Supplementary Figure 1 A

Transcription

1 Supplementary Figure A B M. mullata p53, 3 UTR Luciferase activity (%) mir-5b 8 Le et al. Supplementary Information NC-DP NC-DP NC-DP b-DP NC-AS b-AS C 5 Log fold change in mir-5b level mir-5b O. cuniculus p53, 3 UTR mir-5b E. caballus p53, 3 UTR mir-5b X. tropicalis p53, 3 UTR 3 5. AAGACUUGUUUUAUGCUCAGGGU 3 3 AGUGUUCAAUCCCAGAGUCCCU 5 5. C UUUCCCCCCAGUG CUCAGGGU 3 : 3 AGUGUUCAAUCCCAGAGUCCCU 5 5. ACUUCCUCCACAU-GCUCAGGGC 3 : 3 AGUGUUCAAUC CCAGAGUCCCU 5 5. GGGUGC UAGAGAG CUCAGGGA 3 : : 3 AGUGUUCA AUCCCAGAGUCCCU 5 NC-DP b-DP Wild-type hp MRE-deleted hp Supplementary Figure (A) Predicted mirna response elements (MREs) of mir-5b in the p53 mrnas of monkey, rabbit, horse and frog. Shaded text indicates the seed regions. (B) Luciferase reporter assay validating the specificity and efficacy of mir-5b duplex and antisense. 93T cells were transfected with a Renilla luciferase reporter construct containing a sequence perfectly complementary to human mir-5b. The cells were co-transfected with negative control duplex //3 (NC-DP//3) or mir- 5b duplex (5b-DP) at a final concentration of nm; negative control antisense (NC-AS) or mir- 5b antisense (5b-AS) at a final concentration of nm. The assay was performed two days after transfection. Every Renilla luciferase reading was normalized to that of the control firefly luciferase. The luciferase activity is presented as percentages relative to the level of luciferase in NC-DP transfected cells (dashed line). The values represent average ± s.e.m. (n ). (C) The level of mir-5b in H99 cells two days after a transfection with NC-DP3 or 5b-DP and plasmids expressing human wild-type p53 or human MRE-deleted p53. The level of mir-5b was quantified by real-time PCR, normalized to the expression of U RNA and presented as log fold change ± s.e.m. (n ) relative to that in the p53- only-transfected cells. Two-tail T-test results are indicated by P <.5 and P <.. S S

2 Supplementary Figure A Log fold change in mir-5b level Mock NC-DP3 5b-DP B Log fold change in mir-5b level Mock NC-DP 5b-DP NC-AS 5b-AS Supplementary Figure Validation of mir-5b overexpression and knockdown in SH- SY5Y cells and in human lung fibroblast cells (A) The level of mir-5b in SH-SY5Y cells two days after a transfection with negative control duplex 3 (NC-DP3) or mir-5b duplex (5b-DP). (B) The level of mir-5b in human lung fibroblast cells two days after a transfection with NC- DP, 5b-DP, negative control antisense (NC-AS) or mir-5b antisense (5b-AS). For both (A) and (B), the level of mir-5b was quantified by real-time PCR, normalized to the expression of U RNA and presented as log fold change ± s.e.m. (n ) relative to mir-5b level in the mock-transfected cells. Two-tail T-test results are indicated by P <., relative to the mock-transfected control.

3 Supplementary Figure 3 A Fold change in p mrna level Concentration of 5b-DP (nm) B p53 Tubulin DMSO Etoposide C Fold change in mir-5b expression..8. DMSO Etoposide Supplementary Figure 3 (A) Real-time PCR analysis of p mrna levels in human lung fibroblasts transfected with mir-5b duplex (5b-DP) at different concentrations. The level of p mrna was normalized to the expression of β-actin and presented as fold change ± s.e.m. (n ) relative to the p level in mock transfected cells. Two-tail T-test results are indicated by P <.5 and P <.. (B) Western blot analysis of p53 protein in SH-SY5Y cells treated with µm etoposide or with DMSO vehicle control for hours. Tubulin was used as a loading control. (C) Real-time PCR analysis of mir-5b expression level in SH-SY5Y cells treated as in (B). The level of mir-5b was normalized to the expression of U RNA and presented as fold change ± s.e.m. (n ) relative to mir-5b level in DMSO treated cells. Two-tail T-test results are indicated by P <.. 3

4 Supplementary Figure A Log fold change in mir-5b level 5 3 Mock 5b-DP B Fold change in expression p53 bax p Mock 5b-DP C Fold change in expression.5.5 SH-SY5Y NC-DP SH-SY5Y 5b-DP 3T3 Mock 3T3 5b-DP PPPCA TP53INP PRKRA BAK PLAGL PLK3 PPPCA Supplementary Figure (A) The level of mir-5b in Swiss-3T3 cells two days after a transfection with mir-5b duplex (5b-DP). The level of mir-5b was quantified by real-time PCR, normalized to the expression of U RNA and presented as log fold change ± s.e.m. (n ) relative to mir-5b level in the mock-transfected cells. (B) The mrna levels of p53, p and bax in Swiss-3T3 cells two days after a transfection with mock or 5b-DP. The expression was quantified by real-time PCR, normalized to the expression of β-actin and presented as fold change ± s.e.m. (n ) relative to that in the mocktransfected cells. (C) Real-time PCR analysis of seven mir-5b putative targets in the p53 pathway. The expression of seven genes was measured in human SH-SY5Y cells transfected with negative control duplex (NC-DP) or 5b-DP or in mouse Swiss-3T3 cells transfected with mock or 5b-DP. The level of each mrna was normalized to the expression of β-actin and presented as fold change ± s.e.m. (n ) relative to the mock/nc-dp. Two-tail T-test results are indicated by P <.5 and P <.. The expression of PLAGL was not detected in Swiss-3T3 cells.

5 Le et al. Supplementary Information Supplementary Figure 5 mismo TUNEL Live TUNEL 3 hpf hpf 8 hpf hpf 3 hpf Live m5bmo Supplementary Figure 5 Developmental onset of apoptosis in mir-5b morphants: Embryos were injected with either mismo or m5bmo. Cell death was observed in the brain by live imaging of the head and fluorescent imaging of fixed embryos where apoptotic cells were stained by a TUNEL assay. Each fluorescent image is a projection of multiple optical slides from a representative embryo. Three embryos were observed in each condition and all of them have a similar phenotype as in the representative image. Scale bar, 5 μm. 5

6 Supplementary Figure mismo m5bmo lp5bmo//3 %, n = 7 95%, n = 85 98%, n = mismo + p53mo m5bmo + p53mo lp5bmo//3 + p53mo %, n = 37 9%, n = %, n = 3 mismo in p53 MK mutant m5bmo in p53 MK mutant lp5bmo//3 in p53 MK mutant %, n = 8 %, n = 5 %, n = Supplementary Figure Rescue of mir-5b morphants by the loss of p53 The phenotype of mir-5b morphants were reversed by co-injection of mir-5b morpholinos with p53 morpholino, or by injecting mir-5b morpholinos into p53 MK homozygous mutants. Images were captured at hpf. Morphants typically exhibit severe cell death in the brain (brackets) and absence of midbrain-hindbrain boundary (), smaller eyes (blue arrows) and deformed somites (green arrows). Each control/morphant embryo is shown with a lateral view of the whole body and a magnified view of the head. The total number of embryos (n) in each treatment and the percentage of embryos having the same phenotype as in the representative embryo are indicated below each image.

7 Supplementary Table. Primer sequences Red text indicates restriction enzyme sites; green text indicates the overhang sequences for binding of restriction enzymes; lower case text indicates mismatched mutations. Name Type Sequence Luc-hP53-mreF MRE top strand 5 -TCGAGAAGACTTGTTTTATGCTCAGGGTGC-3 Luc-hP53-mreR MRE bottom strand 5 -GGCCGCACCCTGAGCATAAAACAAGTCTTC-3 Luc-fP53-mreF MRE top strand 5 -TCGAGTGAAATGTCAAATACTCAGGGCAGC-3 Luc-fP53-mreR MRE bottom strand 5 -GGCCGCTGCCCTGAGTATTTGACATTTCAC-3 hp53-utr-f PCR forward primer 5 - AAGTCCAAAAAGGGTCAGTCTACCTCCC-3 hp53-r PCR reverse primer 5 - GCTCACAATTGTAATCCCAGCACTCTGG-3 hp53-utr-fx PCR forward primer 5 -CCGCTCGAGACCCAGGACTTCCATTTGCTTTGTC-3 hp53-utr-rn PCR reverse primer 5'- TTCCTTTTGCGGCCGCGATCGCCTGAGCCCAGGAGTTT-3 fp53-utr-fx PCR forward primer 5'- CCGCTCGAGATG CTA AGA GAG AAA GAA ACT GG -3 fp53-utr-rn PCR reverse primer 5'-TTCCTTTTGCGGCCGCGCAAATGCGTGTAAACAGTAATAAG-3 ` hp53-f PCR forward primer GTCATGGCGACTGTCCAGCTTTGTG-3' hp53-fe PCR forward primer 5'- CCGGAATTCGTTCGGGCTGGGAGCGTGCTTT-3 hp53-rx PCR reverse primer 5'- CCGCTCGAGTCTGGGAGGCTGAGACAGGTGGAT-3 fp53-fe PCR forward primer 5'-CCGGAATTCGTTTAGTGGAGAGGAGGTC-3' fp53-rx PCR reverse primer 5'-CCGCTCGAGAGTTTTATCAAGATTTCCAGGAGG -3' hp53xhomutf Mutagenesis primer 5'-CAGCCTTTGCCTCCCCGGGtGgTgCAGTCCTGCCTCAGCC-3 hp53xhomutr Mutagenesis primer 5'-GGCTGAGGCAGGACTGCACCACCCGGGGAGGCAAAGGCTG -3' hp53-3misf Mutagenesis primer 5 -GGATCCACCAAGACTTGTTTTATGCTgcGGcTCAATTTCTTTTTTC-3 hp53-3misr Mutagenesis primer 5 - GAAAAAAGAAATTGAGCCGCAGCATAAAACAAGTCTTGGTGGATCC-3 hp53delf Mutagenesis primer 5 -GTATATGATGATCTGGATCCACCAAGTCAATTTCTTTTTTC-3 hp53delr Mutagenesis primer 5 - GAAAAAAGAA ATTGACTTGG TGGATCCAGA TCATCATATAC-3 fp53-3misf Mutagenesis primer 5 -GCAAATGAAATGTCAAATACTgAcGcCATGTACAAGTCCCTCC-3 fp53-3misr Mutagenesis primer 5 - GGAGGGACTT GTACATGGCG TCAGTATTTG ACATTTCATT TGC -3 fp53-delf Mutagenesis primer 5'GATTGGATGTCTAAATATGAGCAAATGTACAAATGTACAAGTCCCTCCTG GAAATCTTGATAAAAC-3 fp53-delr Mutagenesis primer 5'GTTTTATCAAGATTTCCAGGAGGGACTTGTACATTTGTACATTTGCTCATATT TAGACATCCAATCC-3' factinf SYBR forward primer 5 -CCAGACATCAGGGAGTGAT-3 factinr SYBR reverse primer 5 -TCTCTGTTGGCTTTGGGATT-3 fpf SYBR forward primer 5 - CGGAATAAACGGTGTCGTCT-3 fpr SYBR reverse primer 5 - CGCAAACAGACCAACATCAC-3 hpf SYBR forward primer 5 - TTTCTCTCGGCTCCCCATGT-3 hpr SYBR reverse primer 5 - GCTGTATATTCAGCATTGTGGG-3 hbaxf SYBR forward primer 5 - CCGATTCATCTACCCTGCTG-3 hbaxr SYBR reverse primer 5 - CAATTCCAGAGGCAGTGGAG-3 7

8 Supplementary Table. Morpholino sequences Name Type Sequence m5bmo Blocking mature mir-5b 5'-TCACAAGTTAGGGTCTCAGGGA-3' mismo Mismatched control 5 -TCAgAAGaTAGGcTCTCtGGcA-3 lp5bmo Blocking pre-mir-5b- 5'- GTGCACATAACAGGAAAACGTCACA -3' lp5bmo Blocking pre-mir-5b- 5'-CGTGGACATCGAAGCAGAACGTCAC -3' lp5bmo3 Blocking pre-mir-5b-3 5'- GTGATTTTTAGCACACAAAGCTCAC-3' p53mo Blocking p53 translation 5 -GCGCCATTGCTTTGCAAGAATTG-3 Negative control MO Standard negative control designed by Gene Tools 5'-CCTCTTACCTCA GTTACA ATTTATA 3' 8

9 Supplementary Table 3. Putative mir-5b targets in the p53 pathway Targets TP53 PRKRA PLK3 TP53INP BAK PLAGL PPPCA PPPCA Human Monkey Mouse Guinea pig Rabbit Cat Horse Opossum Lizard Chicken Frog Zebrafish