Supplementary Information

Transcription

1 Supplementary Information Supplementary Figure 1. Elevated Smurf1 expression is associated with the progression of colorectal cancer. (a) The tumor microarray analysis with anti-smurf1 antibody. (b) Box plot of Smurf1 expression in colorectal tissues. The subjects were divided into four groups based on tumor volume, representing level 1 (Tumor volume 5 cm 3 ), level 2 (5 cm 3 <Tumor volume 10 cm 3 ), level 3 (10 cm 3 <Tumor volume 30 cm 3 ) and level 4 (Tumor volume>30 cm 3 ) expression of Smurf1. Data were analyzed by Kruskal-wallis test. (c) Box plot of Smurf1 expression in tumors with different N stages. Data were analyzed by Mann-Whitney U test. (d) MTS assay was performed. Cell proliferation was assessed every 24 hours. Data are presented as means ± s.d. Results were from a representative experiment performed in triplicate. 1

2 Supplementary Figure 2. A yeast two-hybrid screen identifies Nedd8 as an interaction protein of Smurf1. (a) The bait and the prey regions of Smurf1 and Nedd8 in yeast two-hybrid screen of human liver library are shown schematically. (b) All recovered interactors proteins are shown in recovered experiments and ORF pairs are identified in Supplementary Table 1. The No.1-20 of the interactors is ordered by recovered experiments testing. NC and PC represent negative control and positive control, respectively. 2

3 Supplementary Figure 3. Inverse correlation between Smurf1 and NEDP1 expression in colorectal cancers. (a) The tumor microarray analysis with anti-nedp1 antibody. (b) Smurf1 expression scores are shown as box plots, with the horizontal lines representing the median; the bottom and top of the boxes representing the 25th and 75th percentiles, respectively; and the vertical bars representing the range of the data. Colorectal cancer tissues were compared with matched adjacent normal tissues using the Wilcoxon test (n = 30). Representative images of immunohistochemical staining of Smurf1 expression in the same tumor from three cases are shown. Scale bars, 400 μm. Box plot of Smurf1 expression in matched tissues. Data was analyzed with the Wilcoxon test. 3

4 Supplementary Figure 4. Smurf1 interacts with Nedd8 and Ubc12. (a) Endogenous interaction of Smurf1 and Nedd8 in HCT116 cells. Both cell lysates and immunoprecipitates were analyzed by western blotting with the indicated antibodies. (b) GST pull-down assays were performed to detect the direct interaction between Smurf1 and Nedd8. Both input and pull-down samples were subjected to immunoblotting (IB) with anti-nedd8 and anti-gst antibodies. Input represents 10% of the sample used for pull-down. (c) GST pull-down assays were performed with His-Smurf1 and GST-tagged Nedd8, ubiquitin or SUMO-1. Different from GST-Ub and GST-SUMO-1, the Nedd8 protein was fused with a 36-kDa thrombin protein 4

5 upstream of the GST tag, resulting in the expression of a thrombin-gst-nedd8 protein of approximately 70 kda. Both input and pull-down samples were subjected to immunoblotting (IB) with anti-his and anti-gst antibodies. Input represents 10% of that used for pull-down. (d) Flag-Smurf1 was co-transfected with Myc-Nedd8 WT, I44A, or ΔGG into HCT116 cells. Interaction between Smurf1 and Nedd8 mutants were measured by co-immunoprecipitation assays. IgG HC, immunoglobulin heavy chain. (e) Mapping of the Nedd8-binding region on Smurf1. Nedd8 and the indicated Smurf1 mutants were transfected into HCT116 cells. Co-immunoprecipitation assays were performed. (f) Mapping of the ubiquitin-binding region on Smurf1. (g, h) Nedd8 or ubiquitin and the indicated Smurf1 HECT Y439A mutant were transfected into HCT116 cells. Co-immunoprecipitation assays were performed. (i) Ubc12 interacted with Smurf1 C699A as well as Smurf1 WT. 5

6 Supplementary Figure 5. Smurf1 neddylation is not promoted by MDM2. (a) Smurf1, p53 and MDM2 were transfected into HCT116 cells as indicated. In vivo neddylation assays were performed. MDM2 enhanced the neddylation of p53 but not that of Smurf1. (b) Smurf1 and p53 were transfected into the Mdm2 -/- p53 -/- MEF cells. The neddylation of Smurf1 was still detectable. By contrast, the neddylation of p53 was undetectable. 6

