Received 30 December 2008; returned 13 February 2009; revised 27 February 2009; accepted 4 March 2009

Transcription

1 Journal of Antimicrobial Chemotherapy (2009) 63, doi: /jac/dkp122 Advance Access publication 7 April 2009 Molecular epidemiology of Escherichia coli producing extended-spectrum b-lactamases in Lugo (Spain): dissemination of clone O25b:H4-ST131 producing CTX-M-15 Miguel Blanco 1, Maria Pilar Alonso 1,2, Marie-Hélène Nicolas-Chanoine 3,4, Ghizlane Dahbi 1, Azucena Mora 1, Jesús E. Blanco 1, Cecilia López 1, Pilar Cortés 5, Montserrat Llagostera 5, Véronique Leflon-Guibout 3, Beatriz Puentes 1, Rosalía Mamani 1, Alexandra Herrera 1, María Amparo Coira 2, Fernando García-Garrote 2, Julia María Pita 2 and Jorge Blanco 1 * 1 Laboratorio de Referencia de E. coli, Departamento de Microbioloxía e Parasitolxía, Facultade de Veterinaria, Universidade de Santiago de Compostela, Lugo, Spain; 2 Unidade de Microbioloxía Clínica, Complexo Hospitalario Xeral-Calde, Lugo, Spain; 3 Service de Microbiologie, Hôpital AP-HP Beaujon, Clichy, France; 4 Faculté de Médecine D. Diderot, Université Paris 7, Paris, France; 5 Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona, Bellaterra (Barcelona), Spain Received 30 December 2008; returned 13 February 2009; revised 27 February 2009; accepted 4 March 2009 Objectives: Having shown that the Xeral-Calde Hospital in Lugo (Spain) has been concerned by Escherichia coli clone O25:H4-ST131 producing CTX-M-15 (Nicolas-Chanoine et al. J Antimicrob Chemother 2008; 61: ), the present study was carried out to evaluate the prevalence of this clone among the extended-spectrum b-lactamase (ESBL)-producing E. coli isolates and also to molecularly characterize the E. coli isolates producing ESBL other than CTX-M-15. Methods: In the first part of this study, 105 ESBL-producing E. coli isolates (February 2006 to March 2007) were characterized with regard to ESBL enzymes, serotypes, virulence genes, phylogenetic groups, multilocus sequence typing (MLST) and PFGE. In the second part of this study, 249 ESBLproducing E. coli isolates (April 2007 to May 2008) were investigated only for the detection of clone O25b:H4-ST131 producing CTX-M-15 using a triplex PCR developed in this study and based on the detection of the new operon afa FM and the targets rfbo25b and 3 0 end of the bla CTX-M-15 gene. Results: Of the 105 ESBL-producing E. coli isolates, 60 (57.1%) were positive for CTX-M-14, 23 (21.9%) for CTX-M-15, 10 (9.5%) for SHV-12 and 7 (6.7%) for CTX-M-32. Serotypes, virulence genes, phylogenetic groups and molecular typing by PFGE demonstrated high homogeneity within those producing CTX-M-15 and high diversity within E. coli producing CTX-M-14 and other ESBLs. By PFGE, CTX-M-15- producing E. coli isolates O25b:H4 belonging to the phylogenetic group B2 and MLST profile ST131 were grouped in the same cluster. The epidemic strain of clone O25b:H4-ST131 represented 23.1%, 22.5% and 20.0% of all ESBL-producing E. coli isolated in 2006, 2007 and 2008, respectively. Conclusions: CTX-M-type ESBLs, primarily CTX-M-14 and CTX-M-15, have emerged as the predominant types of ESBL produced by E. coli isolates in Lugo. In view of the reported findings, long-term care facilities for elderly people may represent a significant reservoir for E. coli clone O25b:H4-ST131 producing CTX-M-15. The triplex PCR developed in this work will be useful for rapid and simple detection of this clone. Keywords: antibiotic resistance, CTX-M, E. coli, ESBLs... *Corresponding author. Tel/Fax: þ ; jorge.blanco@usc.es # The Author Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please journals.permissions@oxfordjournals.org

