsidation equies both P and the E * Coesponding autho. Phone: (415) Fax: (415) RNA taget site. Impotantly, although E is pesent twice in genomic RNA, only the 5' copy is functional in encapsidation (10, 11): deletion of the 5' ablates RNA packaging and DNA poduction, while deletion of the 3' allows both eactions to poceed (17). Following encapsidation, minus-stand DNA is synthesized. The 5' end of minus-stand DNA maps within DR1 (nt 2537) (7, 12, 14), and deletions of DRI geatly educe vial DNA synthesis (7, 17); these and othe data have suggested that DR1 is the pincipal initiation site fo minusstand synthesis. Thee ae two copies of DR1 on the RNA template; examination of genetically maked hepadnaviuses has suggested that only the 3' copy is functional in evese tansciption (17). On the basis of these esults, the evese tansciption eaction is classically depicted as initiating within the 3' copy of DR1 (Fig. 1, step 2). A detailed undestanding of the biochemisty of the hepadnavius evese tansciption mechanism has been geatly hampeed by the fact that active P cannot be solubilized fom vial coes (16) and that P has been difficult to expess in an enzymatically active fom in heteologous systems (1). We have ecently succeeded in expessing active DHBV P in yeast cells, using the etotansposon Ty as a vecto (20). In this system, P is expessed as a fusion potein with the TyA stuctual potein (DP, analogous to a etovial gag-pol fusion) and is packaged along with its chimeic Ty-DHBV mrna into a vius-like paticle (VLP). The encapsidated RNA contains both DR1 and at its 3' end. Expession of this clone in yeast cells esults in the synthesis of potein-linked minus-stand DHBV DNA templated by this tanscipt. Pime extension analysis of the poduct DNA indicates that the 5' ends map to two stat sites: the coect position (nt 2537) within DR1 and a cyptic site (nt 2576) within a 6-nt bulge in the stem-loop (20). Vial DNAs oiginating at this cyptic site Downloaded fom on Septembe 26, 2018 by guest 3536

2 VOL. 68, 1994 INITIATION OF HEPADNAVIRUS REVERSE TRANSCRIPTION 3537 R R 1. Cap -m m-m-<-an 2. cap-m_s-- m-m 3. Cap EI-JS < --m 4- Cap m z' ~~~~~~~~Cap -913 l Downloaded fom Cap- FIG. 1. Classical hepadnavius evese tansciption mechanism. Pegenomic RNA (dashed line; step 1) is capped and polyadenylated and has a lage teminal edundancy (R). The locations of DR1 and DR2 ae indicated with numbeed boxes, and the stem-loops ae diagammed. Pegenomic RNA is packaged into coes along with polymease (P; shaded oval) though inteaction with c. P initiates evese tansciption at the 3' DR1 (step 2), and the DNA is extended. The pegenomic RNA is degaded by the RNase H activity of P (step 3) until P eaches the 5' end of the template, whee it leaves an RNA oligome annealed the 5' copy of a shot teminal duplication in minus-stand DNA (; step 4). The RNA oligome is tansfeed to DR2, whee it pimes plus-stand DNA synthesis (lowe solid line; step 5). Duing elongation, a second template tansfe ciculaizes the genome and the plus-stand is extended fo a vaiable length (step 6) to yield matue pogeny vial DNA. had been peviously obseved in DHBV-infected cells, but only when DR1 was deleted and then only at low levels (7). The significance of these species mapping within was unclea, since the 3' copy of was known to be dispensable fo evese tansciption in vivo. Howeve, all in vivo analyses of this matte ae complicated by the fact that a second copy of the sequences must be peseved at the 5' end of the genome to allow genomic RNA packaging. Ou Ty-polymease fusion system is not dependent on fo packaging eithe the polymease o its RNA template. We theefoe used this system to analyze the cis equiements fo initiation of minus-stand DNA in the absence of a wild-type