7 Supplementary Figure 6. Cysteine 426 is critical for Smurf1-mediated autoneddylation. (a) Simulated structure of the HECT domain of human Smurf1. Cys426 site and E2 binding pocket have been respectivly highlighted by dark blue and purple red. (d) Sequence alignment of the C426 site on Smurf1 among different species. (c-e) The indicated plasmids or sirnas were transfected into HCT116 cells. Flag antibody-immunoprecipitated Smurf1 proteins were analyzed by immunoblotting with anti-myc antibody to detect conjugated Nedd8. 7

8 Supplementary Figure 7. Identification of Smurf1 neddylation sites in the WW and HECT domains with mass-spectrometry analysis. (a, b) In vitro neddylation assays of no tagged Smurf1 WW+HECT protein, GST-Nedd8, His-Nedd8 E1/E2 reacted in the buffer (40 mm Tris-Cl, ph 7.4, 5 mm MgCl 2, 2 mm ATP, 2 mm DTT) at 37 C for 1h. After eluted out Nd E1, E2, GST-tag was cut off by thrombin, and coomassie blue staining of elutes from either purified neddylated Smurf1-WW+HECT (b, left panel) are shown. The whole sample was loaded on a 10% SDS gel and after coomassie-blue staining bands were excised and analyzed by mass spectrometry. The MS/MS spectrum of a triply charged ion at m/z for MH33+ corresponding to the mass of the neddylated peptide LHHIMNHQCQLKEPSQPLPLPSEGSLEDEELPAQR with the lysine 8

9 residue was modified. The labeled peaks correspond to masses of b and y ions of the modified peptides. The additions of 114 Dalton (mass of GlyGly) were observed for b12 ion demonstrating that neddylation was on the lysine residue. Total six lysines (K324, K495, K545, K558, K559, K667) were identified in the MS analysis. (b) To test whether these six sites are the sole neddylation sites in WW+HECT, we constructed the WW+HECT-6KR (K324R, K495R, K545R, K558R, K559R, K667R) mutant protein (right panel) and tested in the neddylation assay. The data showed that the neddylated bands were attenuated but not abolished, implying that other neddylation sites remain to be identified. A schematic diagram of the identified lysine sites is also shown. 9

10 Supplementary Figure 8. Nedd8 enhances the E3 ligase activity of Smurf1. (a) Knock-down of Ubc12 or UbcH5c by sirna transfection in HCT116 cells. In vivo Smurf1 ubiquitylation assay was performed in the depletion of Ubc12 or UbcH5c. (b, c) In vitro Smurf1 ubiquitylation assay in the presence of Nedd8-E1/E2, Nedd8 (WT or GG). Neddylated Smurf1 was purified on Ni 2+ -NTA Superflow Cartridges and then incubated with ubquitin E1 and E2 (UbcH5c or UbcH7). (d) Quantitative real-time PCR to assess the relative mrna levels of Smurf1 in HCT116 cells in the absence or presence of Nedd8. (e) HCT116 cells were transfected with increasing amounts of a dominant-negative Ubc12 C111S mutant. Aliquots of total lysates were immunoblotted to detect Smurf1. (f) NEDP1 was co-transfected with Smurf1 and Nedd8 as indicated. Smurf1 protein levels were measured by western blot. 10

11 Supplementary Figure 9. Nedd8 enhances the E3 activity of Smurf1 towards its substrates. (a, b) Smad5 or RhoA, Smurf1 and Nedd8 were co-transfected into HCT116 cells. Cell lysates were immunoblotted to detect Smad5 or RhoA protein levels and ubiquitylation. (c) Smurf1 WT and CA mutants were co-expressed with Smad5, ING2 or RhoA in HCT116 cells, and the substrates were detected by Western Blot. (d-f) 11

