CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION. Recombinant DNA technology has revolutionized molecular biology and

Transcription

1 204 CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION SUMMARY Recombinant DNA technology has revolutionized molecular biology and genetics. Today, virtually any segment of DNA, the genetic material of all cells and of most viruses, can be isolated and replicated to provide sufficient quantities of genes to study their structure and expression. Cellular systems can be designed to produce large quantities of pure biological substances. In this chapter the aim was to use an RT-PCR product to produce PTP-1B recombinant protein for use in other applications. The PTP-1B PCR product was cloned into pbluescript II KS +/- and pgex-4t-1 expression vectors. Clones were selected by antibiotic resistance, restriction digestion and sequence analysis. Recombinant PTP-1B protein was produced by pgex-4t-1 expression vector, after stimulation with IPTG and purified with GST agarose. The purified recombinant protein was confirmed to be PTP-1B by western blot analysis using commercially available primary PTP-1B antibody.

2 205 The production of the recombinant PTP-1B protein will allow future production of an ELISA kit that could be used to quantitate PTP-1B protein expression, for example in patients using chemotherapeutic agents to better understand the dephosphorylation mechanisms involved with remission and cancer.

3 206 MATERIALS AND METHODS Cloning of the PTP-1B PCR product Growth and extraction of plasmid DNA E.coli containing either pbluescript II KS +/- phagemid or pgex-4t-1 expression vector was used to inoculated a flask containing 20ml LB broth (Appendix I) and grown overnight at 37 C with constant gentle rotation. Overnight cultures were centrifuged at 1500g for 15 minutes at 4 C. The cell pellet was resuspended with 2.5ml of glucose buffer (25 mm Tris-HCl, ph 8.0, 10 mm glucose and 10 mm EDTA) and 5ml of 0.2 M NaOH with 1% SDS and mixed gently by inverting the tube until the solution became clear and very viscous. The samples were placed on ice for 5 minutes and 4ml of ice cold potassium acetate solution (to make 100ml add 29.4g potassium acetate, 11.5 ml glacial acetic acid and make up to 100 ml with distilled water) added to the mixture. The samples were mixed by inverting the tubes until the viscosity was reduced and a large precipitate formed. The mixture was recentifuged at 1500g for 10 minutes at 4 o C and the supernatant filtered through a nylon fabric filter into a fresh eppendorf tube. To extract the plasmid from the solution the QIAquick DNA purification kit was used according to the protocol given. Samples containing plasmid were stored at -20 o C until required.

4 207 Preparation and storage of competent TOP 10 E.coli cells LB broth (5ml) was inoculated with a single Top 10 E.coli colony using a sterile loop and incubated overnight at 37 C in a rotating incubator. One milliliter of overnight culture was transferred to 100ml of pre-heated LB broth, incubated at 37 o C until the absorbance value of the culture at 650nm was almost 0.4 and placed on ice for 10 minutes. The culture was centrifuged at 5000g for 20 minutes and the bacterial pellet was carefully resuspended in about 10ml of transformation buffer (Appendix I.4) and store at -70 C for not more than 3 months. Ligation reaction The ligation reaction was prepared by combining ±100ng of insert and ±30ng of vector with 2µl DNA ligase buffer, 2µl of T 4 ligase enzyme and sterile Baxter water to make up the reaction volume to 20µl. Ligation took place overnight at 16 o C and competent Top 10 E.coli was transformed with the ligation reaction to incorporate cloned vector.

