DNA MICROARRAY FOR IDENTIFICATION OF FUNGAL PATHOGENS CAUSING INVASIVE FUNGAL INFECTIONS (IFIs) IN NEUTROPENIC PATIENTS ABSTRACT

Transcription

1 Egypt J. Med. Lab. Sci., Sep. 2008; 17(2):49-56 ISSN Original Article DNA MICROARRAY FOR IDENTIFICATION OF FUNGAL PATHOGENS CAUSING INVASIVE FUNGAL INFECTIONS (IFIs) IN NEUTROPENIC PATIENTS Mona H. El-shokry¹, Abeer A.El-Sayed¹, Ola I. Ahmed¹, Tamer M.Ahmed², Iman Z. Ahmed² 1 Microbiology and Immunology Department, 2 Internal Medicine Department, Faculty of Medicine, Ain Shams University. ABSTRACT Background: Opportunistic invasive fungal infections (IFIs) remain as important cause of morbidity and mortality. Candida and Aspergillus species are the most common fungi that cause disease in immunocompromised patients and transplant recipients. Aim of the Work: This study was designed to identify Candida and Aspergillus spp. as possible causes of IFIs in neutropenic patients with different hematological diseases, using high multiplexing capacity of DNA microarray (species identification array). Patients and Methods: Twenty eight patients admitted to Hematology unit-ain Shams University Hospitals with provisional diagnosis of IFI were enrolled in this study. Venous blood samples were collected to detect Candida and Aspergillus spp. using DNA microarray. Results: Nineteen out of 28 studied patients (67.9%) were infected with Candida and Aspergillus spp. Invasive aspergillosis constituted 13/19(68.4%) distributed as follows: A.fumigatus 6/19 (31.6%), A.flavus 4/19 (21%) and A.niger 3/19 (15.8%). On the other hand, IFI with Candida spp. constituted 6/19 (31.6%) distributed as follows; C.glabrata 3/19 (15.8%), C.tropicalis 2/19 (10.5%) and C.albicans 1/19 (5.3%). Duration of hospital stay (mean ± SD = 30.8±4 days) was statistically significant among the infected group in comparison to other patients (mean ± SD = 22.7±2.3 days). Conclusion: Nineteen out of 28 studied patients (67.9%) were infected with Candida and Aspergillus spp. Invasive aspergillosis constituted 13/19(68.4%), while Candidal infection constituted 6/19 (31.6%). DNA microarray represents a reliable method of potential use in clinical laboratories for parallel one-shot detection and identification of the most common fungal pathogens at the species level for prompt management of infection with tailored antifungal treatments. Key Words: Invasive fungal infection, Candida, Aspergillus, microarray. Corresponding Author: Dr. Abeer El-Sayed, Microbiology and Immunology Department, Faculty of Medicine, Ain Shams University, Cairo, Egypt, elsayed_abeer@yahoo.com, Mobile: INTRODUCTION The prevalence of invasive fungal infections (IFIs) has increased over the past three decades owing to the increasing numbers of immuno-compromised hosts. These infections are associated with significant morbidity and mortality (Sable, et al. 2008). The most important host defenses against fungi are neutrophils and alveolar macrophages. Patients with hematological diseases and hematopoietic stem cell transplant recipients are particularly prone to fungal infections due to marked neutropenia resulting from underlying disease, treatment with cytotoxic drugs, corticosteroids and other immuno-suppressive agents (Meersseman, et al. 2004; Garnacho-Montero, et al. 2005). The predominant nosocomial fungal pathogens causing IFI include Candida spp, Aspergillus spp., Fusarium spp., and other moulds (Hof, 2008). 49

2 DNA MICROARRAY FOR IDENTIFICATION OF PATHOGENIC FUNGI CAUSING INVASIVE FUNGAL INFECTIONS... Candida spp. may invade the body at certain sites like the intravenous (IV) tube, urinary catheter, tracheostomy tube, ventilation tubing or surgical wounds. If the infection spread through the bloodstream to the kidneys, lungs, brain or other organs, serious systemic complications would be caused (Badiee, et al. 2008). Repeated cycles of prolonged neutropenia and concomitant corticosteroid therapy increase the risk of filamentous fungal infection. Most filamentous fungal infections are caused by Aspergillus spp. (Segal, et al. 2002). Invasive aspergillosis (IA) has a high mortality rate of up to 60% or even higher if the diagnosis is delayed in patients receiving intensive chemotherapy and allogeneic stem cell transplantation, and may complicate solid organ transplantation (Meersseman, et al. 2004; Vandewoude, et