copy of these signals. Hee we show that the oigin of evese tansciption is within the stem-loop of and not within DR1 as was peviously believed. Nascent chains initiated within c ae tansfeed to DR1, whee they ae extended to thei matue length. Although the sequences used in the Ty system ae supplied fom the 3' position, in authentic DHBV eplication it is the 5' copy of these sequences that is the functional oigin. These data, and simila ecent esults independently obtained by Wang and Seege (22), adically alte ou view of the ealy events in hepadnavius DNA synthesis. MATERIALS AND METHODS Plasmid constuction. ptybdp is a yeast shuttle expession plasmid containing the DHBV3 P gene within a galactoseinducible Tyl element (20). ptybdp-dll was ceated by deletion loop mutagenesis of ptybdp to emove DHBV nt 2531 to All othe mutant deivatives of ptybdp wee constucted by PCR; the mutant fagments wee sequenced and inseted into ptybdp-dll by standad techniques. Plasmids constucted to analyze the initiation sites contain the mutation DRM1 (nt 2533 to 2537, ATTAC to CACGT) o DRM2 (nt 2533 to 2535, ATT to TCC), dlbulge (nt 2572 to 2576 deleted), SLM2 (nt 2572 to 2576, TlT'AC to CACGT, ceating a PmlI site), SLM5 (A2575G), SLM6 (T2574C), SLM8 (inset C afte nt 2575), o SLM9 (inset A afte nt 2575). These mutations wee intoduced singly o in combination, as indicated in the constuct name. Alteations at DR1 and the stem-loop of wee combined by use of a HindIII site ceated between these elements by mutating nt 2555 to 2556 fom CT to AA; ceation of this site had no effect on the minus-stand eplication activity (data not shown). D1.5G is an ovelength DHBV3 expession constuct cloned in pbs(-) on Septembe 26, 2018 by guest

3 3538 TAVIS ET AL. J. VIROL. A DP..-.An DP-dIl - {3 An 5' Ends: DR1 SL + Ba) a-5 u l un0.ic - - cc:m E D0 c}n c AGC C T D '-.-t - - Bulge DP-SL AA -... An DP-DR1 U. An - DP-dlBulge A :- OD - DR FIG. 2. Minus-stand DNAs mapping to DRI ae dependent on the stem-loop. (A) The RNA stuctues poduced fom the mutants ae diagammed; indicated ae the stop codon fo the P open eading fame (UAA), DRI, and the stem-loop. Leftwad-pointing aows epesent the 5' ends of the minus-stand DNAs. Gaps and dashed lines epesent deletions and substitutions of heteologous sequences, espectively. The columns at ight indicate the pesence (+) o absence (-) of minus-stand DNAs with 5' ends at DR1 o the stem-loop (SL). (B) Pime extension analysis of the minus-stand DNAs poduced fom the constucts diagammed in panel A. The mutants examined in each lane ae indicated above the coesponding lanes. The positions of 5' ends mapping to DRI and the bulge of the stem-loop ae maked at the ight, and a sequencing ladde of ptybdp pimed with D2453+ is to the left. DP-MS is a deivative of ptybdp containing missense mutations in the evese tansciptase active site (YMDD to YMHA [6]). Downloaded fom (Statagene Cloning Systems) and contains a 5' duplication of nt 1658 to Plasmids D1.5GeC2574 and D1.5GcG2575 ae deivatives of D1.SG and contain mutations in the 5' copy of the sequences (T2574C and A2575G, espectively). TyDP VLP isolation. TyDP fusion VLPs wee isolated fom the spt3 Sacchaomyces ceevisiae stain YH51, as the endogenous Ty elements ae not expessed in this backgound (4). Following induction of VLP expession with galactose, spheoplasts wee pepaed and lysed by agitation with glass beads, and VLPs wee patially puified by sucose gadient centifugation as descibed peviously (20). VLP DNA puification and pime extension. DNA was isolated fom the VLP pepaations by poteinase K digestion followed by phenol-chloofom extaction and ethanol pecipitation (20). The 5' ends of the DHBV minus-stand DNAs wee detemined by eiteative pime extension, using a themal cycle. 