Supplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato

Transcription

1 Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty of Agriculture, Institute of Plant Sciences, P.O. Box 12, Rehovot 76100, Israel 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA Correspondence to: Dani Zamir 1 zamir@agri.huji.ac.il Correspondence to: Zachary B Lippman 2 lippman@cshl.edu 1

2 Supplementary Figure 1. A genetic screen to identify genes causing heterosis for total fruit yield using heterozygous mutants in the M82 background. a. Statistical comparison of total fruit yields from a selection of 33 first generation (F1) heterozygous mutant hybrids tested at the Western Galilee agricultural experimental station in Akko, Israel (Supplementary Table 1). b. Statistical comparison of mutant hybrids from a second field location in Kfar Masaryk, Israel. The total yield mean values are per 1 m 2 (± standard error) from all 33 mutant heterozygotes (gray) and their isogenic control M82 (red) is presented. Each genotype was represented by at least ten replicates, except for a few 2

3 genotypes with 4-9 replicates due to poor germination. Some genotypes were tested in only one location due to a poor seed germination of mutant heterozygotes. Mean values for the tested genotypes were compared to the M82 isogenic line by using the compare with control (Dunnett) method. Genotypes presenting significantly higher yield than M82 by P < 0.05 are colored black. 3

4 Supplementary Figure 2. Heterosis for yield in tomato is inherited through meiosis and co-segregates as a single locus with sft/+ heterozygosity in an F2 population. Two F2 families segregating for the sft-4537 allele were combined and used to assay the Mendelian segregation of heterosis. Since no significant difference was detected between the two seed sources, the phenotypic data were pooled and compared among the three genotypic groups resolved using a molecular marker diagnosing the sft-4537 allele (Supplementary Table 4 and Online Methods). Bars represent mean values of total fruit yield per 1 m 2 (± standard error). The mean values of the heterozygous and homozygous sft-4537 genotypes were compared to their non-mutant isogenic M82 siblings using the compare with control (Dunnett) and significantly different means values (P < 0.05) are represented with an asterisk. The genotypes M82 and M82 x sft were compared directly in a completely randomized field trial, while low-yielding mutant lines were planted in a neighboring field block (Online Methods). 4

5 Supplementary Figure 3. Loss-of-function alleles for the SFT gene increases plant weight and vegetative biomass at the expense of inflorescence and flower production. Data for plant weight from three independently derived sft homozygous mutant alleles (Online Methods), the M82 inbred, and their F1 hybrid heterozygote (sft/+). Homozygous mutants of sft lack strong flower-promoting signals and are therefore late-flowering, show greater vegetative growth, and have much higher biomass compared to all other tomato genotypes. This is due primarily to a conversion of inflorescences into indeterminate vegetative shoots. The effect on plant weight is additive in sft/+ heterozygous plants, but more closely resembles the average weight of the M82 parent. The d/a value varied from -0.6 to 0.2 depending on the allele, and is consistent with the sft/+ heterozygotes more closely resembling M82 (Online Methods). Similar to total fruit yield and brix (Fig. 1b, c), mean values for plant weight in sft/+ heterozygotes were comparable to a leading commercial processing tomato hybrid AB2 (Online Methods). Mean values (± standard error) were analyzed using a multiple range mean comparison (Tukey-Kramer; P < 0.05). Different letters represent a significant difference. 5

6 Supplementary Figure 4. The number of inflorescences and leaves is increased along individual shoots of sft/+ heterozygotes. a-b. Inflorescence number (a) and total organ number (leaves plus inflorescences) (b) were compared between the shoots of M82 plants and sft/+ heterozygotes to determine if total fruit yield heterosis is based on a suppression of growth termination. Data were collected from five independent plants from each genotype where four shoots were counted for each genotype (Online Methods). Mean values (± standard error) per shoot were calculated and significance from a t-test analysis (P < 0.01) is presented by asterisks (**). The sft x M82 mean value was calculated from the combined data of sft-4537/+and sft-7187/+ heterozygotes since no statistical difference was observed between the two genotypes (data not shown). 6

