Dominguez et al., 2005

Transcription

1 Dominguez et al., 005 SUPPLEMENTARY INFORMATION EXPERIMENTAL PROCEDURES Generation of BACE1 targeted ES cells- For the generation of the first BACE1 line (BACE1I), a 19/ola mouse cosmid library from RZPD (Resource Center of the German Human Genome Project) was screened with a partial cdna of mouse BACE1. The isolated mouse BACE1 cosmid clones contained the 5 part of the murine BACE1 gene. For construction of the targeting vector a 6 kb XbaI DNA restriction fragment of BACE1 covering exon 1 (supplementary figure 1) was subcloned into the plasmid vector pbluescript SKII+ (Stratagene). A SalI restriction site was introduced into the coding region by site directed mutagenesis. The neo expression cassette from pmc1neopa (Thomas and Capecchi, 1987; Stratagene) was inserted into this site located in exon 1 of a XbaI fragment (glutamate 19 of the BACE1 cdna). The insertion of the neo cassette introduces a premature translational stop codon into the open reading frame of the BACE1 gene. The targeting vector was introduced into the ES cell line MPI- (gift of Peter Gruss, Göttingen) by electroporation. G18 resistant colonies were screened by Southern blot analysis of DNA digested with SacI and hybridized with the 5 BglII probe (supplementary figure 1). For the generation of the second BACE1 knockout mouse line (BACE1II, developed in collaboration with Lexicon Genetics Inc.), genomic clones were isolated by screening of the 19SvEvBrd derived lambda pkos genomic library (1). A genomic clone spanning 10 kb of the BACE-1 gene spanning exon 3 up to exon 9 was used to generate the targeting vector via yeast-mediated homologous recombination. In this vector a 5 bp genomic fragment, spanning exon 3, was replaced by a floxed version of exon 3 including a 1.7 kb PGK-neo selection cassette flanked by two Frt sites. The NotIlinearized vector was electroporated into 19 Sv/Evbrd(LEX1) embryonic stem (ES) cells and G18- fialuridine (FIAU)-resistant ES cell clones were isolated and analyzed for homologous recombination by Southern blot analysis. Generation of BACE1 knock out mice- BACE1I: the mutated ES line EB5 was microinjected into blastocysts of C57BL/6J mice or aggregated with morolae from CD1 mice. Chimeric males were mated to C57BL/6J females or CD1 females in case of aggregation chimaeras. Mice were genotyped for the BACE1 gene mutation by Southern blot analysis of SacI-digested genomic DNA or by PCR analyses using a neomycin-specific PCR () and an exon-specific-pcr with primers 5 ATGGCCCCAGCGCTGCACTGGCTCC 3 and 5 CTGCCTACGGTCATCTCCACATAGTAG 3 flanking the exon used for interruption. Homozygous mutant mice were obtained by mating heterozygous mice. BACE1II: targeted ES cell clones were injected into C57BL/6(albino) blastocysts, and the resulting chimeras were mated to C57BL/6(albino) females to generate animals heterozygous for the mutation. In order to generate full BACE1 knockout animals, the above mentioned heterozygotes were crossed to the Protamine Cre mice and male descendants heterozygote for both the floxed BACE1 allele and the Protamine Cre transgene were crossed to C57Bl/6 females to obtain heterozygote BACE1 knock out animals. These were subsequently crossed to generate all three genotypes employed in the reported studies. Generation of BACE targeted ES cells- A bacterial artificial chromosome (BAC) library done from mouse ES 19 SvJ ReleaseII (Genome systems) was screened with a BACE cdna probe including exons 3 to 7 (PCR amplified from mouse BACE cdna using the primers 5 CTCCAAGGGCTTTGA 3 and 5 CCCATCATGGGCTGAATGT 3 ). A ~10 kb fragment of the BACE gene spanning from the EcoRV site within intron until the KpnI site in intron 6 (figure ) has been subsequently subcloned in the puc vector (HincII-KpnI sites). To create the targeting construct, a cassette consisting of a lox P site and the hygromycin resistant gene flanked by two frt sites was introduced at the ClaI site in intron 5. A second lox P site was subsequently introduced at the HincII site within intron 6. The fragment spanning from the Bsu36 I site (in intron 3) until the KpnI site (in 1

2 Dominguez et al., 005 intron 6) was excised from the plasmid and electroporated into 19 Ola ES cells. Homologous recombination in hygromycin-resistant clones was confirmed by Southern blot of EcoRV-digested genomic DNA using a 5 -external probe (I6, PCR amplified from genomic BACE DNA using primers 5' GGTACCTCACAGAAGGGTTTGTATTC 3' and 5' GACCTAACTGACATTACTTCCTTG 3') that detects an 8. kb fragment for the targeted locus. Homologous recombination at the 3 -end was confirmed in these clones by Southern blot of StuI-digested genomic DNA using the 3 -external probe E3 (PCR amplified from BACE cdna using the primer pairs 5' GCTGGACTGGCTTTGTTGGTGA 3' and 5' GCAGCATAAGCAAGTCCAAGG 3'). Generation of BACE knock out mice- Two positive ES cell lines were obtained and independently injected into blastocysts C57BL/6J mice and transferred to foster mothers. Germline transmission of the conditional allele was achieved for both lines. Chimeric males were then mated to C57BL/6J females. Offsprings heterozygote for the BACE-targeted allele were crossed with mice expressing Cre recombinase from the ubiquitous PGK promoter, resulting in a deletion of BACE exon 6 and therefore a full BACE knock out allele. Homozygous mutant mice were obtained by mating heterozygous mice. Generation of BACE1 BACE double knock out mice- Double knock out mice were obtained by mating the monogenic BACE1 and BACE deficient mouse lines. Quantitative RT-PCR- Quantitative RT-PCR analysis was used to show absence of the BACE1 transcript in BACE1II ainimals. Total RNA was isolated from different tissues using Trizol (Invitrogen; Carlsbad, CA) and first strand cdna synthesis was performed on 0.5 µg total RNA using random hexamer primers and SuperscriptII RT (Invitrogen; Carlsbad, CA). Quantitative PCR was performed on a ABIPrism 7700 cycler (Applied Biosystems; Foster City, CA) using a Taqman PCR kit. Serial dilutions of cdna were used to generate standard curves of threshold cycles versus the logarithms of concentration for ß-actin and BACE1. A linear regression line calculated from the standard curves allowed the determination of transcript levels in RNA samples from mice. The BACE1 primer-probe pair (primer 5 TGCCCCACACCCTTTCCT3 primer 5 CCTTTCGGAGGTCTCGATATGT3, probe 5 CATCGCTACTACCAGAGGCAGCTGTCCA3' [5']FAM [3']TAMRA) relative to actin (primer 5 CATCTTGGCCTCACTGTCCAC3, primer 5 GGGCCGGACTCATCGTACT3, probe 5 TGCTTGCTGATCCACATCTGCTGGA3 [5']FAM [3']TAMRA) was used to asses expression levels. Genotyping- Genotyping was performed on DNA extracted from mouse tail biopsy samples. To discriminate between BACE1I wild-type and targeted alleles, the primer set 5 ATGGCCCCAGCGCTGCACTGGCTCC3 and 5 CTGCCTACGGTCATCTCCACATAGTA G3 was used. For BACE1II, primers 5 ACCCTCAAAGTCTGACTGTG3 and 5 TCATGTTCTGCTCTGGGAGC3 were used, that amplify a 05 bp fragment from the wild type allele and 5 bp band from the Cre-excised allele. For genotyping BACE mice, the primers 5'GCTATAGAGACCAAAGCCCACAAATC3' and 5'GCCCGAATAACAAGAGCA TCAC 3' were used. Northern blot analysis- A pre-made Northern blot containing ~ µg of poly A+ RNA per lane from 8 different mouse tissues (Clontech) was used to detect the BACE mrna. The probe consisted of BACE cdna from exon to exon 9 and was PCR amplified from BACE cdna using the primers 5' TTGTGGACACTGGAAGCAG 3' and 5 TCATTTCCAGCGATGTCTGAC 3. The β- actin probe was done by PCR amplification using the primers 5 TCAATAGTGATGACCTG 3 and 5 AGACGGAAATCGTG 3. Histology- Conventional histology was made on wild type, BACE1, BACE and BACE1/ deficient mice, three.5- months old animals of each genotype. Light microscopy examination was done on sections of modified Bouin- or % paraformaldehyde (PFA) fixed tissue, embedded in

3 Dominguez et al., 005 paraffin, which were stained with hematoxylin and eosin. Immunohistology was performed as described (PNAS paper An H 1999) using antibodies against CD5, (BD Pharmingen) and F/80 (ATCC). FITC-labeled tyramide was used for signal detection (Perkin Elmer). Viruses- Vesicular stomatitis virus serotype Indiana (VSV-IND, Mudd-Summers isolate) was originally obtained from D. Kolakofsky, University of Geneva, Switzerland, and was grown on BHK cells in MEM with 5% FCS to virus stocks containing 10 9 pfu/ml. VSV neutralization assay- Serial -fold dilutions of 1:0 pre-diluted serum samples were mixed with equal volumes of VSV containing 500 pfu/ml and the mixtures were incubated for 90 min at 37 C in an atmosphere containing 5% CO. 100 µl of the mixture was transferred onto Vero cell monolayers in 96-well plates and incubated for 1 h at 37 C. Monolayers were overlaid with 100 µl of DMEM containing 1% methylcellulose, and incubated for h at 37 C. Then the overlay was removed and the monolayer was fixed and stained with 0.5% crystal violet dissolved in 5% formaldehyde, 50% ethanol,.5% NaCl. The serum dilution reducing the number of plaques by 50% was taken as titer (3). To determine IgG titers, undiluted serum was treated with an equal volume of 0.1 M -mercaptoethanol in PBS for 1 h at room temperature before samples were processed as described above. REFERENCES 1. Wattler, S., Kelly, M., and Nehls, M. (1999) Biotechniques 6, , 1158, Saftig, P., Peters, C., von Figura, K., Craessaerts, K., Van Leuven, F., and De Strooper, B. (1996) J Biol Chem 71, Kalinke, U., Bucher, E. M., Ernst, B., Oxenius, A., Roost, H. P., Geley, S., Kofler, R., Zinkernagel, R. M., and Hengartner, H. (1996) Immunity 5, SUPPLEMENTARY FIGURES figure 1. Generation of BACE1I knock out mice. A-D) BACE1I strain. E-G) BACE1II strain. A) Schematic representation of part of the BACE1 gene and targeting construct (BACE1I). The targeting construct was made by first subcloning the XbaI fragment of the BACE1 gene in pbluescript vector. S= SacI; B=BglII; X=XbaI. Subsequently, a neomycin-resistance cassette has been inserted within the first coding exon of BACE1, disrupting the open reading frame (site of interruption shown in B). Arrows in exon 1 indicate the primers used for genotyping. The position of the 5 - and 3 -probes as well as the size expected in Southern blotting analysis upon SacI and XbaI digestion, are indicated. Neomycin-resistant ES cells containing one copy of the appropriately disrupted locus were selected by Southern blot analysis of genomic DNA digested with SacI and probed with a 5 -external probe and further confirmed by digestion with XbaI and probing with a 3 - specific probe (not shown). Mice generated with the targeted ES cells also contained the targeted allele (C). Northern blot analysis of mrna isolated from brain, confirmed the absence of BACE1 mrna in the knock out mice (D). figure. Generation of BACE1II knock out mice. A) Schematic representation of part of the BACE1 gene and targeting construct (BACE1II). Grey boxes represent exons; black and grey arrow heads represent Frt and LoxP sites respectively; black arrows represent primers used for PCR genotyping. B) PCR analysis of mouse genomic DNA. The wild type and targeted allele give a 05 and 5 bp PCR product, respectively. C) Expression of the BACE1 transcript in brain, liver and kidney was abolished in the homozygous knockout mouse as determined by quantitative RT-PCR. figure 3. Generation of BACE knock out mice. A) Schematic representation of the BACE gene and the targeting construct. Scheme of the BACE gene consisting of nine coding 3

4 Dominguez et al., 005 exons. Indicated are the two aspartyl protease active sites (D T / S G T / S ) within exon and exon 6, respectively. The targeting construct and the sites of insertion of the sites and the hygromycinresistance cassette are shown at the top of the figure. The wild-type and the targeted loci with the position of the probes used in the Southern blot analysis are shown at the bottom. The fragments expected in the Southern blots for the EcoRV- and StuI digests are also indicated. B) Southern blot analysis of a positive ES clone. Two of the hygromycin-resistant ES clones gave the expected 8. kb fragment in Southern blot analyis using EcoRV digestion and the I6 5 -external probe. Homologous recombination at the 3 -end was confirmed by Southern blot of StuI-digested genomic DNA using the 3 -external probe E3. Shown are the results obtained for one of the two ES positive clones. C) Exon 6 is deleted in BACE knock out mice. RT-PCR analysis using mrna extracted from the indicated tissues of BACE +/+, +/- and -/- mice and exon 5- and exon 7-specific primers. Grey arrow heads, sites; black arrow heads, FRT sites; grey rectangle, hygromycin-resistant marker. Restriction enzymes: B36, Bsu36 I; EV, EcoRV, K, KpNI; S, StuI. figure. Histological analysis of BACE deficient mice. Representative histological sections of non-neuronal and neural tissues from wild type, BACE1 -/-, BACE -/- and double knock out (DKO) mice. Tissue sections of ~3- month old animals were stained with hematoxylin and eosin. No genotype-specific difference could be observed. figure 5. VSV infected BACE1 mice mount protective antibody responses. BACE1 deficient (BACE1 -/- ), heterozygous (BACE1 +/- ) and wild-type mice (BACE1 +/+ ) were intravenously infected with x10 6 pfu of VSV. On indicated days, blood was taken and the serum was analyzed for VSV neutralizing IgM (open circles) and IgG (filled squares) antibodies. Data shown are the mean of three mice per group ± SEM. One out of two similar experiments is shown.

5 A) Targetting construct genomic locus 5 -probe X X S X neo SBB X X S X xon1 E xon1 E xon1 E SacI= 7. kb XbaI= 7.6 kb 3 -probe Targetted locus SBB X X SacI= 8.6 kb xon1 E X neo Exon1 S XbaI= 6 kb X B) MAPALHWLLLWVGSGMLPAQGTHLGIRLPLRSGLAGPPLGLRLPRETDEESE... signalpeptide propeptide Interruption of BACE-1 ORF C ) D ) Southern SacI digestion 5 probe +/+ -/- +/- -/- 8.6 kb 7. kb Northern +/+ -/- 8 S XbaI digestion 3 probe +/+ +/- -/- 7.6 kb 6 kb BACE1 18 S β-actin Fig 1

6 A ) Targetting construct FRT PGK-neo FRT DTGS genomic locus DTGS Targetted locus FRT PGK-neo FRT Cre excised locus B) C) Fold change /+ +/- -/- +/+ +/- -/- +/+ +/- -/- +/+ -/- +/- brain liver kidney Fig

7 A) Targeting construct B su36 I ClaI E E5 E6 HincII I Kpn 10 kb Hygromycin BACE gene genomic locus DTGS EV B36 EcoRV= 9.7 kb StuI= 9. kb K EV S EV S EV E3-probe I6-probe Targeted locus S E3-probe StuI= 6 kb EV S EV S EV I6-probe EcoRV= 8. kb B) C) EcoRV wt wt tg StuI wt tg DTGS wt targeted wt targeted Liver Heart Lung Kidney +/+ +/- -/- +/+ +/- -/- +/+ +/- -/- +/+ -/- 36 bp E5-E6-E7 I6 probe (external 5 ) E3 probe (external 3 ) bp E5-E7 Fig 3

8 Wild-type BACE1-/- BACE-/- DKO Kidney Lung Liver Pancreas Heart Brain Fig

9 VSV neutralizing antibody titer 0 x [log] BACE1 -/- BACE1 +/- BACE-1 +/+ IgM+IgG IgG Days after infection Fig 5