32P-end-labeled oligonucleotide D2453+ (1.5 ng, 5'CCGCCTGATTGGACGGCTTTT'CC) was mixed with DNA isolated fom 1 p.g of VLP potein extact and subjected to 35 to 55 cycles of extension (94 C fo 1 min, 51 C fo 1.5 min, 73 C fo 2.5 min) at 1.5 mm MgCl2 with 1.0 U of Taq DNA polymease in a 50-LI eaction volume. The poduct DNAs wee extacted with 1:1 phenol-chloofom, ethanol pecipitated, esolved on a 6% acylamide-7 M uea sequencing gel, and detected by autoadiogaphy. Cell cultue, DHBV coe DNA isolation, and Southen blotting. LMH cells (a chicken hepatoma cell line) wee gown in 1:1 Dulbecco minimal essential medium-ham nutient mixtue F12 supplemented with 10% fetal bovine seum (Gibco Laboatoies). LMH cells (3 x 10") wee tansfected by calcium phosphate copecipitation as descibed peviously (18). DHBV DNA was extacted 4 days posttansfection fom cytoplasmic coes as descibed peviously (18), with the following modification. Tansfected plasmid DNA in the lysates was digested by adding CaCl2 to 5 mm and micococcal nuclease (200 U; Boehinge Mannheim Biochemicals) and incubating the mixtue at 37 C fo 1 h; digestion was teminated by adding EGTA to 7.5 mm. DHBV DNAs wee esolved on 1% agaose-tis-boate-edta gels without ethidium bomide, tansfeed to Hybond N (Amesham), and pobed with DHBV sequences as descibed ealie (18). PCR amplification of vial DNA. Cytoplasmic DHBV coe DNA was digested with DpnI to educe the level of contaminants of the input plasmids, and the digestion mixtue was amplified by PCR (25 cycles; 94 C fo 1 min, 50 C fo 2 min, 72 C fo 1 min); pimes wee 5'GTAGAAGCTITCTGCAGCG AAAGCAATATATATTCCACATAGG and 5'AGAAGGTA CCGAATTICTAAAGCATCT'ITFGCATCTCTAAC. The PCR poducts wee digested with PstI and EcoRI and cloned into pbs(-), and the sequences of DRI and wee detemined in multiple individual clones. RESULTS Dependence of stat sites at DRI on the stem-loop of. To detemine if the dominant stat site within DRI and the cyptic site within the stem-loop wee used independently of each othe, we deleted the elements individually o in combination (Fig. 2A) and detemined the 5' ends of the esulting minusstand DNAs by pime extension. DNAs fom the wild-type constuct ptybdp gave the expected poducts mapping to DRI and the bulge of the stem-loop; these poducts wee not made when DP caied missense mutations in the evese tansciptase active site (Fig. 2B, lanes 1 and 2). Minus-stand on Septembe 26, 2018 by guest

4 9* VOL. 68, 1994 INITIATION OF HEPADNAVIRUS REVERSE TRANSCRIPTION 3539 A A DR1 Bulae DRI Bulce DRI: GAA*ATWAC CC CT=TCCT DR1: GAATTACACCCCTCT CT SL: A T G TCTAC AT.4 SL: A TA GTCTACAT DRM1 GAALajSa CT SLM5: AT TTTiC TCT(AC)AT SLM2: AT TGCTAC AT DRM2: GA CCCCTCT3 CT SLM6: A*TTT-OAC <TTTaCa TCT(AC)AT SLM8: A CTTA7YQOC 'TCACAT B i-_ :L SLM9. cn N _4 A~TAACTCTACAT CM 2.j _3 -I co) c-j cṉ C D CD a,: :;4 jcm O- B ptybdp A G C T C A &da CL &Q CL 3- O n Q^ - ceo I)n U)c t I - - E 4b CL 0f 0 au 00 Bulge ptybdp c ao acm A G C TC]aC ] --z*~-:-.o] Bulge - DR FIG. 3. Minus-stand DNA at DR1 equies homology to a site in the stem-loop. (A) Sequences flanking the 5' ends of minus-stand - DR1 DNAs ae shown fo wild-type and mutant constucts (nt 2531 to 2548 fo DR1 and nt 2569 to 2584 fo the bulge of the stem-loop [SL]). DR1 and bulge sequences ae boxed, mutant nucleotides ae undelined, and obseved DNA 5' ends poduced by each constuct ae indicated with leftwad aows. Nucleotide numbes fo DNA 5' ends obseved with wild-type constucts ae indicated FIG. 4. above the sequence. (B) Pime Minus-stand DNA pimes ae tansfeed fom the stemloop to DR1. (A) Sequences flanking the 5' ends of minus-stand extension analysis of the minus-stand DNAs poduced fom the constucts in panel A. The DNAs ae shown positions of 5' ends mapping fo wild-type and mutant