Rapid identification and differentiation of fungal DNA in dermatological specimens by LightCycler PCR

Transcription

1 Journal of Medical Microbiology (2004), 53, DOI /jmm Rapid identification and differentiation of fungal DNA in dermatological specimens by LightCycler PCR Ralf Gutzmer, Susanne Mommert, Uta Küttler, Thomas Werfel and Alexander Kapp Correspondence Ralf Gutzmer Received 16 June 2004 Accepted 12 August 2004 Department of Dermatology and Allergology, Hannover Medical University, Ricklinger Str. 5, D Hannover, Germany The aim was to develop a LightCycler PCR method for the rapid detection and differentiation of fungal DNA in dermatological specimens such as skin scales and skin swabs. LightCycler PCR assays were established for seven primer sets specific for fungal DNA. For each primer set LightCycler melting points were defined by amplification of DNA from 21 fungi and sensitivity was determined by amplification of serial dilutions of fungal DNA. A protocol was established that allows detection and differentiation of mould and yeast DNA with one highly sensitive PCR reaction by assessment of LightCycler melting points. Two subsequent LightCycler PCR reactions and one RFLP reaction allowed the differentiation of dermatophytes and non-dermatophyte moulds and the subclassification of yeasts. Analysis of clinical samples from 38 patients with fungal skin diseases provided conclusive new diagnostic information in 9/38 cases (23. 7 %) by this PCR protocol that was not equally provided by direct microscopy and mycological culture. Thus the LightCycler PCR protocol established here represents a rapid diagnostic tool that aids in the diagnosis of fungal skin disease in a substantial number of patients. INTRODUCTION Fungal infections have to be considered in the differential diagnosis of many dermatological problems such as nail dystrophy, paronychia or hair loss. The detection of fungal growth in mycological culture and by direct microscopy of clinical specimens is the gold standard for the diagnosis of fungal infection. Culture regularly requires incubation periods of 2 4 weeks before a definitive result is obtained. For the microscopic identification of fungi, trained personnel are needed, but atypical morphology might still obscure the identification. Moreover, for the classification of some fungi, additional methods are necessary (e.g. the evaluation of biochemical properties in the classification of Candida species). Molecular characterization of fungal DNA has been employed to detect and differentiate fungi (Gil-Lamaignere et al., 2003). Molecular methods are faster, more sensitive, more stable and less dependent on external factors than morphological methods (Faggi et al., 2001; Graser et al., 1998; Kim et al., 2001). Our aim was to establish a LightCycler PCR protocol for the detection and differentiation of a broad spectrum of dermatologically relevant fungal DNA that allows the rapid and sensitive investigation of clinical specimens and aids in the diagnosis of fungal skin infection. METHODS Fungal strains, fungal culture and clinical specimens. The following fungal strains were purchased from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany; DSMZ number in parentheses): Aspergillus niger (1988), Fusarium oxysporum (2018), Candida parapsilosis (5784), Candida guilliermondii (6381), Candida tropicalis (11953), Candida krusei (6128), Malassezia furfur (6171), Rhodotorula mucilaginosa (70825), Hyphopichia burtonii (Trichosporon behrendii, 70663), Microsporum canis (10708), Microsporum gypseum (3824), Microsporum audouinii (10649), Epidermophyton floccosum (10709), Trichophyton verrucosum (7380) and Trichophyton tonsurans (12285). The other strains used in this study were cultured from clinical samples and characterized in the mycological laboratory of our department by standard methods. Yeasts were further characterized according to their carbohydrate assimilation pattern using the API-32C kit (biomérieux). To compare the results of PCR examination and mycological culture in the assessment of clinical samples, scales or skin swabs were obtained. The scales were immediately divided into three portions for direct microscopic examination, mycological culture and PCR (see below). Alternatively, two skin swabs were obtained in parallel for mycological culture and PCR, respectively. Abbreviations: ITS, internal transcribed spacer; PBMCs, peripheral blood mononuclear cells. Selection criteria for patients with fungal skin disease were (a) a clinical presentation consistent with fungal disease, (b) a relief of symptoms by & 2004 SGM Printed in Great Britain IP:

2 R. Gutzmer and others antifungal therapy and (c) no history of antifungal therapy within the last 3 months. Samples were obtained before start of therapy. Patients with clinically clear-cut eczema or psoriasis served as negative controls. Extraction of fungal DNA and dilution experiments. DNA from fungal cultures, human peripheral blood mononuclear cells (PBMCs), Staphylococcus aureus and clinical specimens was extracted using the QIAamp DNA isolation kit (Qiagen). To assess the detection limit of fungal DNA with LightCycler PCR, DNA concentrations from selected samples were adjusted to 1 pg ìl 1 and diluted with water in 10-fold dilutions. These samples were subjected to LightCycler PCR and melting curve analysis as well as agarose gel electrophoresis, and the highest dilution was recorded that resulted in a peak in the melting curve analysis or a visible band on the gel. Detection of fungal DNA by LightCycler PCR. For the amplification of fungal DNA, a variety of primer sets was used that had been previously described in the literature. Details with regard to primer sequences, amplified products and references are given in Table 1. LightCycler PCR was performed on a LightCycler (Roche Diagnostics) using the LightCycler Fast Start DNA Master SYBR Green (Roche Diagnostics) and the conditions summarized in Table 1. To control for a correct amplification product length, the PCR reaction was also analysed by electrophoresis on 1.5 % agarose gels. Amplicons obtained with primer sets TR1 TR2 and N5 N6 contained restriction sites for HaeIII that were characteristic for dermatophytes, yeasts and moulds (Baek et al., 1998). Therefore, these PCR products were digested with HaeIII (MBI Fermentas) and analysed by agarose gel electrophoresis. The following DNA fragment patterns were expected: TR1 TR2, dermatophytes 442/90/49 bp, yeasts 437/142 bp, moulds 441/59/50/30 bp; N5 N6, dermatophytes 147/90/63 bp, yeasts 163/144 bp, moulds 146/71/59/30 bp. RESULTS AND DISCUSSION LightCycler PCR reactions were established for seven primer pairs located in the fungal rdna and internal transcribed spacers (ITSs) regions (Fig. 1) that were specific for fungal DNA as previously characterized by others (Table 1). Light- Cycler PCR for each primer set was investigated for its ability to differentiate dermatologically relevant fungi via melting curve analysis and its sensitivity to amplify fungal DNA. Based on these data, a system for the evaluation of clinical samples was developed and used to analyse clinical specimens in comparison to results from mycological cultures and direct microscopy. Determination of LightCycler PCR melting points for characterized fungal species LightCycler PCR was performed with DNA extracted from 21 characterized fungal cultures. Representative experiments are shown in Fig. 2 and melting points obtained from three independent experiments are given in Table 2. Agarose gel electrophoresis of LightCycler PCR products and of HaeIIIdigested PCR products revealed bands of the expected sizes (Table 1, Fig. 2). Primer sets N5 N6, ITS86 ITS4, UF1 EU1 and TR1 TR2 amplified moulds and yeasts, whereas 18SF1 5.8SR1 amplified primarily and S3 TR2 amplified exclusively yeasts and DH2L DH1R amplified dermatophytes (Table 2). Melting 1208 IP: Journal of Medical Microbiology 53 Table 1. Details on sequences, LightCycler PCR conditions and references for each set of primers used in this study Reference LightCycler PCR conditions Restriction site Primer sequence Expected production length (bp) Primer designation No. of cycles Annealing temp. (8C) MgCl2 (mm) HaeIII Baek et al. (1998), Hopfer et al. (1993) AACTTAAAGGAATTGACGGAAG GCATCACAGACCTGTTATTGCCTC N5 N Turenne et al. (1999) GTGAATCATCGAATCTTTGAAC TCCTCCGCTTATTGATATGC ITS86 ITS Makimura et al. (1998, 1999) HaeIII Baek et al. (1998), Bock et al. (1994), Kappe et al. (1996) AGGTTTCCGTAGGTGAACCT TTCGCTGCGTTCTTCATCGA GTTTCTAGGACCGCC CTCAAACTTCCATCGACTTG 18SF1 5.8SR1 TR1 TR Kappe et al. (1996) CGAATCGCATGGCCTTG TTCTCAGGCTCCCTCTCC UF1 EU Machouart-Dubach et al. (2001) Kappe et al. (1996) TGTACTGGTCCGGCCGGG CGGCGGTCCTAGAAACCAAC AGTCAAATTAAGCCGCAG CTCAAACTTCCATCGACTTG DH2L DH1R S3 TR2

3 LightCycler detection of fungal DNA 500bp N5 18SF1 ITS86 Nuclear small (18S) rdna ITS 1 5.8S rdna ITS 2 Nuclear large (28S) rdna N6 5.8SR1 ITS4 UF1 DH2L TR1 S3 250bp V1 V2 V3 V4 V5 V7 V8 V9 EU1 DH1R TR2 Fig. 1. Location of the primers used in this study within the rdna and ITS regions. V1 V9 denote the variable regions of the 18S rdna subunit (V6 exists in prokaryotes only). Adapted from Kappe et al. (1996), Lindsley et al. (2001), Machouart-Dubach et al. (2001) and White et al. (1990). points obtained with primer set N5 N6 allowed the differentiation of moulds (dermatophytes and non-dermatophytes, around C) and yeasts (below 86 8C). Melting curve analysis of UF1 EU1 amplicons showed a slight difference between moulds (around 86 8C) and yeasts (around 85 8C). Differences in melting points obtained with primers TR1 TR2 were too little to allow the determination of fungi at the genus level. Thus differentiation of dermatophytes and non-dermatophyte moulds was possible in two ways: first, via additional restriction digest of the N5 N6 amplicon with HaeIII, since they have different RFLP patterns (Table 1, Fig. 2); second, via LightCycler melting curve analysis of ITS86 ITS4 amplicons (Table 2). None of the primer sets was able to subclassify dermatophytes and non-dermatophyte moulds since melting points and product lengths were close together. Also other studies were unable to differentiate dermatophyte and non-dermatophyte mould species by analysis of amplification products derived from the rdna and ITS regions using agarose gel electrophoresis (Baek et al., 1998; Bock et al., 1994; Machouart-Dubach et al., 2001; Makimura et al., 1998, 1999; Turin et al., 2000) or real-time PCR (Kami et al., 2001; Pham et al., 2003). For yeasts, the two PCR reactions with ITS86 ITS4 and 18S 5.8S primers allowed the differentiation of Candida albicans versus Candida glabrata versus C. guilliermondii/rhodotorula mucilaginosa versus C. parapsilosis/c. tropicalis versus C. krusei (Table 2). The ITS regions and adjacent rdna were also successfully used in previous studies to detect and differentiate yeasts to the species level with a variety of PCR methods (Ahmad et al., 2002; Chen et al., 2000; Elie et al., 1998; Lindsley et al., 2001; Selvarangan et al., 2002; Shin et al., 1997). Differences in the variability of the rdna and ITS base pair composition are a likely explanation for the ability to differentiate yeasts but not dermatophytes or non-dermatophyte moulds (Graser et al., 1999; Ninet et al., 2003). This is highlighted by the study of Turenne et al. (1999), which examined the length of the ITS2 region amplified with primers ITS86 ITS4. Candida species covered a range of bp, dermatophytes a range of bp with the exception of E. floccosum with 366 bp, and moulds (Aspergillus and Penicillium species) bp. The variability for Candida species is much higher than for dermatophytes and moulds. However, E. floccosum (which yielded a considerably longer amplification product than other dermatophytes) also had a similar melting peak to other dermatophytes in the LightCycler analysis, which underlines the fact that the LightCycler melting curve depends on the length and the base pair composition of an amplicon. Assessment of the sensitivity of various PCR primers in the detection of fungi by LightCycler PCR Serial 10-fold dilutions of DNA from Trichophyton rubrum and C. albicans were used to determine the sensitivity of the seven LightCycler PCR reactions in the detection of fungal DNA (Table 2). The lowest detection level for both T. rubrum and C. albicans DNA was obtained with primer set N5 N6. Agarose gel electrophoresis was as equally sensitive as Light- Cycler melting curve analysis. IP:

4 R. Gutzmer and others N5+N6 300bp 200bp -df/dt ITS86+ITS df/dt L bp Temperature ( C) 18SF1+5.8SR1 200bp Temperature ( C) L HaeIII digested -df/dt L Temperature ( C) Trichophyton rubrum Epidermophyton floccosum Microsporum canis Penicillium sp. Aspergillus niger Candida albicans PBMC Staph. aureus Water Fig. 2. Representative LightCycler PCR experiments for selected primer sets. Amplicons were analysed in parallel by melting curves and agarose gel electrophoresis. Lanes: L, 100 bp DNA ladder; 1, T. rubrum; 2,E. floccosum;3, Microsporum canis; 4,Penicillium sp.; 5, A. niger; 6,C. albicans; 7, PBMCs; 8, Staph. aureus; 9, water IP: Journal of Medical Microbiology 53

5 LightCycler detection of fungal DNA Table 2. Melting points (8C) and detection limits as determined by LightCycler PCR melting curve analysis for the seven primer sets Mean SD of three independent experiments is given. NS, No signal; ND, not determined. N5 N6 ITS86 ITS4 18SF1 5.8SR1 S3 TR2 UF1 EU1 DH2L DH1R TR1 TR2 Trichophyton rubrum NS NS Trichophyton mentagrophytes NS Trichophyton verrucosum NS Trichophyton tonsurans NS Microsporum canis NS Microsporum audouinii NS NS Microsporum gypseum NS NS E. floccosum NS C. albicans NS C. glabrata NS C. guilliermondii NS C. parapsilosis NS C. tropicalis NS C. krusei NS NS NS Malassezia furfur ND ND ND ND Trichosporon behrendii ND ND ND ND Rhodotorula mucilaginosa ND ND ND ND Penicillium sp NS NS NS Aspergillus niger NS NS NS NS Scopulariopsis brevicaulis NS ND ND ND ND Fusarium oxysporum NS ND ND ND ND Human PBMCs NS NS NS NS NS NS NS Staph. aureus NS NS NS NS NS NS NS Water NS NS NS NS NS NS NS Sensitivity T. rubrum 10 pg ìl pg ìl pg ìl pg ìl 1 10 pg ìl 1 Sensitivity C. albicans 1pgìl 1 10 pg ìl 1 10 pg ìl pg ìl 1 1pgìl pg ìl 1 Evaluation of clinical specimens with the LightCycler PCR protocol Based on the results obtained with characterized fungal DNA, the following procedure to evaluate clinical specimens was established. The most sensitive primer set, N5 N6, was used to screen specimens for the presence of fungal DNA. In the case of mould DNA, discrimination of dermatophyte and non-dermatophyte moulds was attempted either by restriction digest of N5 N6 amplicons and assessment of RFLP by agarose gel electrophoresis or by LightCycler melting point determination with primers ITS86 ITS4. In the case of yeast DNA, subclassification was performed by melting curve analysis of PCR reactions with primer sets 18SF1 5.8SR1 and ITS86 ITS4. In cases where only the (most sensitive) melting point for N5 N6 primers but not the (less sensitive) RFLP pattern or melting points of other PCR reactions was available, the statement fungal DNA without further specification was made. negative by PCR and direct microscopy. In two psoriasis patients culture yielded growth of non-dermatophyte moulds; the other 18 patients were negative by culture. Among the 38 positive patients, skin scales were investigated by direct microscopy, culture and PCR in patients 1 28 and skin swabs were investigated by culture and PCR in patients (Table 3). Thirty-three out of 38 (86.8 %) samples were positive by at least one of the three methods. PCR amplification with primers N5 N6 yielded positive results in 32/38 (84 %) specimens by melting point analysis. After restriction digest with HaeIII, in only 22 of these 32 samples (69 %) were bands visible by agarose gel electrophoresis that allowed further classification into dermatophytes, nondermatophyte moulds and yeasts (Table 3). Thus melting point detection is much more sensitive than detection of bands of bp length on agarose gels after restriction digestion. Thirty-eight clinical samples from patients with fungal skin infection (Table 3) and 20 samples from patients with eczema (15 patients) and psoriasis (5 patients) were evaluated. Specimens obtained from the latter 20 patients were all LightCycler PCR provided conclusive new diagnostic information (that was not given by microscopy or culture) in 9/38 cases (23. 7 %, cases 9, 10, 11, 12, 15, 19, 20, 37, 38) and interesting but not conclusive new information in another seven cases (18. 4 %, cases 13, 14, 18, 21, 34, 35, 36). Thus IP:

6 1212 Journal of Medical Microbiology 53 Table 3. Results of LightCycler PCR amplification in comparison to mycological culture for 38 clinical specimens LightCycler PCR was performed following the protocol outlined in Results and Discussion. Samples 1 28, skin scales; samples 29 38, skin swabs. NS, no signal; n.f.s., not further specified. Mould refers only to non-dermatophyte moulds. Patient ID Clinical diagnosis Melting point (8C) N5 N6 RFLP analysis N5 N6 Melting point (8C) ITS86 ITS4 Melting point (8C) 18SF1 5.8SR1 Fungal detection PCR-based Result fungal culture Result KOH 1 Onychomycosis 86.8 NS NS Fungal DNA T. rubrum Positive 2 Onychomycosis 86.8 Dermatophyte NS Dermatophyte T. rubrum Positive 3 Onychomycosis Dermatophyte NS Dermatophyte T. rubrum Positive 4 Onychomycosis 86.8 NS NS Fungal DNA T. rubrum Negative 5 Onychomycosis NS NS Fungal DNA T. rubrum Positive 6 Tinea pedis 87.6 Dermatophyte NS Dermatophyte T. rubrum Positive 7 Tinea pedis NS NS Fungal DNA T. rubrum Positive 8 Tinea capitis 87.8 Dermatophyte NS Dermatophyte Microsporum canis Positive 9 Tinea pedis NS Dermatophyte A. fumigatus Negative 10 Onychomycosis 87.2 Dermatophyte NS Dermatophyte Mould n.f.s. Negative 11 Onychomycosis 87.1 Dermatophyte NS Dermatophyte Rhodotorula Negative 12 Onychomycosis 86.8 Dermatophyte NS Dermatophyte Negative Negative 13 Onychomycosis 87.2 NS NS Fungal DNA Negative Positive 14 Tinea pedis Dermatophyte NS Dermatophyte Negative Positive 15 Tinea capitis 86.2 Dermatophyte NS Dermatophyte Negative Negative 16 Onychomycosis NS C. parapsilosis or C. tropicalis C. parapsilosis Negative 17 Onychomycosis 86.1 Yeast C. glabrata or C. guilliermondii or Rhodotorula C. glabrata Negative 18 Onychomycosis Yeast C. albicans C. krusei Negative 19 Onychomycosis 86.2 Yeast 87.8 NS C. albicans Fusarium sp. Negative 20 Onychomycosis 86.0 NS 88.7 NS C. albicans Negative Negative 21 Tinea corporis 86.0 Yeast Rhodotorula or C. guilliermondii Negative Negative 22 Tinea corporis 88.7 Mould NS Mould Mould n.f.s. Negative 23 Onychomycosis NS NS Negative Mould n.f.s. Negative 24 Onychomycosis NS NS Negative Negative Negative 25 Onychomycosis NS NS Negative Negative Negative 26 Onychomycosis NS NS Negative Negative Negative 27 Onychomycosis NS NS Negative Negative Negative 28 Onychomycosis NS NS Negative Negative Negative 29 Oral candidosis Yeast C. albicans C. albicans 30 Oral candidosis 85.2 Yeast C. albicans C. albicans 31 Oral candidosis 85.9 Yeast C. albicans C. albicans 32 Oral candidosis 86.1 Yeast C. albicans C. albicans 33 Oral candidosis 85.1 NS C. parapsilosis or C. tropicalis C. albicans 34 Paronychia Yeast C. parapsilosis or C. tropicalis C. krusei 35 Paronychia 86.2 Yeast Rhodotorula or C. guilliermondii Yeast n.f.s. 36 Paronychia Yeast NS NS Yeast Mould n.f.s. 37 Oral candidosis 85.5 Yeast C. albicans Negative 38 Perianal candidosis NS C. parapsilosis or C. tropicalis Negative R. Gutzmer and others IP:

7 LightCycler detection of fungal DNA results obtained by our PCR protocol allowed a laboratory diagnosis that was not equally well made by culture and microscopy alone in a substantial number of patients. In 10 cases with detection of yeasts by both PCR and culture (Table 3), yeast classification was concordant in seven cases (70 %). In case 18, PCR detected C. albicans DNA and culture revealed growth of C. krusei. In cases 33 and 34, PCR demonstrated DNA of C. parapsilosis or tropicalis (which could not be differentiated) and culture detected C. albicans and C. krusei, respectively. A rate of 70 % concordant results comparing molecular to biochemical identification of Candida species corresponds well to a previous study that demonstrated a 100 % correct identification of Candida species by DNA fingerprinting as compared to 77. 5% by the API-32C system, which was also used for the phenotypic characterization of Candida species in our study (Latouche et al., 1997). In conclusion, we developed a fast and simple LightCyclerbased PCR protocol to detect DNA of the dermatologically most relevant fungi and to differentiate dermatophytes, yeasts and non-dermatophyte moulds. This protocol can complement mycological culture and direct microscopy in the diagnosis of fungal skin disease and provides additional diagnostic information in a substantial number of patients. However, it can not replace culture and direct microscopy, since dermatophytes as well as non-dermatophyte moulds can not be differentiated at the species level and no information on viability is obtained. ACKNOWLEDGEMENTS We greatly appreciate the technical assistance of the staff of the mycological laboratory of our department, namely Mrs Petra Kopp and Mrs Elke Schulz. REFERENCES Ahmad, S., Khan, Z., Mustafa, A. S. & Khan, Z. U. (2002). Seminested PCR for diagnosis of candidemia: comparison with culture, antigen detection, and biochemical methods for species identification. J Clin Microbiol 40, Baek, S. C., Chae, H. J., Houh, D., Byun, D. G. & Cho, B. K. (1998). Detection and differentiation of causative fungi of onychomycosis using PCR amplification and restriction enzyme analysis. Int J Dermatol 37, Bock, M., Maiwald, M., Kappe, R., Nickel, P. & Naher, H. (1994). Polymerase chain reaction-based detection of dermatophyte DNA with a fungus-specific primer system. Mycoses 37, Chen, Y. C., Eisner, J. D., Kattar, M. M., Rassoulian-Barrett, S. L., Lafe, K., Yarfitz, S. L., Limaye, A. P. & Cookson, B. T. (2000). Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rrna genes. J Clin Microbiol 38, Elie, C. M., Lott, T. J., Reiss, E. & Morrison, C. J. (1998). Rapid identification of Candida species with species-specific DNA probes. J Clin Microbiol 36, Faggi, E., Pini, G., Campisi, E., Bertellini, C., Difonzo, E. & Mancianti, F. (2001). Application of PCR to distinguish common species of dermatophytes. J Clin Microbiol 39, Gil-Lamaignere, C., Roilides, E., Hacker, J. & Muller, F. M. (2003). Molecular typing for fungi a critical review of the possibilities and limitations of currently and future methods. Clin Microbiol Infect 9, Graser, Y., el Fari, M., Presber, W., Sterry, W. & Tietz, H. J. (1998). Identification of common dermatophytes (Trichophyton, Microsporum, Epidermophyton) using polymerase chain reactions. Br J Dermatol 138, Graser, Y., el Fari, M., Vilgalys, R., Kuijpers, A. F., de Hoog, G. S., Presber, W. & Tietz, H. J. (1999). Phylogeny and taxonomy of the family Arthrodermataceae (dermatophytes) using sequence analysis of the ribosomal ITS region. Med Mycol 37, Hopfer, R. L., Walden, P., Setterquist, S. & Highsmith, W. E. (1993). Detection and differentiation of fungi in clinical specimens using polymerase chain reaction (PCR) amplification and restriction enzyme analysis. J Med Vet Mycol 31, Kami, M., Fukui, T., Ogawa, S. & 14 other authors (2001). Use of realtime PCR on blood samples for diagnosis of invasive aspergillosis. Clin Infect Dis 33, Kappe, R., Fauser, C., Okeke, C. N. & Maiwald, M. (1996). Universal fungus-specific primer systems and group-specific hybridization oligonucleotides for 18S rdna. Mycoses 39, Kim, J. A., Takahashi, Y., Tanaka, R., Fukushima, K., Nishimura, K. & Miyaji, M. (2001). Identification and subtyping of Trichophyton mentagrophytes by random amplified polymorphic DNA. Mycoses 44, Latouche, G. N., Daniel, H. M., Lee, O. C., Mitchell, T. G., Sorrell, T. C. & Meyer, W. (1997). Comparison of use of phenotypic and genotypic characteristics for identification of species of the anamorph genus Candida and related teleomorph yeast species. J Clin Microbiol 35, Lindsley, M. D., Hurst, S. F., Iqbal, N. J. & Morrison, C. J. (2001). Rapid identification of dimorphic and yeast-like fungal pathogens using specific DNA probes. J Clin Microbiol 39, Machouart-Dubach, M., Lacroix, C., de Chauvin, M. F., Le, G., Giudicelli, C., Lorenzo, F. & Derouin, F. (2001). Rapid discrimination among dermatophytes, Scytalidium spp., and other fungi with a PCR-restriction fragment length polymorphism ribotyping method. J Clin Microbiol 39, Makimura, K., Mochizuki, T., Hasegawa, A., Uchida, K., Saito, H. & Yamaguchi, H. (1998). Phylogenetic classification of Trichophyton mentagrophytes complex strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Clin Microbiol 36, Makimura, K., Tamura, Y., Mochizuki, T., Hasegawa, A., Tajiri, Y., Hanazawa, R., Uchida, K., Saito, H. & Yamaguchi, H. (1999). Phylogenetic classification and species identification of dermatophyte strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Clin Microbiol 37, Ninet, B., Jan, I., Bontems, O., Lechenne, B., Jousson, O., Panizzon, R., Lew, D. & Monod, M. (2003). Identification of dermatophyte species by 28S ribosomal DNA sequencing with a commercial kit. J Clin Microbiol 41, Pham, A. S., Tarrand, J. J., May, G. S., Lee, M. S., Kontoyiannis, D. P. & Han, X. Y. (2003). Diagnosis of invasive mold infection by real-time quantitative PCR. Am J Clin Pathol 119, Selvarangan, R., Limaye, A. P. & Cookson, B. T. (2002). Rapid identification and differentiation of Candida albicans and Candida dubliniensis by capillary-based amplification and fluorescent probe hybridization. J Clin Microbiol 40, IP:

8 R. Gutzmer and others Shin, J. H., Nolte, F. S. & Morrison, C. J. (1997). Rapid identification of Candida species in blood cultures by a clinically useful PCR method. J Clin Microbiol 35, Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A. & Kabani, A. M. (1999). Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J Clin Microbiol 37, Turin, L., Riva, F., Galbiati, G. & Cainelli, T. (2000). Fast, simple and highly sensitive double-rounded polymerase chain reaction assay to detect medically relevant fungi in dermatological specimens. Eur J Clin Invest 30, White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: a Guide to Methods and Applications, pp Edited by M. A. Innis. San Diego, CA: Academic Press IP: Journal of Medical Microbiology 53