7 Supplementary Figure 5. sft/+ heterozygous plants harboring a functional allele of the SELF PRUNING (SP) gene exhibit reduced heterotic effects. a-b Two environments (field and greenhouse) were used to assay the total yield effect of sft/+ heterozygosity in indeterminate (ID) lines (i.e. carrying at least one functional allele of SP). a. All possible isogenic combinations of SFT and SP alleles sharing the same M82 background were measured in the field for total yield and other phenotypic traits (data not shown and Online Methods). Homozygous M82 indeterminate (ID), M82 determinate (d) (white), their hybrid (light gray), and the equivalent lines harboring sft in the heterozygous state (dark grey) are presented. Due to the relatively large plant size of the M82-ID plants, the M82-d genotypes (sp/sp) were planted at the beginning of each randomized block. The average yields from these plants were the same as previous experiments. The sft x M82 data is presented from Figure 1 (right of the vertical hashed line) to demonstrate that the total fruit yields of sft/+ heterozygous M82-d plants is superior over all other possible genotypic combinations. Mean values (± standard error) were analyzed using a multiple 7

8 range mean comparison (Tukey-Kramer; P < 0.05). No statistically significant differences were observed in any pair-wise comparison among the indeterminate genotypes. b. A second yield trial was performed in greenhouse conditions, in which four pairs of isogenic indeterminate hybrids were compared for total yield (Online Methods). In all cases, heterosis was eliminated and no statistically significant differences were observed in any pair-wise comparison based on a t-test analysis at a confidence level of 95%. 8

9 Supplementary Figure 6. Analysis of transcript accumulation for SFT and its downstream floral target APETALA1/MACROCALYX (Sl-AP1) using real-time PCR. a-b Real-time semi-quantitative RT-PCR was used to detect transcript levels of SFT and Sl-AP1 in two homozygous mutant alleles of sft (sft-4537 and sft-7187) and their F1 hybrids with M82. a. Expression of SFT in young expanding leaves showed no more than two-fold change for all genotypes relative to M82, and no differences in expression were observed when comparing sft homozygotes to sft/+ heterozygotes. Although, the reason for this slight increase is unclear, it may relate to the molecular age of the leaves in sft genotypes or technical limitations in the accurate harvesting of precisely staged leaves. Still, PCR amplification and sequencing of reverse transcribed complementary DNA (cdna) from each heterozygous line indicated that both wild-type and mutant alleles were expressed at equal levels (31 WT alleles compared to 29 sft alleles). b. Expression of Sl-AP1, a developmental marker for the transition to floral identity, showed little or no change in the primary and first sympodial flowering shoot apices of sft/+ heterozygotes compared to M82 controls. Sl-AP1 was greatly reduced in expression in homozygous sft-4537 and sft-7187 mutants relative to their corresponding mutant heterozygotes and M82. 9

10 Supplementary Table 1. List of homozygous mutant lines selected for initial screening for heterosis. Thirty-three mutants affecting diverse traits were selected from a mutant library originating from a high-yielding inbred line known as M82. Included among this set were 10

11 mutants for which the responsible gene had already been identified. Each mutant was crossed with the parental non-mutagenized M82 to create isogenic mutant heterozygotes, and yields were compared with controls in two field locations. Selected mutants (e EMS derived numbers; n- Fast Neutron derived numbers) along with their primary affected phenotypic categories are listed ( as well as the field location(s) where each mutant and mutant heterozygote were tested. The m1 and m2 designation indicates if a particular mutant was either the first or second mutant identified, respectively, in a single M2 segregating family (e.g. e0064m2 was the second mutant identified in M2 family e0064). Seven mutants had known genes, and two were represented by two independent alleles. References for known genes are as follows: 1. Schumacher, K. et al., The Lateral suppressor (Ls) gene of tomato encodes a new member of the VHIID protein family. Proc Natl Acad Sci U S A 96 (1), 290 (1999). 2. Koenig, D. et al., Auxin patterns Solanum lycopersicum leaf morphogenesis. Development 136 (17), 2997 (2009). 3. Lifschitz, E. et al., The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proc Natl Acad Sci U S A 103 (16), 6398 (2006). 4. Schmitz, G. et al., The tomato Blind gene encodes a MYB transcription factor that controls the formation of lateral meristems. Proc Natl Acad Sci U S A 99 (2), 1064 (2002). 5. Lippman, Z. B. et al., The making of a compound inflorescence in tomato and related nightshades. PLoS Biol 6 (11), e288 (2008). 11

12 Supplementary Table 2. Heterosis due to sft/+ heterozygosity is robust across multiple growing conditions and environments. The mean values per 1 m 2 of total fruit yield (TYkg), brix (%) and brix-yield (BY-g/m 2 ) were measured for isogenic M82 plants and sft/+ heterozygotes. Experiments were performed under wide and dense spacing, using two irrigation regimes, in multiple locations (Online Methods). Increased percent effect of sft/+ heterozygotes beyond M82 controls were calculated in each condition and presented along with corresponding P values using a t-test analysis. Significant differences are highlighted by grey boxes (P < 0.001). The different densities and extreme growing conditions had a strong reducing effect on total fruit yield in some conditions (e.g. dense spacing, non-irrigated), which impacted all genotypes. As shown in Figure 4a, the later burst of inflorescences in sft/+ heterozygotes might explain the reduced heterosis in restrictive conditions (Supplementary Table 2; Figure 2a). For limited water, the sft/+plants are unable to carry a complete load of fruits despite producing a large number 12

13 of flowers. For high planting densities, larger plants compete for limited resources, thereby resulting in less fruit accumulation. Nevertheless, the consistent significant results observed for brix and brix-yield, along with the fact that sft/+ heterozygotes matched or exceeded M82 yields in all conditions, highlight the strong impact sft/+ heterozygosity has on heterosis and therefore its potential utilization for agriculture. Since the two tested sft/+ heterozygotes (sft-4537 x M82 and sft-7187 x M82) showed similar results in all field trials, their data were combined and presented as sft x M82. 13

14 Supplementary Table 3. Heterosis from sft/+ heterozygosity exceeds yields from full genome heterozygotes involving distinct genetic backgrounds. The determinate (sp/sp) genetic backgrounds E6203 (processing inbred) and M99 (large-fruited fresh market inbred) were evaluated for plant weight (PW), total fruit yield (TY), fruit weight (FW), brix (BX), and brix-yield (BY). The processing tomato lines E6203, M82, their hybrid E6203 x M82, and its isogenic line E6203 x sft were tested in both wide and dense spacing. The mean values presented reveal a robust heterotic effect driven by heterozygosity of sft, which exceeds full genome heterosis in all traits and under all tested conditions. The same heterotic effects were observed in crosses made with M99. Heterozygous sft/+ plants surpassed isogenic control hybrids and inbred parents for all traits except FW, mainly due to the large fruit size of the M99 line. The mean values were compared using multiple range comparisons (Tukey-Kramer; P < 0.05), where different letters represent a significant difference that are also highlighted with grey boxes. 14

15 Gene/Allele Forward Reverse Genotyping sft dcaps Rest. Enz. agttggaggagatgacctacgtacctttgtca atcactcggacttggagcat Tsp45I sft-4537 mut gacctacgtacctttttcat ctaccatctgctccctcaca N.A.* sft-7187 gggcaagaaatagtgagctatgaaa ttcaaataaattgagaggaagacaa Tse1 sft-stop ggcacgtaccagattctttagg ctaccatctgctccctcaca Bsl1 sp catgaattctttccttcctcagt gatggtcaaatcctcttttcagt ScrF1 RT-PCR Expressed tgggtgtgcctttctgaatg gctaagaacgctggacctaatg - SFT caccgatattccagctacca tgtttgccgacctaattgtc - Sl-AP1 ttcgatcgagaaagaaccaa ttagtttgctggtgccattc - Supplementary Table 4. PCR primers used in this study for genotyping and RT-PCR. For the primer pair sft-4537 mut, PCR amplification indicates only that the mutant allele (mut) is present.* Diagnostic of mutant allele only. 15