constucts as descibed in to DR1 and the bulge of the stem-loop ae maked the at the ight, and a sequencing legend fo Fig. 3A. The downsteam stat sites fo SLM5 and ladde of ptybdp pimed with D2453+ SLM6 have not is to the left. Lanes 8 and 10 been detemined pecisely; the potential locations of show pime extension poducts fom 2 ng of ptybdp-slm2 cut with the 5' ends ae indicated by AC above the aow. (B) Pime extension PmlI. Lanes 9 and 10 ae a dake exposue fom a diffeent expeiment to bette show the signal at DRI fo DP-DRM2/SLM2. analysis of the minus-stand DNAs poduced fom the constucts in panel A. The positions of 5' ends mapping to DR1 and the bulge of the stem-loop ae maked at ight, and a sequencing ladde of ptybdp pimed with D is to the left. Lane 6 shows pime extension poducts fom 2 ng of ptybdp-slm2 cut with PmlI. DNAs wee not detected when both DR1 and the stem-loop wee deleted (DP-dll; lane 3). When DR1 was eplaced with heteologous sequences, no DNAs wee found mapping to the to DR1 ae dependent on the stem-loop, wheeas those DNAs DR1 position, but thee was no change in poducts mapping to mapping to the stem-loop ae independent of DR1. the bulge (DP-SL; lane 4). As expected, 5' ends wee not Tansfe of minus-stand DNA fom the stem-loop to DR1. detected at the bulge when the stem-loop was deleted. Unexpectedly, howeve, none wee detected at DR1 eithe (DP- evealed that thee was an identity of 4 nt between these sites Inspection of the sequences at the stem-loop and aound DR1 DR1; lane 5). To confim this obsevation with a less adical (TIAC; Fig. 3A). We tested whethe this identity might seve mutation, 5 nt wee deleted fom the bulge; again, no minusstand DNAs wee detected at DR1 (DP-dlBulge; lane 6). nascent minus-stand DNA fom the stem-loop to DR1. In to diect a homology-mediated stand tansfe eaction of (Vey weak signals whose 5' ends flank the bulge deletion [nt such a eaction, sequences evese tanscibed fom the stemloop would be the dono and those in DR1 would be 2571 and 2579] upon polonged exposue of these autoadio- the gams could be detected; no 5' ends wee obseved at DR1 even at this moe sensitive level [data not shown].) These esults indicate that minus-stand DNAs with 5' ends mapping accepto. This notion was made attactive by the key obsevation of Wang and Seege (21) that the pincipal poduct of in vito evese tansciption by DHBV polymease is a P-linked Downloaded fom on Septembe 26, 2018 by guest

5 3540 TAVIS ET AL. J. VIROL. R c) Cg B -Relaxed Cicula --DS Linea is, SS Linea FIG. 5. Mutations in the 5' stem-loop of ae tansfeed to DR1 duing vial eplication in vivo. (A) Southen blot of cytoplasmic coe DNA 4 days posttansfection showing the elaxed cicula, doublestanded (DS) linea, and single-standed (SS) linea vial DNA foms. DNAs used wee wild-type D1.5G (WT), 5' e mutants T2574C and A2575G, and the evese tansciptase active site mutant (MS). (B) Pegenomic RNA contains the mutations (X) in the bulge of the 5' stem-loop (SL). Afte initiation at the 5' stem-loop (cuved aow), the nascent minus-stand DNAs ae tansfeed to the 3' copy of DR1 (staight aow) and extended. Completion of evese tansciption yields cicula vial DNA containing a single copy of each DR1 and the coding sequences in the oientation shown. The thee possible configuations fo the DNA ae shown, with the positions of the mutations indicated with X's. The numbe of clones in each configuation obtained fo the mutants following PCR amplification of is shown at the ight. RNA: Cap i DR1-I-.-A I DNA: Tansfe:.... DR1 Bulge. Ix= No Tansfe o False Negative: I-, = PCR Contaminant o Tansfe fom 3' SL: No. of Clones T2574C A2575G Downloaded fom tetanucleotide coesponding to the minus-stand complement of this sequence. The mutations constucted to test this hypothesis ae shown in Fig. 3A, and pime extension analysis of these mutants is shown in Fig. 3B. Pime extension on DNA fom a constuct caying a 5-nt substitution in the bulge of the stem-loop (DP-SLM2; Fig. 3A) eveals two dominant ends mapping within the stem-loop, nt 2574 and 2582 (Fig. 3B, lane 2). Stat sites at nt 2582 ae also seen with the wild-type stem-loop, although less efficiently, and nt 2574 is the neaest C in the mutant bulge to the nomal stat site at nt When this mutation was paied with DR1 (DP-DR1/SLM2; Fig. 3B, lane 3), a modeate signal was obseved at DR1; howeve, inspection of the sequence at the downsteam stem-loop stat site at nt 2582 evealed a 3-nt homology (TAC) with the poposed DR1 accepto site (cf. Fig. 3A). We theefoe alteed DR1 to emove homology to both upsteam sites (DRM1; Fig. 3A); no minus-stand DNAs at DR1 wee detected fom this constuct when it was expessed alone (DP-DRM1; Fig. 3B, lane 4), paied with SLM2 (DP-DRM1/SLM2; lane 5), o paied with the wild-type stem-loop (data not shown). We then estoed homology at DR1 to the novel initiation site at nt 2574 in SLM2 (mutant DRM2; Fig. 3A). No 5' ends wee obseved at DRM2 when it was expessed alone (Fig. 3B, lane 6); howeve, a weak signal was detected when it was paied with SLM2 (Fig. 3B, lane 7, and a dake exposue fom anothe expeiment in lane 9). The ecovey of 5' ends at DR1 when homology was estoed to a site in the stem-loop is consistent with a stand tansfe fom the stem-loop to DR1, but the poo efficiency of the tansfe with the mutant dono to the homologous mutant accepto led us to examine the eaction in anothe manne. We inseted eithe a C (DP-DR1/SLM8) o an A (DP-DR1/SLM9) into the bulge between nt 2575 and 2576 to incease the size of the minus-stand DNA pimes (Fig. 4A). Pime extension of DNA fom these constucts showed doublets at the stat sites in the stem-loop fo both mutants (Fig. 4B, lanes 4 and 5), with the lowe band coesponding to initiation at the inseted nucleotide (the nomal position elative to the 5' side of the bulge) and the uppe band (caying the inseted nucleotide) due to initiation at the nomal position, nt Impotantly, both mutants had a doublet of 5' ends at DR1; one end was at the wild-type position (nt 2537), and the second was 1 nt lage at nt 2538 (Fig. 4B, lanes 4 and 5). The lage of these DNAs can be explained only by tansfe of the lengthened pime fom the stem-loop to DR1. The smalle poduct is likely due to tansfe fom the lowe band in the stem-loop. Make tansfe fom DHBV 5' to DRI in vivo. We next consideed whethe this pime tansfe pocess might also opeate duing authentic DHBV eplication in vivo. Paadoxically, ealie wok had shown that the 3' copy of e was dispensable fo minus-stand DNA synthesis (17). Howeve, as mentioned ealie, in these studies a wild-type copy of was etained at the 5' end of the RNA (to ensue pope RNA encapsidation). We theefoe examined whethe this 5' copy of E might in fact seve as the template fo the tue pime in vivo. To do this, two mutations (T2574C and A2575G) wee inseted individually into the 5' copy of in the ovelength DHBV expession constuct D1.5G. If minus-stand DNA initiates in the 5' stem-loop and extends fo at least 2 (A2575G) o 3 (T2574C) nt pio to tansfe, the mutation in the stem-loop will be tansfeed to DR1 in the esulting vial DNA. on Septembe 26, 2018 by guest

6 VOL. 68, 1994 INITIATION OF HEPADNAVIRUS REVERSE TRANSCRIPTION 3541 R R.Cap -m[ _ An 2a. Cap-II --EJAn 2b. cap p-js-*-m-qp --An 3. Cap -[EJS 4. Cap-m Cap- FIG. 6. Poposed hepadnavius evese tansciption mechanism. The symbols ae the same as those used fo Fig. 1. Minus-stand initiation (Fig. 1, step 2) now consists of two steps. P initiates evese tansciption at the 5' stem-loop and extends minus-stand DNA (solid line) fo 3 to 4 nt (step 2a). Then P and the covalently attached nascent DNA ae tansfeed to the 3' DRI (step 2b), and the DNA is extended. The subsequent steps of the mechanism ae as descibed in Fig. 1. These mutant plasmids wee tansfected into LMH cells, and 4 days late cytoplasmic coe DNA was examined by Southen blotting (Fig. SA). Both mutants wee eplication competent, although they eplicated less efficiently than did wild-type DHBV (32 and 23% fo T2574C and A257G, espectively). As expected fom ealie wok (7, 12, 14), pime extension of these coe DNAs detected 5' ends at DR1 only; no extension poducts mapped to the stem-loop (data not shown). (In the yeast Ty system, constucts caying the identical mutations did poduce DNAs with 5' ends at both the stem-loop and at DRI [DP-DR1/SLM5 and DP-DR1/SLM6; Fig. 4A and B, lanes 2 and 3]; see Discussion.) The DRI _ egion (nt 2490 to 2750) fom the cytoplasmic DNAs was then amplified by PCR and cloned, and the sequences at DRI and the stem-loop wee detemined fo multiple clones fom each mutant (Fig. SB). The esults fo T2574C wee definitive: 21 of the 22 PCR clones sequenced had the T-to-C mutation at both the oiginal position in the stem-loop and Cap - also at DRI (T2535C). The emaining clone caied the mutation at neithe location and was a PCR poduct of eithe (i) the 3' end of the input plasmid DNA o (ii) a DNA pimed by tansfe to DR1 of a pime initiated at the 3' stem-loop. The A2574G mutation was tansfeed to DRI (A2536G) in 14 of the 22 clones sequenced; 6 of the emaining clones wee PCR contaminants fom the 3' end of the input plasmids (o wee tansfe poducts fom the 3' stem-loop). Two clones caied the mutation at the stem-loop only. These clones epesent eithe initiation at DRI without tansfe (i.e., the classical model of initiation, as in Fig. 1) o ae false negatives esulting fom PCR amplification of the 5' end of the plasmid o fom ciculaization of the template duing plusstand synthesis pio to copying the tansfeed lesion in DRI (ou PCR stategy elies on amplifying the vial plus-stand DNA because the pimes flank the gap in the minus-stand DNA). Given these possibilities fo the oigin of clones with wild- Downloaded fom on Septembe 26, 2018 by guest

7 3542 TAVIS ET AL. J VlIROL. type DRI sequences, the obseved tansfe fequencies epesent minimal measuements of the elative fequency of initiation at the 5' stem-loop vesus DR1. Since all 21 unambiguous evese tansciption poducts fo T2574C initiated at the maked stem-loop and tansfeed the mutation to DRI, binomial pobability analysis indicates that at 95% confidence, no moe than 13% of the initiation events could have occued at DRI in the couse of nomal vial eplication. DISCUSSION Using a yeast Ty expession system that is not dependent on fo template packaging, we have demonstated that initiation of DHBV evese tansciption occus within the stem-loop and not at DRI as was peviously supposed. The vial DNAs whose 5' ends map to DRI ae deived not by de novo initiation thee but by tansfe of shot nascent P-linked chains initiated within the stem-loop in a eaction mediated in pat by homology between the pime and the accepto site in DRI (see below). While the 3' copy of seves this oigin function in ou Ty constucts, make tansfe expeiments in the context of the vial genome indicate that it is the 5' copy of that caies out this function in vivo. Independently of this wok, Wang and Seege have obtained closely simila esults, using both DHBV P made in vito and make tansfe expeiments in vivo (22). Togethe, these esults ovetun ealie models of hepadnavius evese tansciption in which the piming site was assigned to DRI and establish the existence of a peviously unsuspected template tansfe eaction in minus-stand synthesis. This new model is summaized in Fig. 6. The consevation of homology between DRI and the bulge in all hepatitis B viuses stongly agues that this mechanism will be applicable to all membes of this vius family. The pevious identification of the initiation site as nt 2537 within DRI was based on data gatheed by analysis of evese tansciption poducts poduced in vivo. The 3' copy of DRI was taken to be the initiation site on the basis of make tansfe studies vey simila in outline to those epoted hee (17). Mutations just upsteam of the 5' DRI wee not incopoated into the 5' end of vial DNA, while identical lesions placed nea the 3' DR1 wee. In etospect, howeve, we now know that these mutations wee outside of the sequences that ae actually involved in the template tansfe and hence failed to detect the tansfe. In the context of ou pesent undestanding (Fig. 6), what these pio studies actually establish is (i) that the 3' copy of DRI is the accepto site fo the tansfe and (ii) that the tansfeed pime can be no longe than 5 nt. The tansfe of the minus-stand pime usually employs a shot egion of homology. Howeve, homology alone is not sufficient to explain all featues of the tansfe: thee appea to be sequence specificity and/o context effects that ae also impotant. Tansfe can occu when 1 of the 4 nt of homology between the sites is alteed (T2574C and A2575G) o when the pime is lengthened by 1 nt (DP-DR1/SLM8 and DP-DRI/ SLM9). Such changes would be expected to significantly affect hybidization of a 4-nt nucleic acid. Moe compellingly, the inefficient tansfe of DP-DRM2/SLM2 despite 6 nt of homology between the dono and accepto sites in this constuct agues stongly that homology pe se is not the sole deteminant of tansfe. Finally, the fidelity with which the tansfe eaction selects nt 2537 as the 5' end of the accepto (instead of othe UAC o UUAC motifs nea the 3' DRI) cannot be explained simply by homology consideations and suggests that othe stuctual deteminants may affect accepto site choice. A moe detailed analysis of these featues of the tansfe eaction is in pogess. The esults of the make tansfe expeiment in avian cells (Fig. 5) establish that the vast majoity of piming events occu at the 5' copy of but do not exclude the possibility of a low level of initiation within the 3' copy of DRI. Howeve, if this occus in vivo, it is unlikely to contibute moe than a few pecent of the total poducts of evese tansciption. These expeiments also suggest that eithe the 3' stem-loop is aely used fo initiation in vivo o, if it is, poducts fom this site ae neithe extended beyond a few nucleotides no tansfeed to DRI. How this 3' copy is silenced as a poductive initiation site in wild-type DHBV is not undestood, but its use in DR1 deletion mutants (7) indicates that its capacity to function in vivo is not ievesibly abogated. DHBV P initiates evese tansciption by inteacting with the same copy of that is employed fo RNA packaging. The pimay sequence motifs fo binding and ecognition by P lie outside of the bulge in the stem-loop (1Sa), and the bulge appeas pimaily to povide an appopiately stuctued template fo initiation (which appeas to stongly pefe to utilize a C). This is eminiscent of the ole of the bulge of the human hepatitis B vius stem-loop in pegenomic RNA packaging (15); in fact, detailed mutational analysis of the cis equiements fo both the packaging and piming eactions eveals them to be emakably simila (15a). These findings suggest the satisfyingly pasimonious model that only a single RNA ecognition event may be equied to tigge both RNA encapsidation and evese tansciption. ACKNOWLEDGMENTS This wok was suppoted by gants fom the National Institutes of Health. REFERENCES 1. Ayola, B., P. Kanda, and R. E. Lanfod High level expession and phosphoylation of hepatitis B vius polymease in insect cells with ecombinant baculoviuses. Viology 194: Batenschlage, R., M. Junke-Niepmann, and H. Schalle The P gene poduct of hepatitis B vius is equied as a stuctual component fo genomic RNA encapsidation. J. Viol. 64: Batenschlage, R., and H. Schalle The amino-teminal domain of the hepadnavial P-gene encodes the teminal potein (genome-linked potein) believed to pime evese tansciption. EMBO J. 7: Boeke, J. D., C. A. Styles, and G. R. Fink Sacchaomyces ceevisiae SPT3 gene is equied fo tansposition and tanspositional ecombination of chomosomal Ty elements. Mol. Cell. Biol. 6: Bosch, V., R. Batenschlage, G. Radziwill, and H. Schalle The duck hepatitis B vius P-gene codes fo potein stongly associated with the 5'-end of the vial DNA minus stand. Viology 166: Chang, L.-J., R. C. Hisch, D. Ganem, and H. E. Vamus Effects of insetional and point mutations on the functions of the duck hepatitis B vius polymease. J. Viol. 64: Condeay, L. D., T.-T. Wu, C. E. Aldich, M. A. Delaney, J. Summes, C. Seege, and W. S. Mason Replication of DHBV genomes with mutations at the sites of initiation of minusand plus-stand DNA synthesis. Viology 188: Ganem, D., and H. E. Vamus The molecula biology of the hepatitis B viuses. Annu. Rev. Biochem. 56: Hisch, R. C., J. E. Lavine, L. J. Chang, H. E. Vamus, and D. Ganem Polymease gene poducts of hepatitis B viuses ae equied fo genomic RNA packaging as well as fo evese tansciption. Natue (London) 344: Hisch, R. C., D. D. Loeb, J. R. Pollack, and D. Ganem cis-acting sequences equied fo encapsidation of duck hepatitis B Downloaded fom on Septembe 26, 2018 by guest

8 VOL. 68, 1994 INITIATION OF HEPADNAVIRUS REVERSE TRANSCRIPTION 3543 vius pegenomic RNA. J. Viol. 65: Junke-Niepmann, M., R. Batenschlage, and H. Schalle A shot cis-acting sequence is equied fo hepatitis B vius pegenome encapsidation and sufficient fo packaging of foeign RNA. EMBO J. 9: Lien, J. M., D. J. Petcu, C. E. Aldich, and W. S. Mason Initiation and temination of duck hepatitis B vius DNA synthesis duing vius matuation. J. Viol. 61: Loeb, D. D., and D. Ganem Revese tansciption pathway of the hepatitis B viuses, p In A. M. Skalka and S. P. Goff (ed.), Revese tansciptase. Cold Sping Habo Laboatoy Pess, Cold Sping Habo, N.Y. 14. Molna-Kimbe, K. L., J. W. Summes, and W. S. Mason Mapping of the cohesive ovelap of duck hepatitis B vius DNA and of the site of initiation of evese tansciption. J. Viol. 51: Pollack, J. R., and D. Ganem An RNA stem-loop stuctue diects hepatitis B vius genomic RNA encapsidation. J. Viol. 67: a.Pollack, J. R., and D. Ganem. Submitted fo publication. 16. Radziwill, G., H. Zentgaf, H. Schalle, and V. Bosch The duck hepatitis B vius DNA polymease is tightly associated with the vial coe stuctue and unable to switch to an exogenous template. Viology 163: Seege, C., and J. Maagos Identification and chaacteization of the woodchuck hepatitis vius oigin of DNA eplication. J. Viol. 64: Stapans, S., D. D. Loeb, and D. Ganem Mutations affecting hepadnavius plus-stand DNA synthesis dissociate pime cleavage fom tanslocation and eveal the oigin of linea vial DNA. J. Viol. 65: Summes, J., and W. S. Mason Replication of the genome of a hepatitis B-like vius by evese tansciption of an RNA intemediate. Cell 29: Tavis, J. E., and D. Ganem Expession of functional hepatitis B vius polymease in yeast eveals it to be the sole vial potein equied fo coect initiation of evese tansciption. Poc. Natl. Acad. Sci. USA 90: Wang, G.-H., and C. Seege The evese tansciptase of hepatitis B vius acts as a potein pime fo vial DNA synthesis. Cell 71: Wang, G.-H., and C. Seege Novel mechanism fo evese tansciption in hepatitis B viuses. J. Viol. 67: Downloaded fom on Septembe 26, 2018 by guest