2 Blanco et al. Introduction Materials and methods Extended-spectrum b-lactamases (ESBLs) are plasmid-encoded b-lactamases that confer significant resistance to penicillins, cephalosporins and aztreonam. During the 1990s, SHV and TEM types were dominant among ESBLs all over the world and CTX-M-producing organisms were rarely isolated. In recent years, ESBL production in Enterobacteriaceae, particularly in Escherichia coli, has significantly increased in numerous countries, including Spain. This increase is primarily due to the spread of CTX-M-type ESBLs, both in nosocomial and in community settings. 1 4 Among the CTX-M enzymes, CTX-M-15 has currently been shown to be the most frequent CTX-M enzyme all over the world and, very recently, this enzyme was identified in a clonal group of E. coli isolates recognizable by their sequence type (ST) and serotype, namely ST131 and O25:H4, which have emerged and disseminated in three continents. 5 7 Having shown that the Xeral-Calde Hospital in Lugo (Spain) has been concerned by E. coli clone ST131 producing CTX-M-15, 6 the present study was carried out to evaluate the prevalence of this clone among the ESBL-producing E. coli isolates whose rate has dramatically increased in this hospital, and also to molecularly characterize the E. coli isolates producing ESBL other than CTX-M-15. A prospective study was carried out from January 2006 to May 2008 at the Xeral-Calde Hospital in Lugo (Spain). During the 29 month study period, E. coli were isolated from patients in the Microbiology Unit of the Xeral-Calde Hospital in Lugo (Spain) and 630 (5.6%) were positive for ESBL production. The incidence of ESBL-producing isolates increased from 3.8% in 2006 to 7.4% in In the first part of this study, 105 ESBL-producing E. coli isolates recovered from inpatients and outpatients between January 2006 and March 2007 were characterized with regard to ESBL enzymes, 8 O:H serotypes, 6 O25a and O25b subtypes, 9 virulence genes (papc, sfa/focde, afa/drabc, hlya, cnf1, iucd, neuc), 10 phylogenetic groups (A, B1, B2, D), 9 multilocus sequence typing (MLST) 11 and PFGE profiles, 12 as described previously. In the second part of the study, 249 ESBL-producing E. coli isolates recovered from April 2007 to May 2008 were investigated only for the detection of clone O25b:H4-ST131 producing CTX-M-15. The 354 isolates characterized in this study were obtained from 354 different patients and the majority were recovered from urine samples. In many patients, more than one sample was positive for ESBL-producing E. coli isolates, so, the number of isolates finally included in the study (n¼105þ249¼354) was less than the total number (n¼630) of ESBL isolates identified in the hospital. Table 1. Phylogenetic groups, virulence genes, antimicrobial resistance and serotypes of ESBL-producing E. coli isolates CTX-M-14 CTX-M-15 CTX-M-32 SHV-12 Number of isolates Phylogenetic groups A 17 (28.3) 0 1 (14.3) 5 (50) B1 21 (35.0) 0 2 (28.6) 2 (20) B2 5 (8.3) 23 (100) 1 (14.3) 1 (10) D 17 (28.3) 0 3 (42.9) 2 (20) Virulence genes hlya 1 (1.7) cnf papc 10 (16.7) 0 2 (28.6) 1 (10) sfa/focde afa/drabc 1 (1.7) 23 (100) 0 1 (10) neuc 3 (5.0) 0 1 (14.3) 1 (10) iucd 46 (76.7) 23 (100) 5 (71.4) 8 (80) Classified as ExPEC 11 (18.3) 23 (100) 2 (28.6) 2 (20) Antimicrobial resistance to ciprofloxacin 35 (58.3) 23 (100) 4 (57.1) 4 (40) gentamicin 11 (18.3) 0 2 (28.6) 0 tobramycin 7 (11.7) 18 (78.3) 1 (14.3) 2 (20) trimethoprim/sulfamethoxazole 25 (41.7) 23 (100) 3 (42.9) 4 (40) Serotyping and MLST serogroup O25 2 (3.3) 23 (100) 1 (14.3) 0 molecular O25b subtype 1 (1.7) 23 (100) 0 0 serotype O25:H4 1 (1.7) 22 (95.7) 1 (14.3) 0 clone O25:H4-ST131 1 (1.7) 22 (95.7)

3 Serotypes, virulence genes and genetic diversity of ESBL-producing E. coli Infections were primarily classified as nosocomially or community acquired, in accordance with the classic CDC criteria. Episodes of community-acquired infections were further classified as healthcare-associated, following the criteria previously described elsewhere. 4 Proportions were compared between groups by Fisher s exact test. P, 0.05 was considered to denote significant differences. Typing of the afa operon was performed using the seven pairs of primers designed by Le Bouguénec et al. 13 (afae1, afae2, afae3, afae5, afae7, afae8, daae). Plasmid extraction, transfer and incompatibility typing were carried out as described previously. 14 Determination of plasmid size and identification of replicon content were established for transconjugants by hybridization of S1 nucleasedigested genomic DNA with probes specific for bla CTX-M-15 and different F replicons (FII, FIA, FIB). The results were confirmed by DNA sequencing of replicons. 15 The presence of genes previously associated with plasmids encoding CTX-M-15, i.e. bla OXA-1 and acc(6 0 )-Ib-cr, was determined by PCR. 7 The genetic environment of the bla CTX-M-15 gene was investigated by a specific PCR for upstream insertion elements (ISEcp1 and IS26) in isolates of clone O25b:H4-ST131 producing CTX-M Sequences relevant to this work have been deposited in the EMBL Nucleotide Sequence Database under accession numbers FM955458, FM and FM Results and discussion Of the 105 ESBL-producing E. coli isolates of the first part of this study, 60 (57.1%) were positive for CTX-M-14, 23 (21.9%) for CTX-M-15, 10 (9.5%) for SHV-12, 7 (6.7%) for CTX-M-32 and the remaining 5 isolates were positive for CTX-M-1, CTX-M-9, CTX-M-10, CTX-M-14b and SHV-2 (Table 1). Higher percentages of CTX-M-15-positive (22/23, 95.7%) and CTX-M-32-positive (6/7, 85.7%) isolates than CTX-M-14- positive (39/60, 65.0%) and SHV-12-positive (5/10, 50%) isolates were detected among nosocomial and healthcare-related infections. Eight (34.8%) of 23 CTX-M-15 isolates came from patients with residence in a nursing home compared with only 8 (9.8%) of 82 CTX-M-15-negative isolates (P, 0.001) [Table S1, available as Supplementary data at JAC Online ( oxfordjournals.org/)]. In a previous multicentre study during the first quarter of 2004, 92 ESBL-producing E. coli isolates from 14 hospitals across Spain were examined. The most prevalent ESBLs were CTX-M-14 (45.7%), CTX-M-9 (20.6%) and SHV-12 (21.7%). Furthermore, only four clusters of two strains each were detected. 3 Surprisingly, only a single isolate positive Figure 1. PFGE of XbaI-digested DNA from all 22 CTX-M-15-producing E. coli isolates of serotype O25b:H4, phylogenetic group B2 and MLST profile ST131. This unweighted pair-group method with arithmetic mean dendrogram was generated using BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) using the Dice coefficient. The scale above the dendrogram indicates percentage similarity. Using a 85% similarity cut-off point, PFGE identified only one cluster. 1137

4 Blanco et al. Figure 2. PFGE of XbaI-digested DNA from 56 CTX-M-14-producing E. coli isolates. Strain designation, serotype, phylogenetic group and VFs are shown on the right-hand side. Using a 85% similarity cut-off point, PFGE identified one cluster including two isolates of serotype O82:H21 and phylogenetic group B1. The remaining 54 isolates showed a genetic similarity,85% and were considered to be unrelated. 1138

5 Serotypes, virulence genes and genetic diversity of ESBL-producing E. coli Table 2. Triplex PCR specific for clone E. coli O25b:H4-ST131 producing CTX-M-15 with the new afa operon FM Gene Primer Oligonucleotide sequence ( ) Fragment size (bp) Annealing temperature (8C) Reference New afa operon FM AFA-O25F GAGTCACGGCAGTCGCGGCGG this study AFA-O25R TTCACCGGCGACCAGCCATCTCC rfbo25b rfb.1bis ATACCGACGACGCCGATCTG rfbo25b.r TGCTATTCATTATGCGCAGC 3 0 end of the bla CTX-M-15 gene CTX-M-F1 ATAAAACCGGCAGCGGTG CTX-M-F2 GAATTTTGACGATCGGGG for the CTX-M-9 enzyme (1.0%) was detected in the present study, showing an important change from the previous Spanish reports. 3,4 In contrast, we report the highest prevalence of CTX-M-15-positive isolates yet detected in Spanish hospitals. Serotyping of E. coli O and H antigens has appeared to be suitable for the identification of the major clonal types of human and animal pathogenic strains. To our knowledge, this is the first study that analyses the serotypes of E. coli producers of different ESBL types. Although the 105 ESBL-producing E. coli isolates belonged to 30 O serogroups and 54 different O:H serotypes, the majority (22/23, 95.7%) of CTX-M-15-producing isolates belonged to serotype O25:H4. Furthermore, the 23 CTX-M-15- producing isolates exhibited the O25b molecular subtype. 