12 Smad5, RhoA, Smurf1 and Nedd8 with Roc1 knock down or not, were co-transfected into HCT116 cells. The sample were immunoblotted to detect Smad5 or RhoA protein levels and ubiquitylation. (g, i) Smurf1 WT and CA mutants were co-expressed with Smad4 in HCT116 cells, together with Roc1 knock down or not. Smad4 protein levels and ubiquitylation were measured. (h) Together with ectopic Roc1 or not, Smad4, Smurf1 and Nedd8 were co-transfected into HCT116 cells. Cell lysates were immunoblotted to detect Smad4 levels. (j) Nedd8 had no significant effects on the interaction between Smurf1 and its substrates. Interactions of Smurf1 and its substrates in the present of Nedd8 or not were assayed by co-immunoprecipitation. Both cell lysates and immunoprecipitates were analyzed by western blotting with the indicated antibodies. 12

13 Supplementary Figure 10. Neddylation of yeast Rsp5 also promotes the ubiquitin ligase activity. (a) Rub1, the Nedd8 homologue in yeast, could form conjugates and the conjugation is dependent on E1 Uba3, Ula1 and E2 Ubc12. HA tagged Rub1 expression plasmids were transformed into wide type or E1, E2 knock out cells before the total cell lysates were analyzed by western blot. The Pgk1 protein levels were checked as the loading control. (b) Mammalian Nedd8 could also form conjugates in yeast. (c, d) Identification of Rsp5 K45, K79, K458 as the potential diglycine residue conjugated sites by using liquid chromatography mass spectrometry (LC-MS)/MS analysis. Detailed information of MS/MS is shown in Supplementary Table 2. (e) Establishment of Rsp5 K45A yeast strains. Mutation of the K45 site of Rsp5 abolishes its Rub1 conjugation. 13

14 14

15 15

16 16

17 Supplementary Figure 11. Uncropped scans of the most important western blots. 17

18 Supplementary Table 1. The list of Smurf1 recovered interactors in Y2H No. Bait Prey Gene Prey Gene Full Name Symbol NM 1 Smurf1-WW+HECT USF2 upstream transcription factor 2 NM_ Smurf1-WW+HECT PSME3 proteasome activator subunit 3 NM_ Smurf1-WW+HECT PDLIM3 PDZ and LIM domain 3 NM_ Smurf1-WW+HECT PLA2G4C phospholipase A2 NM_ Smurf1-WW+HECT DNM1 dynamin 1 NM_ Smurf1-WW+HECT CTSF cathepsin F NM_ Smurf1-WW+HECT MFSD3 major facilitator superfamily domain NM_ containing 3 8 Smurf1-WW+HECT C11orf41 chromosome 11 open reading frame 41 NM_ Smurf1-WW+HECT WBP11 WW domain binding protein 11 NM_ Smurf1-WW+HECT TRIP6 thyroid hormone receptor interactor 6 NM_ potassium intermediate/small conductance 11 Smurf1-WW+HECT KCNN1 calcium-activated channel, subfamily N, NM_ member 1 12 Smurf1-WW+HECT TRAF4 TNF receptor-associated factor 4 NM_ Smurf1-WW+HECT WBP11 WW domain binding protein 11 NM_ Smurf1-WW+HECT Nedd8 neural precursor cell expressed, NM_ developmentally down-regulated 8 DnaJ (Hsp40) homolog, subfamily C, member 15 Smurf1-WW+HECT DNAJC30 NM_ Smurf1-WW+HECT DNM1 dynamin 1 NM_ Smurf1-WW+HECT ATN1 atrophin 1 NM_ Smurf1-WW+HECT DNM1 dynamin 1 NM_ potassium intermediate/small conductance 19 Smurf1-WW+HECT KCNN1 calcium-activated channel, subfamily N, NM_ member 1 20 Smurf1-WW+HECT SF3B4 splicing factor 3b, subunit 4 NM_