5 208 Transformation protocol Transformation was carried out by combining 1ng of cloned plasmid and 20µl of competent E.coli. The mixture was placed on ice for 20 minutes, transferred to a waterbath at 42 C for 90 seconds and returned to ice for 2 minutes. Eighty microliters of LB broth was added to the mixture, incubated at 37 C for 45 minutes with gently rotation, plated onto LB agar containing appropriate selector antibiotics and incubated at 37 C overnight in an inverted position. Testing bacteria for α-complementation Transformed E.coli were plated on LB agar containing 50µg/ml ampicillin, 40µl of X-gal (20 mg/ml in dimethylformamide) and 4µl of isopropylthio-β-dgalactoside (IPTG) (200 mg/ml). X-gal is very expensive and therefore can be spread on the surface of the agar plate rather then incorporating the sugar throughout the volume of the agar medium. A stock solution of X-gal was prepared by dissolving X-gal in dimethylformamide to make a 20 mg/ml solution and storing at -20 o C wrapped in foil to prevent damage from light. The IPTG solutions are prepared by dissolving 2 g of IPTG in 10ml of H 2 O and sterilizing by filtering through a 0.22-micron disposable filter and storing at -20 C.

6 209 Using a sterile glass spreader X-gal and IPTG were spread over the entire surface of the agar plate, incubate upside down at 37 C until all of the fluid evaporated. Colonies that contained active β-galactosidase were pale blue in the centre and dense blue at their periphery, while colonies containing the inserted DNA were white in colour. Expression of recombinant protein White colonies which contained the transformed vector were selected and grown in LB broth overnight at 37 o c. One milliliter of overnight culture was transferred to 1ml of fresh LB broth, grown for one hour at 37 o C and induced with 1mM IPTG for 3 hours. Cultures were centrifuged for 5 minutes at 13000g and the cell pellet resuspended with 100µl of lysing buffer (1% Triton X-100, 0.03% SDS, 10mM EDTA, 2mM PMSF all made up in PBS). Samples were freeze-thawed in liquid nitrogen and centrifuge at 13000g for 15 minutes. The supernatant containing the recombinant protein was transferred to a new eppendorf tube and store at -20 o C until required. Purification of recombinant protein Recombinant PTP-1B protein was purified using the GST microspin purification kit (Amersham).

7 210 RESULTS Restriction endonuclease digestion of pbluescript Bluescript II KS +/- plasmid was grown in Top 10 E.coli overnight, extracted, purified and restriction digested with restriction endonucleases in preparation for cloning (figure 48). Figure 48: Agarose gel electrophoresis (0.5%) of pbluescript II KS +/- phagemid digested with restriction endonucleases. Lane 1: molecular weight markers, lane 2: pbluescript II KS +/- phagemid (PBS II KS) undigested, lane 3: PBS II KS digested with BstZI (producing a 2961 bp linearized fragment), lane 4: PBS II KS digested with PVU II (producing two fragments of 2513 and 448 bp), lane 5: PBS II KS digested with TRU 9I (producing nineteen fragments of 876, 365, 354, 271, 235, 226, 138, 125, 98, 59, 53, 52, 39, 17, 14, 12, 11, 11 and 5 bps).

8 211 Alkaline phosphorylation of restriction digested pbluescript vector Bluescript plasmid (PBS II KS) was digested with Bst ZI to produce a linear fragment of 2961 bp, which was alkaline phosphorylated to prevent self annealing and increase ligation efficiency (figure 49). Figure 49: Agarose gel electrophoresis (0.5%) of alkaline phosphorylated Bluescript plasmid digested with restriction endonuclease BstZI.

9 212 Preparation of PCR product for cloning PTP-1B RT-PCR product digested with Eae I restriction endonuclease produced three fragments (558, 104 and 91 bp). The 558 bp fragment (figure 50) was cut out of the 1% agarose gel and purified with the Quigen gel purification system to ligate into alkaline phosphorylated Bluescript plasmid digested with BstZI (figure 49) Figure 50: Agarose gel electrophoresis (1%) of PCR product digested with restriction endonuclease Eae I. Lane 1: 1µl PCR product (753 bp), lane 2: 1µl PCR product digested with Eae I (91, 104 and 558 bp), lane 3: 1µl of PCR product (753 bp), lane 4: 5µl of PCR product digested with Eae I (91, 104 and 558 bp). Lanes 3 and 4 were loaded 30 minutes after lanes 1 and 2. The 558 bp band from lane 4 was cut out from the gel and purified using Quigen columns.

10 213 The ratio of insert to vector was checked prior to ligation. Figure 51 is an agarose gel depicting alkaline phosphorylated Bluescript vector digested with BstZI and purified PTP-1B PCR product digested with Eae I (558 bp). Figure 51: Agarose gel electrophoresis (1%) of Bluescript vector and PTP- 1B insert. Lane 1: 1µl Bluescript vector digested with BstZI, lane 2: 5µl of PTP-1B PCR product digested with Eae I (558 bp, from figure 50).

11 214 Graphical representation of bluescript II KS+ vector Figure 52: Diagram of pbluescript II KS+ vector demonstrating the restriction digestion sites used to clone the 558 bp PTP-1B PCR product.

12 215 Graphical representation of PTP-1B PCR fragment insert orientation in pbluescript II KS+ vector clone Figure 53: Diagram of PTP-1B PCR product insert orientation. Figure above: A to B orientation of insert would give rise three fragments when digested with restriction endonuclease Pvu II (566, 440 and 2513 bp) Figure below: B to A orientation of insert would give rise to three fragments when digested with restriction endonuclease Pvu II (274, 732 and 2513 bp).

13 216 PTP-1B pbluescript II KS+ clone selection Five white colonies were selected and grown overnight in LB broth. Cultures were centrifuged at 3000g for 10 minutes and plasmids extracted. Each purified plasmid sample was digested with AVA I to release the 404bp fragment of PTP- 1B, confirming the presence of a positive clone as shown for clones 1 and 4. The smears seen in lanes 3, 3#, 5 and 5# is DNA breakdown. Figure 54: Agarose gel electrophoresis (1%) of clones selected to confirm PTP-1B PCR fragment insertion. Lane 1: Bluescript plasmid undigested. Five bacterial colonies were selected as numbered above (1, 2, 3, 4 and 5) and tested for the presence of insert by restriction endonuclease digestion with AVA I (1#, 2#, 3#, 4# and 5#). Clones 1 and 4 tested positive for insert since they released a 404 bp insert fragment when digested with AVA I.

14 217 PTP-1B pbluescript II KS+ clone orientation check Positive clones were digested with PVU II restriction endonuclease to allow the orientation of PTP-1B inserts to be determined. Clones 1 and 4 (figure 54) were selected to check orientation, clone 1 (lane 2) had an A to B orientation and clone 4 (lane 3) a B to A orientation (figure 55). Figure 55: Agarose gel electrophoresis (1%) to check PTP-1B insert orientation. Clones were digested with PVU II restriction endonuclease to check orientation of insertion. Lane 1: control Bluescript digestion producing 2 fragments (448 and 2513 bp), lane 2: clone #1 digestion producing 3 fragments (440, 566 and 2513 bp), lane 3: clone #4 digestion producing 3 fragments (274, 732 and 2513 bp). Due to incomplete digestion with PVU II another band below the 2513 bp fragment can be seen in all three lanes, this is undigested circular Bluescript.

15 218 Graphical representation of PTP-1B PCR product cloning in pbluescript KS+ vector Figure 56(a): Graphical representation of PTP-1B cloning. A= PTP-1B RT- PCR product digested with Eae I (558 bp), B= segment of pbluescript multiple cloning site, indicating Bam HI and Bst ZI restriction digestion sites, C= A-B orientated PTP-1B (558 bp) clone of pbluescript, X= base pair change responsible for Bst ZI restriction enzyme not being able to digest at its previous digestion site after PTP-1B was cloned successfully into pbluescript.

16 219 pbluescript KS+ PTP-1B clone sequencing The A-B orientated PTP-1B (558 bp) clone of pbluescript was sequenced using KS primers (figure 56(b)). The presence of the PTP-1B insert can be seen from base pair 51 onwards. Figure 56(b): Graphical representation of bluescript PTP-1B clone sequencing.

17 220 pbluescript KS+ PTP-1B clone 1 restriction digestion Bluescript KS+ PTP-1B clone 1 (A-B orientation) was digested with BamHI and Bst ZI to release a modified 577bp PTP-1B insert (figure 57). The released modified insert was re-cloned into pgex-4t-1 fusion expression vector to produce a recombinant PTP-1B protein. Figure 57: Agarose gel electrophoresis (1%) of clone 1 digested with BamHI and Bst ZI. A 577 bp PTP-1B fragment was released as shown above.

18 221 Graphical representation of pgex-4t-1 expression vector The pgex-4t-1 expression vector was selected to produce a recombinant protein of PTP-1B. Figure 58 is a graphical representation of the pgex-4t-1 expression vector showing all its main features. Figure 58: Map of pgex-4t-1 expression vector (Adapted from Amersham Pharmacia Biotech manual).

19 222 Restriction digestion of pgex-4t-1 expression vector The circular pgex-4t-1 expression vector was digested with restriction endonucleases Bam HI and Bst ZI to clone the modified 577bp PTP-1B fragment digested out of Bluescript clone 1 (A-B orientation). Figure 59: Agarose gel electrophoresis (0.5%) of pgex-4t-1 GST expression vector restriction digested with Bam HI and Bst ZI. Lane 1: pgex-4t-1 undigested, lane 2: pgex-4t-1 vector digested with BamHI and Bst ZI to produce a linear vector. The vector was not alkaline phosphorylated since dissimilar sticky ends were produced.

20 223 PTP-1B pgex-4t-1 clone selection The modified 577bp PTP-1B insert was ligated into pgex-4t-1 expression vector. Colonies were selected by colour and antibiotic resistance. Clones were selected by size (lanes 2, 3 and 4 [figure 60]) Figure 60: 1% Agarose gel electrophoresis of pgex-4t-1 PTP-1B clone selection. Lane 1: pgex-4t-1 (native), lane 2, 3 and 4 pgex-4t-1 vector clones. All three colonies selected have the PTP-1B insert since they are larger in size then the native vector.

21 224 PTP-1B pgex-4t-1 clone restriction digestion The three clones described in figure 60 (#1, #2 and #3) were digested with AVA I to release a 404 bp PTP-1B insert (lanes 3, 4 and 5 are positive clones) Figure 61: Agarose gel electrophoresis (1%) of pgex-4t-1 clones digested with restriction endonuclease AVA I. Lane 1: pgex vector undigested, lane 2: pgex vector digested with AVA I, lane 3, 4 and 5 are pgex clones digested with AVA I, demonstrating the PTP-1B insert (404 bp).

22 225 PTP-1B pgex-4t-1 clone sequencing A positive PTP-1B pgex-4t-1 clone was sequenced using a pgex5 primer (5 - d[gggctggcaagccacgtttggtg]-3 ; figure 62). The PTP-1B insert can be seen from base pair 58 onwards. Figure 62: Graphical representation of pgex-4t-1 PTP-1B sequencing.

23 226 Expression of PTP-1B recombinant protein BL-21 E.coli were transformed with a purified PTP-1B pgex-4t-1 clone and stimulated with IPTG for 3 hours. A 46 kda recombinant PTP-1B protein was produced (lane 6) and purified using GST agarose (lane 7, figure 63). Figure 63: SDS-PAGE (10%) of purified PTP-1B recombinant protein. Lane 1: molecular weight markers, lane 2: HL-60 cell total protein lysate, lane 3: uncloned p-gex-4t-1 vector, lane 4: uncloned pgex-4t-1 vector stimulated to produce GST protein, lane 5: PTP-1B cloned pgex-4t-1 vector, lane 6: PTP- 1B cloned pgex-4t-1 vector stimulated with IPTG to produce the recombinant PTP-1B protein, lane 7: GST agarose purified PTP-1B protein from lane 6.

24 227 Western blot analysis of recombinant PTP-1B protein Purified recombinant PTP-1B protein was checked by western blot analysis using commercial available PTP-1B primary antibody (figure 64). The western blot analysis confirmed the presence of the recombinant PTP-1B protein by comparing it to wild type PTP-1B (lanes 2 and 3) protein. Figure 64: Western blot of PTP-1B recombinant protein. Lane 1: purified recombinant PTP-1B protein (thrombin uncleaved), lane 2 and 3: HL-60 cells (wild type) total protein extract, 40µg and 80µg respectively.

25 228 DISCUSSION The PTP-1B mrna sequence was carefully analysed for PCR primers and restriction digestion sites. Primers were selected to be specific and have high annealing temperatures to improve PCR efficacy. The RT-PCR reaction was optimized for cdna template-, Taq DNA polymerase-, MgCl 2 - and primerconcentration. A 753bp PTP-1B RT-PCR product was produced, ready to clone into Bluescript II KS+ and pgex-4t-1 expression vectors. Both vector clones were checked for PTP-1B insert by restriction digestion and DNA sequence analysis. Recombinant PTP-1B protein was successfully produced by stimulation transformed BL-21 E.coli with 1mM IPTG for 3 hours. The recombinant protein was purified with GST agarose and checked by western blot analysis using commercially available PTP-1B primary antibody. Future experiments aim to produce large quantities of recombinant PTP-1B protein, with a view to produce an ELISA method that would allow rapid quantitation of PTP-1B protein and which could be used to provide further understanding of the mechanisms involved in cell proliferation, differentiation and transformation. Such an approach could be applied in the clinical context,

26 229 giving rise to information which may be helpful in diagnosing and treating diseases such as cancer.

27 230 CONCLUSION Life is fascinating and full of cyclical patterns. Oscillatory behaviour not only contributes to life itself, but also determines the properties and behaviour of cells, and the molecular mechanisms by which they are all controlled. Current knowledge suggests that intracellular signaling can take place through modulating cellular rhythms, as a result of the effect of growth factors or hormones and that differentiation and cancer can result from changes in this oscillatory behaviour. The work presented here provides further, new evidence that the biochemical processes underlying cell function and behaviour are time dependent indeed, they should be regarded as such when designing experiments and interpreting results. The results indicate that the expression of phosphoprotein phosphatase 1, phosphoprotein phosphatase 2A and protein tyrosine phosphatase-1b protein expression is dynamic during normal cellular activity and that this oscillatory behaviour is modulated after stimulation with either, DMSO, PMA, ATRA or 9- cis RA. Knowledge of the actions of these potential anti-cancer drugs may have important implications with respect to design of therapeutic agents. Time dependent changes in PTP-1B mrna expression is consistent with earlier findings, however experimental data obtained from this study is limited and

28 231 further investigations is needed. The PTP-1B recombinant protein successfully produced in this study may provide insight on the mechanisms of action of phosphoproteins in relation to cell proliferation, differentiation and malignant transformation. More and more evidence comes to light living cells are dynamic expression of this fundamental attribute of life is universal. Clearly, temporal organization in many cells is more complex than is often realised, and failure to take account of this may result in the loss of valuable information. In this study, emphasis has been on the reversible phosphorylation of proteins. There is presumably a dynamic balance between phosphorylation and dephosphorylation, modulation of which may be achieved by altering the characteristics of frequency, phase, amplitude and wave shape of the rhythms of the enzymes and regulatory molecules involved in the system. Finding in this study are consistent with the view that hormones and other agents can influence metabolism and hence cell behaviour and properties by modifying the dynamics. An important implication with respect to cell proliferation and differentiation and the reversal of cancer, and may be relevant to a variety of other diseases including bacterial or viral infections, inflammation and diabetes.