IRE1a-XBP1 is a novel branch in the transcriptional regulation of Ucp1 in brown adipocytes.
|
|
- Howard Waters
- 5 years ago
- Views:
Transcription
1 IREaXBP is a novel branch in the transcriptional regulation of Ucp in brown adipocytes. Supplementary Information Rie Asada, Soshi Kanemoto, Koji Matsuhisa, Kenta Hino, Min Cui, Xiang Cui, Masayuki Kaneko, and Kazunori Imaizumi.
2 Fold Induction ( Each protein / bactin ) Supplementary Figure. 8 4 BIP GRP94 # # #3 #4 # # #3 #4 (kda) 75 ATF4 5 bactin BIP GRP94 ATF Supplementary Figure. Cold exposure increased UPRrelated proteins in BAT. Western blotting (WB) analysis of Bip, GRP94, and ATF4 in BAT exposed to cold (4 C) for 4 h, or in control (8 C) BAT. bactin was used as a loading control. Note that the significant increase in Bip protein was induced by cold exposure. Differences between control and cold exposure were analyzed by Student s ttest. Data are mean ±S.D. (control: n = 4, cold: n = 4) P <.5.
3 Relative mrna levels ( spliced/unspliced Xbp mrna ) Relative mrna levels (/ 8S rrna) Relative mrna levels (/ 8S rrna) Supplementary Figure. (a) Ucp (b) cont. CL 36,43 Bip Grp Calr (c) cont. CL 36,43 cont. CL 36,43 cont. CL 36, cont. CL 36,43 sxbp # # #3 # # #3.8 uxbp sxbp.6.4. cont. CL 36,43 Supplementary Figure. UPRrelated genes were upregulated by subcutaneous injection of CL 36,43 in vivo. (ab) Realtime PCR analysis of Ucp (a), and UPRrelated genes (b) in BAT of mice injected with CL 36,43. (c) RTPCR analysis of Xbp in BAT injected with CL 36,43 (left panel). uxbp and sxbp indicate unspliced and spliced forms of Xbp, respectively. Graph on right shows the quantification of Xbp splicing levels. Control mice were injected with sterile saline. Differences control and CL 36,43 were analyzed by Student s ttest. Data are mean ±S.D. (control: n = 3, CL 36,43: n=3), P <.5.
4 Relative mrna levels ( spliced/unspliced Xbp mrna ) Relative mrna levels (/ 8S rrna) Supplementary Figure 3. (a) (b) FSK 4m8C.5 FSK 4m8C Supplementary Figure 3. Inhibition of the IREaXBP pathway suppressed the increase in the Ucp expression induced by forskolin. (a) RTPCR analysis of Xbp in brown adipocytes that were pretreated with 3 mm 4m8C for 3 min and then stimulated with mm forskolin (FSK) for 3 h (upper panel). Lower graph is the quantification of Xbp splicing levels. (b) Realtime PCR analysis of Ucp in brown adipocytes treated with 4m8C and FSK described as (a). Note that treatment with 4m8C significantly decreased Ucp expression induced by FSK. Data are mean ±S.D. (n = 4), P <.5, P <..
5 Relative mrna levels ( spliced/unspliced Xbp mrna ) Supplementary Figure 4. (a) Promoter region of Ucp (4 kb) ACGT (UPRE Core) CCACG (ERSE Core) Ucp (b) uxbp sxbp 4 3 (c) (kda) sxbp bzip Activation domain sxbp DbZIPsXBP 5 DbZIPsXBP Activation domain bactin 5 37 Supplementary Figure 4. A searching for sxbp binding sites, and RTPCR or WB analysis of Xbp in C3HT/ cells. (a) A schematic representation of sxbp binding sites in the promoter region of Ucp (4kb). Red boxes indicate UPRE core sequences and blue boxes indicate ERSE core sequences. Note that there are two UPRE and one ERSE core sequences within kb region. (b) RTPCR analysis of Xbp in C3HT/ cells transfected with mock or a vector expressing sxbp (left panel). uxbp and sxbp indicate unspliced and spliced forms of Xbp, respectively. Graph on right shows the quantification of relative sxbp mrna levels. forskolin (FSK) treatment time was 4 h. Data are mean ±S.D. (n = 3), P <.5, P <.. (c) A schematic representation of sxbp and DbZIPsXBP constructs (left panel). The WB analysis of C3HT/ cells transfected with vectors expressing sxbp or DbZIPsXBP (right panel). The experiment was independently reproduced three times.
6 Supplementary Table Primer sets used for Realtime PCR or RTPCR analysis Gene Ucp Bip Grp94 Calreticulin Xbp Erdj4 8S rrna Construct sxbp DbZIPsXBP Sequence caaatcagctttgcctcactc acaagctttctgtggtggcta gtttgctgaggaagacaaaaagctc cacttccatagagtttgctgataat tgtgcagagagaggaagaagc aactcctcatttccagcgagt tgatgctaagaagcctgagga tctaggcccagtacagcaaaa acacgcttgggaatggacac ccatgggaagatgttctggg ccatgaagtaccaccctgaca gaccgagtgttttggttctga tggataccgcagctaggaata tcgtttatggtcggaactacg Primer set used for construction PCR Sequence caccatggtggtggtggcagcggc ttagacactaatcagctggg agaacacgcttgggaatggacac ctcctccgggctcaggtgcgtgagc