19 Supplementary Table 2. List of primer sequences Myc-Nedd8 Flag-Nedd8 His-Nedd8 Myc-Nedd8 GG Myc-Nedd8 I44A Flag-Smurf1 Flag-Smurf1 C373A Flag-Smurf1 C426A Flag-Smurf1 C530A Flag-Smurf1 C626A Flag-Smurf1 C726A His-Smurf1 His-Smurf1 WW+HECT Myc-Smurf1 primernedd8-1:5 -tctgtcgaccatgctaattaaagtgaag-3 primernedd8-2:5 -aatgcggccgcctatcctcctct cagagc-3 primernedd8-3:5 -aattgaattcaatgctaattaaagtgaag-3 primernedd8-4: 5 -taaggtaccctatcctcctctcag agc-3 primernedd8-4: 5 -taaggtaccctatcctcctctcag agc-3 primernedd8-5: 5 -aat tggatcctaatgctaattaaa gtgaag-3 primernedd8-1: 5 -tctgtcgaccatgctaattaaagtg aag-3 primernedd8-6:5 -aatgcggccgcctatctcagagcagccaa-3 primernedd8-1+primernedd8-7; primernedd8-8+primernedd8-2 primernedd8-7:5 -gcagaggctcgcatacagtggcaagcag-3 ; primernedd8-8:5 -tgccactgtatgcgagcctctgctgttg-3 primersmurf1-1: 5 -taagaattca atgtcgaacccc gggaca -3 primersmurf1-2:5 -taaggtacctcactccacagcaaacccgca -3 primersmurf1-1+primersmurf1-3; primersmurf1-4+primersmurf1-2 primersmurf1-3:5 -ggacacttcgatgcgagcatgaccagcttgggg-3 primersmurf1-4:5 -ccccaagctggtcatgctcgcatcgaagtgtcc-3 primersmurf1-1+primersmurf1-5; primersmurf1-6+primersmurf1-2 primersmurf1-5:5 -attcagcatttcatgagccagcaagtaaagcca-3 primersmurf1-6:5 -tggctttacttgctggctcatgaaatgctgaat-3 primersmurf1-1+primersmurf1-7; primersmurf1-8+primersmurf1-2 primersmurf1-7:5 -ggcgttgtgttccacagcgaaggtgtggtccag-3 primersmurf1-8:5 -ctggaccacaccttcgctgtggaacacaacgcc-3 primersmurf1-1+primersmurf1-9; primersmurf1-10+primersmurf1-2 primersmurf1-9:5 -gttgctgtcggccacagcgtgcttcagccgcgt-3 primersmurf1-10:5 -acgcggctgaagcacgctgtggccgacagcaac-3 primersmurf1-1+primersmurf1-11 primersmurf1-11:5 -taaggtacctcactccacagcaaacccagcggtctcctccacggc -3 primersmurf1-12: 5 -aagaattcatatgtcgaacccc gggacacgc-3 primersmurf1-13:5 -tactcgagactcactccacagcaaacccgca-3 primersmurf1-14:5 -aatctagaaaatgtgccgcatcgaagtgtcc -3 primersmurf1-15: 5 -aattggatcctaatgctgccc gaaggctacgaa-3 primersmurf1-16: 5 -tctgtcgaccatgtcgaacccc gggacacg -3 primersmurf1-17:5 -aatgcggccgctcactccacagcaaacccgc -3 19

20 Myc-Smurf1 1-14K Myc-Smurf K Myc-Smurf K Myc-Smurf K Myc-Smurf K GST-UbcH5c GST-Ubc9 GST-Ubc12 Myc-Ubc12 Flag-Ubc12 Myc-Ubc12 C111S GST-Ubc12 N26 GST-Ubc12 H88-D89A Flag-NEDP1 Flag-NEDP1 primersmurf1-16+primersmurf1-18; primersmurf1-19+ primersmurf1-17 primersmurf1-18:5 -gacacgagacagaataggaaccggcggc-3 primersmurf1-19:5 -gccgccggttcctattctgtctcgtgtc-3 primersmurf1-16+primersmurf1-20; primersmurf1-21+ primersmurf1-17 primersmurf1-20:5 -tctgtcgaccatgtcgaaccccgggacacg-3 primersmurf1-21:5 -aatgcggccgctcactccacagcaaacccgc-3 primersmurf1-16+primersmurf1-22; primersmurf1-23+ primersmurf1-17 primersmurf1-22:5 -ccccaagctggtcattgccgcatcgaagtgt -3 primersmurf1-23:5 -acacttcgatgcggcaatgaccagcttgggg -3 primersmurf1-16+primersmurf1-24; primersmurf1-25+ primersmurf1-17 primersmurf1-24: 5 -gaaatgctgaatccttattacgggctcttcc-3 primersmurf1-25: 5 -ggaagagcccgtaataaggattcagcatttc-3 primersmurf1-16+primersmurf1-26; primersmurf1-27+ primersmurf1-17 primersmurf1-26: 5 -ggatgcgaccgagagacttgagaagacggctgatggtgag-3 primersmurf1-27: 5-gagtggtagtcggcagaagagttcagagagccagcgtagG-3 primere2-1: 5 - attggatccatggcgctgaaacggatt aat-3 primere2-2: 5 - aataactcgagttcacatggcatactt ctgagt-3 primere2-3: 5 - attggatccatgtcggggatcgccctc agc -3 primere2-4: 5 - aataactcgagtttatgagggcgcaaa cttctt-3 primere2-5:5 -attgaattcatgatcaagctgttctcgctg-3 primere2-6:5 -atgcggccgctcctatttcaggcagcgctcaa -3 primere2-7:5 -aattgtcgacaatgatcaagctgttctcgctg - 3 primere2-8:5 -atatggtaccctatttcaggcagcgctcaaa - 3 primere2-9:5 -aattgaattcaatgatcaagctgttctcgctg-3 primere2-10: 5 - aattgtcgacctatttcaggcagcg ctcaaa-3 primere2-7+primere2-11; primere2-12+primere2-8 primere2-11:5 -tctgaggatgttgagagagacgttgccc-3 primere2-12:5 -ctcgagggcaacgtctctctcaacatcc-3 primere2-13: 5 -attgaattcatggcgtcggcggcgcag ctg-3 primere2-6:5 -atgcggccgctcctatttcaggcagcg ctcaa -3 primere2-5+primere2-14; primere2-15+primere2-6 primere2-14:5 -gggttacccggcagcaccccccaaggtgaag-3 primere2-15:5 -ccttggggggtgctgccgggtaaccctggcc-3 primernedp1-1:5 -taagaattcaatggaccccgtagtcttg a -3 primernedp1-2:5 -taaggtaccctactttttagcaagtgtg-3 primernedp1-1+primernedp1-3; 20

21 C163A primernedp1-4+primernedp1-2 primernedp1-3: 5 -tatcacgtacatccctgcgtcatagctg -3 primernedp1-4:5 -caaaacagctatgacgcagggatgtacg -3 RSP5 WT 5 -GTGAATTCATGCCTTCATCCATATCCGTCAAGTTAG GTCTCGAG TCATTCTTGACCAAACCCTATGGTTTCTTC -3 RSP5 K45A 5 -CAAATCTACATCCGCAGCGAAGGCAACGTTAAATCCCTACTGGAAT G CATTCCAGTAGGGATTTAACGTTGCCTTCGCTGCGGATGTAGATTTG -3 RSP5 K79A 5 -TGATCAAAAGAAATTTAAAAAGGCAGATCAAGGGTTTCTTGGCGT GG CCACGCCAAGAAACCCTTGATCTGCCTTTTTAAATTTCTTTTGATCA -3 RSP5 K458A 5 -ATTGCCGGGACAATGTCATATTGCAGTACGTAGAAAGAACATTTTT G CAAAAATGTTCTTTCTACGTACTGCAATATGACATTGTCCCGGCAAT -3 RSP5 C777A 5 -GTGAATTCATGCCTTCATCCATATCCGTCAAGTTAG ACAATTGCCAAAATCTCACACAGCATTTAACAGAGTTGATTTGCCA C -3 Myc-Vps9 5 -AAAAATCGCGTATTGGGCCCTGTGTTGATGCTCTACTTTCTCTGTCA GAAcgtacgctgcaggtcgac TACATATTGCTAGGCTACTCTATACATGAAATATGTGCATGAGATCAT TAatcgatgaattcgagctcg -3 GFP-Sna3 5 -CCGATGTGCCCTTGATGGACAACAAACAACAGCTCTCTTCCGGCCG TACTCgtacgctgcaggtcgac TCTATGTGTTATTTAGAACTACGGTGATAAAGAGCTCGTTCCGATCA CTAAtcgatgaattcgagctcg -3 Flag-Rub1 5 -GCGGATCCTACATGAATTTAACTTCGCAGTATCCAAAGTTG GCGAATTCGTATGCTTGGTTTGCTCTTTATCACCACGC ATTAACTTCCTTACAGCCGTAACCGatggattacaaggatgacgatgacaagATTG TTAAAGTGAAGACACTGACTG CAGTCAGTGTCTTCACTTTAACAATcttgtcatcgtcatccttgtaatccatCGGTTA CGGCTGTAAGGAAGTTAAT -3 21