7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

Transcription

1 Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect a complementary sequence in a specimen (target sequence) Hybridization: Binding of complementary strands through formation of hydrogen bonds Marnie Imhoff, MBA, MLS (ASCP) CM UNMC School of Allied Health Clinical Laboratory Science Program mimhoff@unmc.edu Target Sequences Specific ACGT sequences within genes that are unique for that protein, organism or disease state ACGTTATGCGCATGTGAGGTACCTAA ACGCGTACACTCCA Target Sequences Oligonucleotides (short polymers of DNA or RNA) are synthesized to correspond to these unique regions Oligonucleotides are used as probes in hybridization reactions for the identification or detection of these specific sequences Nucleic Acid Probes Probes must be very specific. Synthesized in the laboratory Probes are labeled with enzymes, fluorescent, chemiluminescent or radioactive tags to allow for detection. Can be RNA, denatured DNA, or modified nucleic acids depending on the hybridization technique DNA Probes Oligonucleotides of nucleotides Length may depend on the target sequence and the technique Complementary to target molecule sequence Generally very stable Double stranded probes must be denatured before use 1

2 RNA Probes Highly specific Length depends on target sequence and technique used Less stable than DNA probes DNA manipulation Double stranded DNA can be melted apart (denatured) and will anneal (hybridize)using high temperatures or ph Annealing of DNA strands will be directed by complimentary alignment of nucleotide bases A to T or U G to C The presence of non-complimentary strands of nucleic acid DOES NOT affect the re-association rate of complimentary strands Hybridization Basis of direct probe assays Visualization 1. Radioactive 2. Chemiluminescence (colorimetric) 3. Fluorescence Hybridization Techniques Analysis of specific target sites without amplification Takes place in a solid support medium or in liquid Methods Southern blot Northern blot Western blot Dot (slot) blot Microarrays In-situ hybridization Hybridization Assay Three main steps Sample preparation Probe hybridization Detection Southern Blot Size of target DNA used in interpretation Various DNA sizes created by restriction enzymes 2

3 Southern Blot Southern Blot Procedure: DNA cut by restriction enzymes DNA fragments separated by electrophoresis Fragments denatured to single strands DNA transferred to solid support for detection Complementary probe used to detect target Probe contains label Probe signal is used to determine the presence or absence of the target sequence. Restriction enzymes Cleave DNA at specific recognition sites Highly specific for their recognition site Collectively called restriction endonucleases Differences in fragment lengths result from: Mutations Inheritance patterns Southern Blot: Transfer Nitrocellulose membrane most common Process is called blotting Transfer is by capillary action, vacuum or electrophoretic. Southern Blot Southern Blot: Transfer Capillary action Membrane placed on top of gel and absorbent material placed on top of membrane Buffer moves the DNA by capillary action Membrane is washed when transfer complete Buffer Membrane Absorbent paper Filter paper or paper towels Support Gel 3

4 Southern Blot: Transfer Vacuum Membrane placed on a porous plate The gel is placed on top of the membrane After transfer the DNA can be permanently bound to the membrane by UV crosslinking or baking in a vacuum oven. Southern Blot: Transfer Electrophoretic Gel placed on top of Whatman paper Membrane placed on top of gel Gel-membrane-paper, placed between two glass plates A second layer of Whatman paper is placed on top of the second glass plate The current carries the DNA from the gel to the membrane Membrane Whatman paper Glass plate Gel Whatman paper Membrane Porous plate Gel Vacuum Buffer Buffer Support Buffer Northern and Western Blot Northern 1. Targets RNA instead of DNA 2. Modification of the Southern blot Western 1. Targets protein instead of DNA 2. Modification of the Southern blot Southern, Northern and Western Blot: Detection Southern and Northern Blot use a single stranded probe Western Blot probes are binding proteins or antibodies. For visualization Western blots utilize a secondary antibody directed against the primary protein or antibody probe. Southern Blotting: Interpretation C C 4 5 Dot Blot Single stranded target Single stranded labeled probe Detect presence/absence of target Qualitative only 4

5 Dot Blot Technique Dot Blot - Interpretation Microarray Giant dot blot Probes immobilized Target is labeled Detects hundreds to thousands of genes DNA Chip Technology (Microarrays) ~200 microns 1,000 to 10,000 genes nanoliter volumes fluorescent detection Microarray in Practice Microarray: Interpretation 5

6 In Situ hybridization In Situ hybridization Cell morphology preserved Target detected in cells Provides information about distribution in cells Fluorescent In Situ Hybridization (FISH) Factors Affecting Hybridization Temperature ph Salt concentration: neutralize negative sugar-p backbone GC content, probe length: 3:2 H bonds per pair Environment: aqueous or non-aqueous Temperature Increased temperature Decreased temperature ph Most hybridization reactions adjusted to ph 6-8 6

7 Salt (NaCl) High salt concentrations 1. neutralize the negative charge of the sugar phosphate backbone 2. can force DNA strands together, even in the presence of non-complimentary regions Salt (NaCl) Low salt concentrations negativity of DNA cause a repulsion of DNA strands and reduced H bond formation between complimentary nucleotides GC Content GC bond strength stronger (3:2) than AT or AU Increasing the %GC in the oligonucleotide probe increases the: GC pairs formed strength of double helix formed temperature required to melt strands apart Oligonucleotide Probe Length Increase the length Decrease the length Aqueous vs. Non-aqueous Non-aqueous substances (formamide) destabilize mismatches (alignment of noncomplimentary regions) of oligonucleotide probe hybridization Non-aqueous substance reduce the temperature required to melt DNA strands apart Troubleshooting Much like other automated instrumentation Check temperature 1. Cold false positives 2. Hot false negatives Check fluid levels 1. No salt false negatives 2. Too much salt false positives Check visualization system 7

8 Summary Molecular testing detects target specific nucleic acid (DNA or RNA) ACGT sequences that are unique for an organism or disease state Oligonucleotide can be synthesized complimentary to target sequence DNA can be melted apart and it will re-anneal Summary Re-association of DNA strands is directed by complimentary alignment of nucleotide bases Hybridization affected by: temperature, ph, salt concentration, GC content, probe length and environment 8