Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy

Transcription

1 Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1

2 Contents 1. Design of DNA nanopores Sequences D maps of DNA nanopores Models and dimensions of DNA nanopores Experimental results Electrophoretic analysis of intact DNA nanopores Analysis on the resistance of DNA nanopores toward DNase I digestion UV vis analysis of NP-0C, NP-1C and NP-3C Fluorescence digestion curve of NP-0C recorded for 120 min Gel electrophoretic analysis of NP-3C in the presence of SUVs Fluorescence digestion profiles of SUV-bound NP-3C at high BAL-31 concentration Single-channel current analysis of NP-3C before and after addition of BAL Fluorescence digestion profiles of NP-3C and NP-3C 4' with SUVs Digestion profiles of NP-3C incubated with SUVs for variable durations Confocal microscopic analysis of NP-1C and NP-3C bound externally to GUVs Confocal microscopic analysis of NP-3C bound internally to GUVs Analysis on the interaction of cholesterol-dna origami plates and SUVs Electrophoretic analysis of cholesterol-dna origami plates with SUVs Nuclease digestion of cholesterol-dna origami plates incubated with SUVs

3 1. Design of DNA nanopores 1.1. Sequences Table S1. Names, chemical modifications, and sequences of DNA oligonucleotides used to prepare DNA nanopores. ID Sequence 5 à 3 1 AGCGAACGTGGATTTTGTCCGACATCGGCAAGCTCCCTTTTTCGACTATT 2 CCGATGTCGGACTTTTACACGATCTTCGCCTGCTGGGTTTTGGGAGCTTG 3 CGAAGATCGTGTTTTTCCACAGTTGATTGCCCTTCACTTTTCCCAGCAGG 4 AATCAACTGTGGTTTTTCTCACTGGTGATTAGAATGCTTTTGTGAAGGGC 5 TCACCAGTGAGATTTTTGTCGTACCAGGTGCATGGATTTTTGCATTCTAA 6 CCTGGTACGACATTTTTCCACGTTCGCTAATAGTCGATTTTATCCATGCA 1(chol) Sequence of 1, carries a cholesterol via a tri(ethylene glycol) linker at the 3 end 3(chol) Sequence of 3, carries a cholesterol via a TEG linker at the 3 terminus 5(chol) Sequence of 5 carries a cholesterol via a TEG linker at the 3 terminus 4' GTGGTTTTTCTCACTGGTGATTAGAATGCTTTTGTGAAGGGCAATCAACT Strand 2 contained a FAM dye, whilst strand 6 contained a Cy3 dye where stated. Both dyes were incorporated into the 5' terminus of the respective oligonucleotides. Table S2. Names and composition of DNA nanopores and control nanostructures. Nanopore Oligonucleotides used NP-0C 1, 2, 3, 4, 5, 6 NB-1C 1(chol), 2, 3, 4, 5, 6 NB-3C 1(chol), 2, 3(chol), 4, 5(chol), 6 NP-3C 4' 1(chol), 2, 3(chol), 4 ', 5(chol), 6 3

4 1.2. 2D maps of DNA nanopores Figure S1. 2D maps of DNA nanopores (A) NP-0C and (B) NP-1C, (C) NP-3C and NP-3C4'. The component DNA strands are represented as lines, and the 5' and 3' termini of the strands are indicated by squares and triangles, respectively. The segments in semitransparent color at the top and bottom of the 2D maps indicate the mismatched T4 singlestrand loops. Orange circles show the positions for the cholesterol modifications, the purple and gray circles denote the position of the fluorophores Models and dimensions of DNA nanopores Figure S2. (A) Cylinder representation of NP-3C in top and side view. (B) Space filling model of NP-3C in top and side view. 4

5 2. Experimental results 2.1 Electrophoretic analysis of intact DNA nanopores Figure S3. Electrophoretic analysis with a 1.2% agarose gel confirms the formation of DNA nanopores. Gel lanes from left to right: 1 kbp marker, 100 bp marker, NP-0C, NP-1C, NP- 3C, NP-3C 4', and oligonucleotide Analysis on the resistance of DNA nanopores toward DNase I digestion Figure S4. Electrophoretic analysis with 1.2% agarose gels showing that DNA nanopores are of high resistance toward nuclease digestion by DNAse I. Analyzed pores are NP-3C (top) and NP-1C (bottom) in the absence (right) or presence of SUV membrane vesicles (left) after 1 h incubation with DNAase I at 37 C The DNAse I concentration increases from left to right at 0, 7.5, 30, 120, and 480 U per ml. The physiologically relevant concentration of DNAse I is 3.6 U per ml. [1] 5

6 2.3 UV vis analysis of NP-0C, NP-1C and NP-3C Figure S5. UV vis analysis of DNA nanopores in the absence and presence of BAL-31. (A) UV absorption spectra of NP-0C after addition of BAL-31 to a final concentration of 4 U per ml. Scans were taken at intervals of 30 s over 30 min. The first scan has the lowest absorption at 260 nm. (B) Graph plotting the absorption at 260 nm of DNA nanopores as function of incubation duration with BAL-31. NP-0C (purple) from A, NP-1C (gray) and NP- 3C (pink). The asterisk denotes the addition of BAL-31. (C) UV melting profiles of native (purple) and BAL-31 digested (red) NP-0C. (D) UV melting profiles of native (pink) and digested (red) NP-3C. The digested pores were incubated for 30 min with BAL-31 in C and D. 2.4 Fluorescence digestion curve of NP-0C recorded for 120 min Figure S6. Fluorescence emission of Cy3-labeled NP-0C as a function of time after adding BAL-31 to a final concentration of 0.1 U per ml. 6

7 2.5 Gel electrophoretic analysis of NP-3C in the presence of SUVs Figure S7. 0.5% Agarose gel electropherogram of NP-3C incubated with increasing amounts of SUV as measured by the concentration of lipid. Gel lanes from left to right: 1000 bp DNA marker, 100 bp DNA marker, NP-3C with 0, 0.9, 3.6, 14, 57, 227 and 909 µm lipid. 2.6 Fluorescence digestion profiles of SUV-bound NP-3C at high BAL-31 concentration Figure S8. Kinetic fluorescence emission plot of Cy3-labeled NP-3C in the presence of SUVs after addition of 1.7 U (green) and 13 U (red) of BAL-31, and of reference pore NP-0C after addition of BAL-31 at 1.7 U (purple) and 13 U (black). 7

8 2.7 Single-channel current analysis of NP-3C before and after addition of BAL-31 Figure S9. Examples of single-channel current traces of NP-3C before and after addition of BAL-31 (final concentration of 3.3 U per ml) and after 20 min incubation. The potential was switched alternatingly by +/-20 mv from 0 to +/-100 mv. 8

9 2.8 Fluorescence digestion profiles of NP-3C and NP-3C 4' with SUVs Figure S10. Kinetic fluorescence emission plot of Cy3-labeled NP-3C (green) and NP-3C 4' (blue) nanopores that had been incubated with SUVs for 60 min, and of NP-3C without SUVs (red), after addition of BAL-31 to a final concentration of 1.7 U per ml. 2.9 Digestion profiles of NP-3C incubated with SUVs for variable durations Figure S11. Kinetic fluorescence emission plot of Cy3-labeled NP-3C after addition of with BAL-31 (final concentration of 1.7 U per ml) in the absence of SUVs (red), or when NP-3C had been pre-incubated with SUVs for 2 min (gray), 15 min (dark green) and 60 min (light green). 9

10 2.10 Confocal microscopic analysis of NP-1C and NP-3C bound externally to GUVs Figure S12. Confocal laser scanning microscopic images of FAM-labeled NP-1C (A) and Cy3-labeled NP-3C (B) bound to the same GUV, before and after the addition BAL-31 to a final concentration 1.7 U per ml. Each frame represents 1 min intervals, and the asterisk denotes the time point when BAL-31 was added. Scale bar, 10 µm Confocal microscopic analysis of NP-3C bound internally to GUVs Figure S13. Confocal laser scanning microscopic images of Cy3-labeled NP-3C encapsulated inside a GUV, before and after the addition BAL-31 (8.2 U per ml). Each frame represents 1 min intervals, and the asterisk denotes the time point of adding BAL-31. Scale bar, 5 µm. 10

11 2.12 Analysis on the interaction of cholesterol-dna origami plates and SUVs Figure S14. The nuclease probe assay was applied to a previously published single layer DNA origami plate measuring 50 x 50 nm [2]. (A) The plate carried a variable number of cholesterol tags (orange) ranging from 0 (Plate-0C), 1 (Plate-1C), 2 (Plate-2C) and 4 (Plate- 4C). The lipid anchors are located at the corners of the plate. (B) Proposed interaction of the cholesterol-dna nanostructures with membrane vesicles. No binding for Plate-0C, and membrane-tethering for Plate-1C, -2C and -4C. 11

12 2.13 Electrophoretic analysis of cholesterol-dna origami plates with SUVs Figure S15. Electrophoretic analysis of DNA origami plates carrying 0, 1, 2 and 4 cholesterols incubated with increasing amounts of SUVs. (A) 1.5% agarose gels of DNA plates in the presence of 0, 1, 4, 14, 57, 227 and 909 µm lipid, with a 1000 bp DNA marker on the left. (B) Plot summarizing the degree of plates bound to SUVs, as analyzed with gels in A. 12

13 2.14 Nuclease digestion of cholesterol-dna origami plates incubated with SUVs Figure S16. Electrophoretic analysis with 1.5% agarose gels of DNA origami plates carrying 0, 1, 2 and 4 cholesterol tags after incubation with BAL-31 (3.3 U per ml). Gel bands are from left to right: DNA plates 0, 0.5, 1, 2, 3, 4, 5 and 6 min after the addition of BAL-31, with a 1 kbp DNA marker on the left. References 1) Benson, E., Mohammed, A., Gardell, J., Masich, S., Czeizler, E., Orponen, P., & Högberg, B. (2015). DNA rendering of polyhedral meshes at the nanoscale. Nature, 523 (7561), ) Hager, R., Burns, J. R., Grydlik, M. J., Halilovic, A., Haselgrübler, T., Schäffler, F. & Howorka, S. (2016). Co-Immobilization of Proteins and DNA Origami Nanoplates to Produce High-Contrast Biomolecular Nanoarrays. Small, 12 (21),