al. 2004; Garnacho- Montero, et al. 2005). These infections are difficult to be diagnosed and cause high rates of morbidity and mortality. Early initiation of effective antifungal therapy and reversal of underlying host defects remain the cornerstones of treatment for nosocomial fungal infections (Richardson and Lass-Florl, 2008). Delay in IFIs treatment leads to higher relapse rates and increased therapy costs. Diagnosis of these infections with confidence and at an early stage of disease is vital (Wenzel, et al. 2005). The conventional identification of pathogenic fungi based on phenotypic features and physiological tests is time-consuming and, therefore, often imperfect for the early initiation of an antifungal therapy (Loeffler, et al. 2000). PCR-based assays were found to have promising sensitivity and specificity and demonstrated a potential value for the early diagnosis of IFI (Loeffler, et al. 2000). However, traditional methods in molecular biology generally work on a "one gene in one experiment" basis, which means that the "whole picture" of gene function is hard to obtain. Recently, DNA microarray has attracted tremendous interests among biologists. An array is an orderly arrangement of samples. It provides a medium for matching known and unknown DNA samples based on base-pairing rules and automating the process of identifying the unknowns. This technology promises to monitor the whole genome on a single chip so that researchers can have a better picture of the interactions among thousands of genes simultaneously (Spiess, et al. 2007). DNA microarray or DNA chips are fabricated by high-speed robotics, generally on glass but sometimes on nylon substrates, for which probes with known identity are used to determine complementary binding, thus allowing massively parallel gene expression and gene discovery studies. An experiment with a single DNA chip can provide researchers information on thousands of genes simultaneously (Leinberger, et al. 2005). Microarrays were also introduced for the rapid and simultaneous identification of Candida and non-candida yeasts, as well as moulds, such as Aspergillus spp. based on panfungal internal transcribed spacer (ITS) primers directed at the conserved regions between the 18S and 28S rrna, which were shown to correlate well with culture results (Klouche and Schroder, 2008). AIM OF THE WORK This study was conducted to identify three Candida and three Aspergillus spp in neutropenic patients with different hematological diseases using high multiplexing capacity of DNA microarray. PATIENTS AND METHODS Patients: This study included 28 patients admitted to hematology unit (Faculty of Medicine Ain Shams University, Cairo, Egypt) with different hematological diseases, during the period from January to May All patients suffered from: 1. Severe neutropenia (neutrophils< 500/ μl) for more than ten days. This neutropenia was secondary to different hematological disorders like; aplastic anemia, lymphoma, acute lymphoblastic leukemia, or acute myeloblastic leukemia. 50

3 EL-SHOKRY et al. 2. Persistent fever for more than ten days (with no localizing symptoms), which does not respond to the protocol of empirical antifungal therapy (Fluconazole 200mg/ 12hr) and empirical antibiotics therapy. The empirical antibiotics were advised with the maximum doses and in combinations according to the Regimens for empric therapy in neutropenic patients (Beutler, 2006). Methods: Venous blood samples (3ml) were collected from each patient in a vacutainer containing sterile EDTA. Blood was centrifuged and plasma was separated. DNA was extracted using Magna Pure Compact Nucleic Acid Isolation Kit (Roche-Germany Cat. No ) and the full-automated MagNa Pure Compact Instrument (Roche- Germany). The yield of total DNA obtained was determined spectrophotometrically. Universal fungal primers were used for amplification of the ITS1 and ITS2 regions. The sequence of primers is ITS1: 5'-TCCG- TAGGTGAACCTGCGG-3' (position 36-54) and ITS 4: 5'-TCCTCCGCTTATTGATATG-3' (position ), as described by White et al. (1990). The sequence of the forward primer ITS1 is complementary to a conserved region at the end of the 18S rrna gene, and the sequence of the reverse primer ITS 4 binds to a conserved region at the beginning of the 28S rrna gene, leading to amplification of the ITS regions and the 5.8S rrna gene, which is located between the non-coding ITS regions as shown in Figure (1) DNA amplification was performed in parallel to positive and negative controls. The positive control strain was isolated from clinical sample and identified by standard methods according to Collee et al. (1996).The negative control consisted of an equal volume of water replacing the DNA template. A total reaction volume of 50μl was prepared for PCR. The mixture contained 5μl of 10x reaction buffer (100mM Tris, 500mM KCL; ph8.3), 3μl of 25mM MgCl2, 1μl of 10mM PCR nucleotide mix, 2.5μl of each primer (20μM), 0.2μl of Taq DNA polymerase (5 units/μl) (Biogenet Korea), 500 ng of template DNA and DEPC treated water. The amplification was performed in a Mastercycler gradient (Eppendorf, Hamburg, Germany). An initial denaturation step (94 C for 5 min) was followed by 35 cycles (with each cycle consisting of DNA denaturation at 94 C for 30 S, primer annealing at 55 C for 30 S, and extension at 72 C for 1 min) and a final extension step at 72 C for 7 min. (Leinberger, et al. 2005). Amplified DNA products were separated by electrophoresis in a 1% agarose gel containing ethidium bromide (0.5 mg/ml); the running buffer was TAE (40 mm Tris acetate [ph 8.0], 1 mm EDTA). A 100-bp DNA ladder was used as a molecular size marker (Promega-USA). DNA bands were visualized by UV transillumination. Then, DNA was denaturated for 5 min at 95 C and stored at 20 C. Conserved regions served as targets for probes which are able to discriminate between Candida and Aspergillus (genus-specific probes) (Leinberger, et al. 2005). The probes were purchased from TIB MOLBIOL, Germany Table 1: Oligonucleotide probes sequence for identification of selected Candida and Aspergillus spp. Probes sequences Species Position CTTGAAAGACGGTAGTGGTAA Candida albicans TTACTACACACAGTGGAGTTTACT Candida glabrata AAACCAAACTTTTTATTTACAGT Candida tropicalis GGAGACACCACGAACTCTGT Aspergillus Flavus Fig. 1: Schematic representation of rdna region with primers ITS1 and ITS4 localization (arrows) (Korabecna, 2007). CCAACACGAACACTGTCTGA Aspergillus niger CCGACACCCAACTTTATTT Aspergillus fumagatus

4 DNA MICROARRAY FOR IDENTIFICATION OF PATHOGENIC FUNGI CAUSING INVASIVE FUNGAL INFECTIONS... Five μl of each sample (PCR product) were spotted on microarray slide at room temperature. Six slides were prepared and tested by one of the six probes. Positive and negative controls were included. Probes were left at room temperature to thaw, and then 100 μl of deionized H 2 O were added to each probe. Hybridization was performed under standardized conditions (Seifarth, et al. 2003). Slides were incubated for 30 min at room temperature. After hybridization, the slides were washed with 2x SSC (1x is 0.15 M NaCl plus M sodium citrate) with 0.1% sodium dodecyl sulfate, then 2x SSC, and finally, 0.2x SSC for 10 min each time. The washing procedure was performed at room temperature with agitation in a glass container (Leinberger, et al. 2005) Staining of microarray slides was performed using PARAGON DNA Microarray QC Stain Kit - with SYBR 555 stain and control slide (Invitrogen, USA, Cat P32930), according to manufacturer s instructions. Microarray slides were placed into a staining tube containing the prepared staining solution (27 ml of stain buffer was added to 30 μl SYBR Green nucleic acid stain concentrate). The slides were incubated in the staining solution for 5 minutes at room temperature thereafter the staining solution was poured off. Tubes (with slides inside) were centrifuged at 3000 rpm for 1 min with the tube lid off. Any remaining stain solution was decanted. Then fresh wash buffer (27 ml) was added and the slides were washed for 5 min with mild agitation. The working wash buffer was poured off and the slides were centrifuged at 3000 rpm for 1 min with the tube lid off. The remaining wash buffer was poured off, and centrifuged again for an additional 5 min with the tube lid off thereafter the Microarray slides were ready to be scanned. Each slide was imaged by Carl Zeis camera (Figure 3). Image analysis was performed by the fluorescent image analyzer, Image Pro-Plus to determine the optical density of each spot in addition to the positive and negative controls. Statistical analysis was done using the Epi Info version 6.04d (Dean, et al.1991). RESULTS The present study was conducted on 28 neutropenic patients (10 females and 18 males) with mean age ± SD (35.8 ±8.4 years) suffering from different hematological diseases.ninteen out of the 28 neutropenic patients (67.9%) were diagnosed to have invasive fungal infection. Aspergillus spp. were identified in 13/19 (68.4%) of the tested samples and Candida spp. were identified in 6/19 (31.6 %) of them. A. fumigatus was the main Aspergillus spp. identified in 31.6% (6/19) of the patients and C. glabrata was the main Candida spp. identified in 15.8% (3/19) of the patients. The distribution of Aspergillus and Candida spp. identified is shown in Figure (2). There is no statistically significant association between infections caused by Candida and Aspergillus spp. and the following factors; Diabetes Mellitus {DM}, steroids intake, inserted central line and/or urinary catheters (Table 2) Table (3) illustrates the association between IFIs and the duration of hospital stay. The duration of hospital stay was statistically higher among the infected group (p value=0.04) in comparison to other patients. 52

5 EL-SHOKRY et al. Fig. 2: Distribution of the identified species causing invasive fungal infections. C.tropicalis C.albicans C.glabrata A.flavus A.niger A.fumigatus Fig. 3: Fungus-specific fluorescence signals of different fungal spp in the 28 blood sample shown on the microarray slides. Positive controls are marked with the arrows. Table 2: Factors associated with invasive fungal infection. Risk Factors Relative risk Confidence interval P- value gender > 0.05 DM > 0.05 Steroid intake > 0.05 Central line > 0.05 Urinary catheter > 0.05 P value< 0.05 is significant Table 3: Association between IFIs and the duration of hospital stay. Risk factor Infected patients Other patients P-value Hospital-stay (days) Mean ± SD 30.8± ± P value< 0.05 is significant IFIs: Invasive Fungal Infections. 53

6 DNA MICROARRAY FOR IDENTIFICATION OF PATHOGENIC FUNGI CAUSING INVASIVE FUNGAL INFECTIONS... DISCUSSION IFIs remain as important cause of morbidity and mortality where the mortality from invasive yeast infections appears to be less than the mortality from invasive mould infections (Erjavec and Verweij, 2002). Patients in the present study suffered from different hematological diseases with fever that lasted more than 10 days and were not responding to empiric antibiotic therapy and thus empiric antifungal therapy was initiated as recommended by Segal et al. (2002) and Beutler (2006). The initiation of antifungal therapy can protect the patients from the serious complications (including death) that result from IFIs according to Wingard (2007). Neutropenia is the most important riskfactor for the development of invasive aspergillosis and systemic candidiasis in patients with cancer. This was evident in the present study as 19/28 (67.9%) of our patients had IFIs. Aggressive anti-neoplastic therapy and better control of other complications (e.g. haemorrhage and bacterial infections) lead to more risk of invasive fungal infections in these patients. In addition, the damage of the oropharygeal mucosa (through use of aggressive cytotoxic drugs) facilitates Candida colonization and subsequent invasion (Meunier, 1994; Vento and Cainelli, 2003). Previous studies on immuno-compromised patients revealed changeable spectrum of clinically relevant fungal pathogens causing systemic infections with considerable morbidity and mortality (Richardson and Lass-florl, 2008). In the present study, Aspergillus was themain genus isolated from the patients (69%). Our data were most consistent with Invasive Aspergillosis (IA) as being an emerging serious opportunistic infection in patients with different hematological malignancies who are receiving intensive chemotherapy, they are at risk for infections due to profound and prolonged neutropenia which contribute to the actual risk of IA during advanced stages of the disease as explained by Spiess et al. (2007). Moreover, Segal et al. (2002) proved that the risk of invasive filamentous fungal infection is directly related to the period of neutropenia. In our patients neutropenia lasted more than ten days and consequently increased the risk of aspergillosis. A. fumigatus was the main Aspergillus spp. isolated from (31.6%) of our patients, and this was consistent with many studies that reported that infection with Aspergillus spp are mainly due to A.fumigatus (Meunier, 1994; Richardson and Lass-florl, 2008). Candida spp. were detected in 6/19 (31.6%) of infected patients whereas C. glabrata was the main Candida spp. isolated from 3/19 (15.8%). It has been suggested that the widespread use of azoles in clinical settings could have contributed to changing the etiology of C. albicans candidemia toward non-c. albicans candidemia which now account for more than 50% of systemic Candida infections (Richardson and Lassflorl, 2008). Also, C. tropicalis is known to be an important cause of infections in patients with cancer and appears to be more virulent than C. albicans in patients with haematological malignancy as it was isolated from 2 out of 19 infected patients (10.5%). In a retrospective survey of candidiasis performed at the University Hospital Vienna between 2001 and 2006, the number of non-c. albicans infections increased, with C. tropicalis causing 7% which is similar to the isolation rate of our study (Presterl, et al. 2007) In the current study, assessment of factors for these infections is critical in initiating early antifungal therapy. The risk factors though were non significant but still promotes to invasive mycosis. However the only significant risk factor in the present study was the duration of hospital stay (30.8±4.8 days) that was consistent with Bonten et al. (1994) who stated that prolonged hospitalization acts as a risk factor for the development of nosocomial infections and Jovanovic et al. (2006) who reported that the risk for nosocomial infections in hospitalized patients in the intensive care units (ICUs) is higher than in patients staying in other wards. 54

7 EL-SHOKRY et al. The present study describes the setup of an up-to-date version of a DNA microarraybased system for the identification of the most common fungal pathogens in immuno-compromised patients in Egypt, encompassing 6 different spp. belonging to 2 genera. Indeed, the use of the panmicrobial chip may supersede the effective needs of the local diagnostic routine and may have high running costs. Therefore, we advise to establish a rapid low-cost, specific, and sensitive molecular method to detect and identify the most emerging fungal pathogens. Our DNA microarray used 6 chips one for each probe to decrease the financial cost and in the mean time to be able to detect clinically relevant fungal pathogens at low detection thresholds. Because of the rapidly developing resistance and multi-resistance types, empirical therapy is increasingly less predictable. At present, microarray with its broad-range pathogen identification approaches can thus not replace standard culture-based identification, but can be used as an adjunct for improvement of bloodstream infection diagnosis for prompt management of infection with tailored antifungal treatments. Conclusion and recommendations: Opportunistic fungal infections are associated with high rate of morbidity and mortality. In the present study, 19 out of 28 studied patients (67.9%) were infected with Candida and Aspergillus spp. Invasive aspergillosis constituted 13/19(68.4%), while Candidal infection constituted 6/19 (31.6%). Adequate measures must be defined for the optimal prevention and treatment of these infections, so the use of rapid, accurate and sensitive diagnostic method is mandatory. Since, several human fungal pathogens are characterized by high rates of intrinsic resistance. Therefore, identification of a fungal pathogen to the spp. level rather than antifungal drug susceptibility testing is presently the most important step in the selection of the adequate antifungal agent which can be achieved by using microarray technique. So, we recommend more studies on this diagnostic method as well the avoidance of empirical use of antibiotics and antifungal treatment in hospitals. REFERENCES Badiee, P., Kordbacheh, P., Alborzi, A., et al Study on invasive fungal infections in immunocompromised patients to present a suitable early diagnostic procedure. International Journal of Infectious Diseases, p Beutler, S. M Treatment of infections in the immunocompromised host. In Williams hematology, edited by S. Campbell. McGraw-Hill, p Bonten, M. J., Gaillard, C. A., van Tiel, F. H., et al The stomach is not a source for colonization