9 In contrast, the E. coli isolates producing other types of ESBLs showed great variation of serotypes [Table S2, available as Supplementary data at JAC Online ( Thirty-nine (37.1%) of 105 ESBL-producing E. coli isolates were classified as extraintestinal pathogenic E. coli (ExPEC) because they exhibited two or more virulence genes. All 23 CTX-M-15-producing E. coli were positive for iucd and afa/ drabc genes and thus showed the ExPEC status. In contrast, only 16 (19.5%) of the 82 CTX-M-15-negative isolates were classified as ExPEC (P, 0.001). All 23 CTX-M-15-producing E. coli isolates belonged to the most virulent group B2. In contrast, only 7 (8.5%) of the 82 CTX-M-15-negative isolates were derived from this phylogenetic group (P, 0.001). To more rigorously assess phylogenetic relationships within CTX-M-15 isolates of serotype O25b:H4, all 22 CTX-M-15 isolates of this serotype underwent seven-locus MLST. All 22 isolates were found to belong to ST131, indicating that all 22 isolates belonged to clonal group O25b:H4-ST131. An identical ST (ST131) was found in the CTX-M-14-producing isolate FV9053 of serotype O25b:H4 and phylogenetic group B2. In contrast, the two group D isolates with serotype O25a:H4 producing CTX-M-1 and CTX-M-32 displayed ST648. To our knowledge, this is the first study to detect clone O25b:H4-ST131 producing CTX-M-14 in Europe. This clone had been previously isolated in four different hospitals in Japan. On the other hand, we did not find clone O86:H18-ST38 producing CTX-M-9 that has also been detected in Japan. 17 Cluster analysis of DNA fingerprinting was performed on 95 isolates. Using a 85% similarity cut-off point, PFGE identified two clusters. All 22 CTX-M-15-producing E. coli isolates of serotype O25b:H4 and phylogenetic group B2 and MLST profile ST131 grouped in the same cluster (Figure 1). The second cluster included two CTX-M-14-producing isolates of serotype O82:H21 and phylogenetic group B1 (Figure 2). The remaining 71 isolates showed a genetic similarity,85% and were considered to be unrelated. All 22 isolates belonging to clonal group O25:H4-ST131 producing CTX-M-15 were not typeable using the seven pairs of primers designed by Le Bouguénec et al. 13 for afae subtyping. In contrast, the isolate O25:H4-ST131 producing CTX-M-14 showed the afae1 subtype. We have determined the nucleotide sequence of the afa operon of two representative isolates of O25b:H4-ST131 producing CTX-M-15 (FM and FM955460) and of the isolate O25b:H4-ST131 producing CTX-M-14 (FM955458). Two oligonucleotide primers (AFA-O25F and AFA-O25R) were designed to amplify a fragment of 207 bp of the new afa operon FM specific for isolates of O25b:H4-ST131 producing CTX-M-15. Furthermore, we have developed a simple triplex PCR for the identification of epidemic clonal O25b:H4-ST131 CTX-M-15- producing isolates based on the detection of the new operon afa, therfbo25b gene and the 3 0 end of the bla CTX-M-15 gene. The evaluation of this triplex PCR was carried out for the first 105 ESBL-producing isolates of this study (including 22 O25b:H4-ST131 CTX-M-15 afa FM955459), for 30 O25b:H4-ST131 CTX-M-15 strains isolated in seven countries from three continents (including two afa FM strains) 6 and for 100 ExPEC ESBL-negative isolates obtained in previous studies. 10,18 Only the 24 O25b:H4-ST131 CTX-M-15 afa FM isolates were positive with regard to the PCR amplification of the three targets, showing a 100% specificity and sensitivity [Table 2 and Figure S1, available as Supplementary data at JAC Online ( All clonal O25b:H4-ST131 isolates identified in our study were positive for the afa operon and were susceptible to gentamicin, as well as epidemic O25-ST131 strain A prevalent in the UK. 16 In contrast, the majority of clonal CTX-M-15-producing isolates spread in long-term care facilities and hospital institutions in Madrid (Spain) were gentamicin-resistant and negative for the afa/drabc sequence. 5 In the second part of this study, 249 ESBL-producing E. coli isolates recovered from April 2007 to May 2008 were investigated only for the detection of clone O25b:H4-ST131 producing CTX-M-15 using the triplex PCR developed in this study. A total of 54 (21.7%) O25b CTX-M-15 isolates with the new operon afa FM were identified. All isolates of this clone obtained in the first and second part of this study were grouped in the same cluster by PFGE. 1139

6 Blanco et al. The spread of a single clone in our hospital would suggest a nosocomial dissemination, mainly in the geriatric service; however, this outbreak of a CTX-M-15 O25b:H4-ST131 E. coli also affected nursing homes. Thus, of the 54 isolates of clone O25b:H4-ST131 producing CTX-M-15 recovered in the second part of our study, 27 (50.0%) isolates came from patients with residence in nursing homes located in different villages of the province of Lugo and in the city of Lugo. In view of these findings, long-term care facilities for elderly people may represent a significant reservoir for E. coli clone O25b:H4-ST131 producing CTX-M-15. The epidemic strain of clone O25b:H4-ST131 represented 23.1%, 22.5% and 20.0% of E. coli with ESBLs isolated in 2006, 2007 and 2008, respectively. CTX-M-15-positive O25b:H4-ST131 isolates with the new afa operon FM were recovered in 24 months of the 29 month study period. The first isolate was obtained in February 2006 and the last in May Thus, the rise in ESBL-producing E. coli isolates (from 3.8% in 2006 to 7.4% in 2008) not only reflects the clonal spread of this strain, but also other types. Multireplicon plasmids carrying FII and FIA replicons and the bla CTX-M-15 gene were identified in all 21 CTX-M-15-positive O25b:H4-ST131 isolates assayed in this study. IncF plasmids carrying the FII replicon in association with the FIA replicon and the bla CTX-M-15 gene were identified in epidemic strain A O25-ST131 prevalent in the UK and E. coli isolates from other countries, demonstrating that these multireplicon plasmids were the vehicles for the dissemination of the bla CTX-M-15 gene. 7,19 These plasmids might carry important, but still unknown, virulence factors (VFs) implicated in the spread of epidemic clone O25b:H4-ST131. The presence of genes previously associated with plasmids encoding CTX-M-15, i.e. bla OXA-1 and acc(6 0 )-Ib-cr, was determined by PCR in 25 isolates of clone O25b:H4-ST131 producing CTX-M-15. All 25 isolates contained the acc(6 0 )-Ib-cr gene and 23 isolates the bla OXA-1 gene. Like epidemic strain A, prevalent in the UK, 16 all Spanish O25b:H4-ST131 isolates investigated showed an IS26 element within the terminal inverted repeat of the ISEcp1-like element upstream of bla CTX-M-15, thus separating the bla CTX-M-15 allele from its usual promoter. The majority of ESBL-producing E. coli isolates analysed in this study lacked important extraintestinal VFs, such as P and S adhesins, Hly and CNF1 toxins and K1 invasive antigen. These classic VFs are very frequently associated with highly virulent ExPEC of serotypes O1:K1:H7, O2:H1/H-, O2:K1:H4/H6/H7, O4:H5, O6:H1/H-, O7:K1:H-, O15:K52:H1, O18:K1:H7, O22:K1:H1, O25:H1/H2, O45:K1:H7, O75:H5/H- and O83:H31 that cause urinary tract infection, urosepsis, septicaemia and neonatal meningitis. 18,20 The lack of important extraintestinal VFs suggests that many ESBL-producing E. coli isolates may be opportunistic pathogens of low virulence whose ability to cause disease is limited to compromised hosts, as is the case in the present study. However, CTX-M-15-producing isolates of clone O25:H4-ST131 have a substantial extraintestinal virulence capability. 6 The appearance of fluoroquinolone- and trimethoprim/ sulfamethoxazole-resistant CTX-M-15-producing isolates derived from phylogenetic group B2 with multiple VFs is a worrying development that deserves close attention. This might also explain in part the worldwide appearance of CTX-M-15- producing organisms. Acknowledgements We thank Monserrat Lamela, Angeles Espiño and Inés Trabado for skilful technical assistance. A. M. acknowledges the Ramón y Cajal programme from the Spanish Ministry of Education and Science. Funding This work was supported by grants from the Fondo de Investigación Sanitaria (Instituto de Salud Carlos III, Spanish Ministerio de Sanidad y Consumo, Spanish Network for Research in Infectious Diseases, REIPI, RD06/ ) (J. B.), the Spanish Ministry of Education and Science (AGL ) (A. M.) and the Autonomous Government of Galicia [grants PGIDIT05BTF26101P (J. B.), PGIDIT065TAL26101P (J. E. B.) and 07MRU036261PR (M. B.)]. Transparency declarations None to declare. Supplementary data Tables S1 and S2 and Figure S1 are available as Supplementary data at JAC Online ( References 1. Livermore DM, Canton R, Gniadkowski M et al. CTX-M: changing the face of ESBLs in Europe. J Antimicrob Chemother 2007; 59: Oteo J, Lázaro E, de Abajo FJ et al. Antimicrobial-resistant invasive Escherichia coli, Spain. Emerg Infect Dis 2005; 11: Diestra K, Coque TM, Miró E et al. Caracterización y epidemiología molecular de betalactamasas de espectro extendido en Escherichia coli y Klebsiella pneumoniae en once hospitales españoles (2004). Enferm Infecc Microbiol Clin 2008; 26: Rodríguez-Bano J, Navarro MD, Romero L et al. Bacteremia due to extended-spectrum b-lactamase-producing Escherichia coli in the CTX-M era: a new clinical challenge. Clin Infect Dis 2006; 43: Oteo J, Navarro C, Cercenado E et al. Spread of Escherichia coli strains with high-level cefotaxime and ceftazidime resistance between the community, long-term care facilities, and hospital institutions. J Clin Microbiol 2006; 44: Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V et al. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother 2007; 61: Coque TM, Novais A, Carattoli A et al. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum b-lactamase CTX-M-15. Emerg Infect Dis 2008; 14: Leflon-Guibout V, Jurand C, Bonacorsi S et al. Emergence and spread of three clonally related virulent isolates of CTX-M-15-producing Escherichia coli with variable resistance to aminoglycosides and tetracycline in a French geriatric hospital. Antimicrob Agents Chemother 2004; 48:

7 Serotypes, virulence genes and genetic diversity of ESBL-producing E. coli 9. Clermont O, Lavollay M, Vimont S et al. The CTX-M-15-producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J Antimicrob Chemother 2008; 61: Blanco M, Blanco JE, Alonso MP et al. Detection of pap, sfa and afa adhesin-encoding operons in uropathogenic Escherichia coli strains: relationship with expression of adhesins and production of toxins. Res Microbiol 1997; 148: Wirth T, Falush D, Lan R et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol 2006; 60: Blanco M, Blanco JE, Dahbi G et al. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (mb and jr/b2b). J Med Microbiol 2006; 55: Le Bouguénec C, Lalioui L, du Merle L et al. Characterization of AfaE adhesins produced by extraintestinal and intestinal human Escherichia coli isolates: PCR assays for detection of Afa adhesins that do or do not recognize Dr blood group antigens. J Clin Microbiol 2001; 39: Blanc V, Cortés P, Mesa RJ et al. Characterisation of plasmids encoding extended-spectrum b-lactamase and CMY-2 in Escherichia coli isolated from animal farms. Int J Antimicrob Agents 2008; 31: Hopkins KL, Liebana E, Villa L et al. Replicon typing of plasmids carrying CTX-M or CMY b-lactamases circulating among Salmonella and Escherichia coli isolates. Antimicrob Agents Chemother 2006; 50: Woodford N, Ward ME, Kaufmann ME et al. Community and hospital spread of Escherichia coli producing CTX-M extendedspectrum b-lactamases in the UK. J Antimicrob Chemother 2004; 54: Suzuki S, Shibata N, Yamane K et al. Change in the prevalence of extended-spectrum-b-lactamase-producing Escherichia coli in Japan by clonal spread. J Antimicrob Chemother 2009; 63: Bidet P, Mahjoub-Messai F, Blanco J et al. Combined multilocus sequence typing and O serogrouping distinguishes Escherichia coli subtypes associated with infant urosepsis and/or meningitis. J Infect Dis 2007; 196: Karisik E, Ellington MJ, Pike R et al. Molecular characterization of plasmids encoding CTX-M-15 b-lactamases from Escherichia coli strains in the United Kingdom. J Antimicrob Chemother 2006; 58: Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis 2000; 181: