Biology Celebration of Learning (100 points possible)

Transcription

1 Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein 3. Promoter c. insertion or deletion of one nitrogenous base during replication 4. Transcription d. process of building of proteins using mrna 5. Mutagen e. twisted ladder structure of DNA 6. Frame shift mutation f. series of three bases coding for one amino acid 7. Double helix g. region of DNA that initiates transcription of a gene 8. Genotype h. genetic code makeup of a cell or organism 9. Translation i. observable physical traits of an organism 10. Phenotype j. physical or chemical agent that changes the genetic material Multiple Choice Select the one option that best fits (2 points each). 11. There are different nitrogenous bases found in DNA. a. 2 b. 4 c. 6 d DNA is ; RNA is. a. double stranded; single stranded b. single stranded; double stranded c. double stranded; double stranded d. single stranded; single stranded 13. The entirety of an organisms genetic material is known as its. a. Traits b. Allele c. Phenotype d. Genome 14. The nitrogenous bases in DNA are held together via. a. Ionic bonds b. Covalent bonds c. Hydrogen bonds d. Van der Waals Forces 15. Transcription occurs: a. Within the cytoplasm b. Within the nucleus c. Attached to a ribosome d. Outside the cell

2 16. Translation occurs: a. Within the cytoplasm b. Within the nucleus c. Attached to a ribosome d. Outside the cell 17. DNA is made up of building blocks called a. Proteins b. Nitrogenous bases c. Nucleotides d. Deoxyribose sugars 18. The bases of RNA are the same as those of DNA with the exception that RNA contains a. Cysteine instead of cytosine b. Uracil instead of thymine c. Cytosine instead of guanine d. Uracil instead of adenine 19. Which of the following is not a type of RNA a. nrna (nuclear RNA) b. mrna (messenger RNA) c. rrna (ribosomal RNA) d. trna (transfer RNA) 20. Each amino acid in a protein is specified by a. Several genes b. A promoter c. An mrna molecule d. A codon 21. The three nucleotide codon system can be arranged into combinations a. 16 b. 20 c. 64 d is the scientist credited with discovering DNA was a double helix. a. James Watson b. Francis Crick c. Frederic Griffith d. Rosalind Franklin 23. If a strand of DNA is 26% adenine (A), what percent of the complementary strand is thymine (T)? a. 13% b. 26% c. 39% d. 52% 24. Which of the following is a nucleotide found in DNA? a. ribose + phosphate group + thymine b. ribose + phosphate group + uracil c. deoxyribose + phosphate group + thymine d. deoxyribose + phosphate group + uracil

3 25. DNA is copied during a process called a. Replication b. Translation c. Transcription d. Transformation 26. RNA contains the sugar a. Ribose b. Deoxyribose c. Glucose d. Lactose 27. Chargaff s rules stated: a. DNA must remain within the nucleus b. Amino acids are coded for by a three nucleotide sequence c. There are equal ratios of adenines s to thymines and cytosines to guanines d. Gene expression is regulated by protein synthesis 28. Which of the following are found in both DNA and RNA? a. ribose, phosphate groups, and adenine b. deoxyribose, phosphate groups, and guanine c. phosphate groups, guanine, and thymine d. phosphate groups, guanine, and cytosine 29. Which type(s) of RNA is(are) involved in protein synthesis? a. transfer RNA only b. messenger RNA only c. ribosomal RNA and transfer RNA only d. messenger RNA, ribosomal RNA, and transfer RNA 30. How many bases are needed to specify three amino acids? a. 3 b. 6 c. 9 d Why is it possible for an amino acid to be specified by more than one kind of codon? a. Some codons have the same sequence of nucleotides b. There are 64 different combinations of codons, but only 20 amino acids c. Some codons do not specify an amino acid d. The codon AUG codes for the amino acid methionine and serves as the start codon for protein synthesis. 32. During translation, the type of amino acid that is added to the growing polypeptide depends on the a. Codon on the mrna only b. Anticodon on the mrna only c. Anticodon on the trna to which the amino acid is attached only d. Codon on the mrna and the anticodon on the trna to which the amino acid is attached

4 33. Which type of RNA functions as a blueprint for the genetic code? a. rrna b. trna c. RNA polymerase d. mrna 34. A point shift mutation occurs when a(n): a. nitrogenous base is added to the strand b. nitrogenous base is deleted from the strand c. entire section of DNA is reversed d. nitrogenous base is incorrectly changed within the sequence 35. The anticodon is located on the: a. mrna b. trna c. ribosome d. amino acid Complete the following complementary strands (2 points each) 36. DNA : TATATTGCGATCGATCCTAC DNA: 37. DNA: CATACCTAGCTAGCGTTATA RNA: 38. DNA: RNA: GUACACCUGCGAUGUACUUA Short Answer (4 points) 39. Compare and contrast DNA and RNA. Make sure to include at least three comparisons.

5 Essay Question (10 points) 40. Describe, in detail, the process of protein synthesis. Make sure to include transcription, translation, and all key components in your response. Use the DNA strand CATTGACCAC in your essay.