of the upper respiratory tract and pneumonia in ICU patients. Chest 105(3): Collee, J. G., et al Mackie and McCartney's practical medical microbiology.14th ed. Edinburgh: Churchill Livingstone. Dean, A. G., Dean, J. A., Burton, A. H., and Dicker, R. C Epi Info: A general-purpose microcomputer program for public health information systems. American Journal of Preventive Medicine 7(3): Erjavec, Z., and Verweij, P. E Recent progress in the diagnosis of fungal infections in the immunocompromised host. Drug Resist Updat 5(1):3-10. Garnacho Montero, J., Amaya Villar, R., Ortiz Leyba, C., et al Isolation of Aspergillus spp. from the respiratory tract in critically ill patients: Risk factors, clinical presentation and outcome. Critical Care (London, England) 9(3):R Hof, H Developments in the epidemiolgy of invasive fungal infections - Implications for the empiric and targeted antifungal therapy. Mycoses 51 Suppl 1:1-6. Jovanovic, B., Mazic, N., Mioljevic, V., et al [Nosocomial infections in the intensive care units]. Vojnosanitetski Pregled. Military-Medical and Pharmaceutical Review 63(2):

8 DNA MICROARRAY FOR IDENTIFICATION OF PATHOGENIC FUNGI CAUSING INVASIVE FUNGAL INFECTIONS... Klouche, M., and Schroder, U Rapid methods for diagnosis of bloodstream infections. Clinical Chemistry and Laboratory Medicine: CCLM / FESCC 46(7): Korabecna, M The variability in the fungal ribosomal DNA (ITS1, ITS2 and 5.8S RNA gene): Its biological meaning and application in medical mycology. In Communicating current research and educational topics and trends in applied microbiology, edited by A. Méndez-Vilas. p Leinberger, D. M., Schumacher, U., Autenrieth, I. B., and Bachmann, T. T Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses. Journal of Clinical Microbiology 43(10): Loeffler, J., Hebart, H., Brauchle, U., et al Comparison between plasma and whole blood specimens for detection of Aspergillus DNA by PCR. Journal of Clinical Microbiology 38(10): Meersseman, W., Vandecasteele, S. J., Wilmer, A., et al Invasive aspergillosis in critically ill patients without malignancy. American Journal of Respiratory and Critical Care Medicine:170(6): Meunier, F Current issues on the prophylaxis and the management of fungal infections in leukemic patients. International Journal of Antimicrobial Agents 4(1): Presterl, E., Daxbock, F., Graninger, W., and Willinger, B Changing pattern of candidaemia and use of antifungal therapy at the University Hospital of Vienna, Austria. Clinical Microbiology and Infection: 13(11): Richardson, M., and Lass Florl, C Changing epidemiology of systemic fungal infections. Clinical Microbiology and Infection: 14 Suppl 4:5-24. Segal, B. H., Bow, E. J., and Menichetti, F Fungal infections in nontransplant patients with hematologic malignancies. Infectious Disease Clinics of North America 16(4): Seifarth, W., Spiess, B., Zeilfelder, U., et al Assessment of retroviral activity using a universal retrovirus chip. Journal of Virological Methods 112(1-2): Spiess, B., Seifarth, W., Hummel, M., et al DNA microarray-based detection and identification of fungal pathogens in clinical samples from neutropenic patients. Journal of Clinical Microbiology 45(11): Vandewoude, K., Colardyn, F., Verschraegen, G., et al Clinical relevance of positive Aspergillus cultures in respiratory tract secretions in ICU patients. Abstracts of the Interscience Conference on Antimicrobial Agents and Chemotherapy 44:360. Vento, S., and Cainelli, F Infections in patients with cancer undergoing chemotherapy: Aetiology, prevention and treatment. Lancet Oncol. 4(10): Wenzel, R., Del Favero, A., Kibbler, C., et al Economic evaluation of voriconazole compared with conventional amphotericin B for the primary treatment of aspergillosis in immunocompromised patients. The Journal of Antimicrobial Chemotherapy 55(3): White, T. J., Lee, B. S., and Taylor, J Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR protocols: A guide to methods and application, edited by M. A. Innes, D. H. Gelfand, J. J. Sninsky and T. J. White. San Diego: Academic Press. p Wingard, J. R New approaches to invasive fungal infections in acute leukemia and hematopoietic stem cell transplant patients. Best Pract.Res. Clin.Haematol. 20(1): Sable, C. A., Strohmaier, K. M., and Chodakewitz, J. A Advances in antifungal therapy. Annual Review of Medicine 59: