ScriptSeq Complete Gold Kit

Transcription

1 ScriptSeq Complete Gold Kit (Epidemiology) Low Input Cat. No. SCL6EP 6 Reactions (Contains 1 box of Cat. No. LIE1206, 1 box of Cat. No. LIMC126 and 1 box of SSV21106) Cat. No. SCL24EP 24 Reactions (Contains 1 box of Cat. No. LIE1224, 1 box of Cat. No. LIMC1204 and 1 box of SSV21124) Lit. # 357 7/ EPILIT357 Rev. A

2 Total RNA Ribo-Zero rrna depletion 1.5 hr AAAAAA AAAAAA cdna synthesis 1.5 hr (Single tube workflow) 3 Terminal tagging ScriptSeq v2 PCR and library purification 2.5 hr Figure 1. An overview of the ScriptSeq Complete Gold Kit (Epidemiology) procedure. rrna is first removed from the sample using the Ribo-Zero Magnetic Gold Kit (Epidemiology). The ScriptSeq v2 RNA-Seq Library Preparation Kit is then used to make the RNA-Seq library from the Ribo-Zero treated RNA. Quick Protocol for Ribo-Zero Magnetic Gold Kit (Epidemiology) Low Input For experienced users only! Step Procedure Pages Prepare Magnetic Beads Treat sample with rrna Removal Solution Remove rrna Purify rrna-depleted sample Add 90 µl Magnetic Beads to RNase-free tube. Place in magnetic stand for 1 min at RT. Wash with 90 µl RNase-Free Water. Place in magnetic stand, repeat wash step. Resuspend in 35 µl Resuspension Solution Optional: Add 0.5 µl RiboGuard RNase Inhibitor Mix in 20 µl total volume: ng total RNA 2-4 µl rrna Removal Solution 2 µl Reaction Buffer Incubate C, then 5 RT. Mix previously prepared Magnetic Beads. Add RNA mixture, mix well by pipetting, vortex well. Incubate 5 RT, vortex well. Incubate 5 50 C. Place in magnetic stand, transfer supernatant (rrna-depleted sample) to RNase-free tube. Ethanol precipitation or alternative method Epicentre I Madison, WI I Phone: I I Fax:

3 1. Kit Contents and Specifications Ribo-Zero Gold Kit (Epidemiology) Low Input The kit components are supplied in tubes with colored caps for easier identification. Each kit contains one box of Cat. No. LIE1206/LIE1224 and one box of Cat. No. LIMC126/LIMC1204. Ribo-Zero Gold rrna Removal Reagents (Epidemiology) Low Input (Cat. No. LIE1206/LIE1224) Component Name RiboGuard RNase Inhibitor (100 U/μl) Ribo-Zero Gold rrna Removal Solution (Epidemiology) Tube Label 6-rxn Volume 24-rxn RiboGuard RNase Inhibitor 10 μl 15 μl rrna Removal Solution (Epidemiology) 30 μl 110 μl Ribo-Zero Reaction Buffer Ribo-Zero Reaction Buffer 20 μl 60 μl Glycogen (10 mg/ml) Glycogen 20 μl 60 μl Sodium Acetate (3 M) Sodium Acetate 120 μl 500 μl RNase-Free Water RNase-Free Water 1 ml 3 x 1.5 ml Storage: Store this kit box and its contents at 70 C to 80 C. Cap Color Blue Clear Magnetic Core Kit Low Input (Cat. No. LIMC126/LIMC1204) Component Name Tube Label 6-rxn Volume 24-rxn Cap Color Magnetic Beads Magnetic Beads 600 µl 4 x 600 µl Clear Magnetic Bead Resuspension Solution Magnetic Bead Resuspension Solution 250 μl 1 ml Yellow/Clear RNase-Free Water RNase-Free Water 1.5 ml 3 x 1.5 ml Clear Storage: Store this kit box and its contents at 4 C (Do Not Freeze!). Additional Required Reagents and Equipment : Magnetic rack or stand for 1.5 ml tubes 0.2-ml or 0.5-ml and 1.5 ml microcentrifuge tubes (RNase-free) Thermocycler or other temperature control device for 0.2-ml or 0.5-ml tubes Water bath, heating block, or other temperature control device for 1.5-ml tubes RNA purification kits such as Agencourt RNAClean XP Kit (Beckman Coulter), or Qiagen RNeasy MinElute Cleanup Kit, or ice-cold 100% and 70% ethanol ScriptSeq v2 RNA-Seq Library Preparation Kit Component Name Tube Label Volume ScriptSeq v2 cdna Synthesis Primer cdna Primer 18 µl 55 µl RNA Fragmentation Solution Fragmentation Solution 10 μl 30 μl ScriptSeq v2 cdna Synthesis PreMix cdna Synthesis PreMix 25 μl 80 µl 100 mm DTT 100 mm DTT 100 μl 100 μl StarScript Reverse Transcriptase StarScript Reverse Transcriptase 8 μl 15 µl ScriptSeq Finishing Solution Finishing Solution 10 μl 30 µl ScriptSeq v2 Terminal Tagging PreMix Terminal Tagging PreMix 60 μl 200 µl DNA Polymerase DNA Polymerase 8 μl 15 µl Exonuclease I Exo I 10 µl 30 µl FailSafe PCR PreMix E FailSafe PCR PreMix E 200 μl 650 µl Forward PCR Primer Forward PCR Primer 10 μl 30 µl Reverse PCR Primer Reverse PCR Primer 10 μl 30 µl 6-rxn 24-rxn Cap Color Nuclease-Free Water Nuclease-Free Water 500 μl 500 µl Clear Storage: Store the kit at 20 C in a freezer without a defrost cycle. Green Red Blue Yellow techhelp@epicentre.com (800)

4 Additional Required Reagents and Equipment: FailSafe PCR Enzyme Mix (Epicentre) Optional: MinElute PCR Purification columns (Qiagen) Optional: Agencourt AMPure XP System (DNA; BeckmanCoulter) and magnetic plate, rack, or stand for 1.5-ml tubes Performance Specifications and Quality Control A Ribo-Zero Magnetic Gold Kit (Epidemiology) reaction removes >99% of 28S, 18S, 5.8S, mt16s, mt12s, 23S, 16S, and >95% of 5S rrna, from 125 ng of a 2:1:1 mixture of Universal Human Reference, Gram-positive, and Gram-negative bacterial total RNA, as assessed by qrt-pcr before and after a Ribo-Zero Magnetic Kit reaction. The ScriptSeq v2 RNA-Seq Library Preparation Kit is function-tested in a control reaction using 5 ng of rat liver poly(a) RNA. At least 400 ng of a di-tagged library must be produced in a final volume of 20 µl, with a size distribution of 100-1,000 bp, and a peak range of bp as assayed using an Agilent Bioanalyzer. 2. RNA Sample Considerations DNA-Free RNA Treat the RNA sample with DNase I to remove all traces of DNA. Then, remove the DNase I prior to the Ribo-Zero reaction. DNA contamination will interfere with rrna removal and is the main cause of loss of directionality when sequencing the ScriptSeq Complete library. The RNA sample should be free of salts (e.g., Mg 2+ or guanidinium salts) or organics (e.g., phenol and ethanol). Amount of RNA The low-input Ribo-Zero process uses ng of DNA-free RNA. The sample should be dissolved in RNase-Free Water or TE Buffer. It is important to quantify the amount of total RNA in the sample as accurately as possible in order to use the appropriate amount of Ribo-Zero rrna Removal Solution in Part 3.B. Use Table 1 (Part 3.B) to determine the maximum volume in which the total RNA sample can be dissolved prior to performing the Ribo-Zero procedure. RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue RNA extracted from FFPE tissue can be used to prepare rrna-depleted ScriptSeq Complete libraries. However, the quality of FFPE RNA can be highly variable due to the tissue-fixation procedure, age of the sample, storage conditions, fixation reversal process, etc. Therefore, we cannot guarantee success with every FFPE RNA sample. Ribo-Zero treatment of FFPE RNA samples does not require any modifications to the procedure presented here. However, the use of FFPE RNA does require procedural modifications to the ScriptSeq library preparation procedure. Be sure to read Part 5.A, 5.D, and Appendix 1 before proceeding. If possible, determine the size distribution of an FFPE RNA sample (e.g., Agilent 2100 Bioanalyzer) before beginning the Ribo-Zero procedure. The size of the FFPE RNA will determine the best method to purify the ScriptSeq Complete library in Part 5.F. 3. Ribo-Zero Kit Procedure 3.A. Preparation of the Magnetic Beads Required in Part 3.A Component Name Tube Label Cap Color Magnetic Beads Magnetic Beads RNase-Free Water RNase-Free Water Clear Magnetic Bead Resuspension Solution Magnetic Bead Resuspension Solution Yellow/Clear RiboGuard RNase Inhibitor (100 U/μl) RiboGuard RNase Inhibitor Blue Important! Allow the Magnetic Core Kit components to equilibrate to room temperature before proceeding! Remove the Ribo-Zero rrna Removal Reagents from 70 C to 80 C storage, thaw the tubes, and place them on ice. Wash the beads by using either the batch washing or individual washing procedure. 4

5 3.A.1. Batch Washing Procedure 1. For each Ribo-Zero reaction, 90 µl of the Magnetic Beads is required. Note: Mix the Magnetic Beads well by pipetting or gentle vortexing. 2. Determine the amount of Magnetic Beads required for the total number of reactions and dispense a maximum of 1,080 µl into each 1.5-ml RNase-free microcentrifuge tube (sufficient for 12 reactions). Pipet the Magnetic Bead suspension slowly to avoid air bubbles and to ensure pipetting of the correct volume. Store unused Magnetic Beads at 4 C. Note: When setting up more than six Ribo-Zero reactions, either multiples of 1,080-µl aliquots can be washed in a RNase-free 1.5 ml microcentrifuge tubes, or a larger volume can be washed in RNase-free 15-ml tubes (e.g., using a 15-ml magnetic stand). 3. Place the 1.5-ml microcentrifuge tube containing the Magnetic Beads on the magnetic stand for at least 1 minute (until the solution appears clear). 4. With the 1.5-ml microcentrifuge tube still on the stand, remove and discard the supernatant. Caution: The supernatant contains 0.1% sodium azide. 5. Remove the 1.5-ml microcentrifuge tube from the stand and add an equal volume of RNase-Free Water. Mix well by repeated pipetting or by vortexing at medium speed. 6. Repeat steps 3, 4 and 5 (i.e. wash the beads a total of 2 times with RNase-Free water). 7. Remove the 1.5-ml microcentrifuge tube from the magnetic stand. Add a volume of Magnetic Bead Resuspension Solution equal to the number of reactions x 35 µl (e.g., for 12 reactions, add 12 x 35 = 420 µl Magnetic Bead Resuspension Solution). Mix well by repeated pipetting or by vortexing at medium speed. 8. Aliquot 35 µl of the washed Magnetic Beads into each new 1.5-ml RNase-free microcentrifuge tube (corresponding to the number of Ribo-Zero reactions). 9. Optional: Add 0.5 µl of RiboGuard RNase Inhibitor to each tube of resuspended Magnetic Beads, and mix briefly by vortexing. 10. Store the microcentrifuge tubes at room temperature until required in Part 3.C. 3.A.2. Individual Washing Procedure Note: Mix the Magnetic Beads well by pipetting or gentle vortexing. 1. For each reaction, pipet 90 µl of Magnetic Beads into a 1.5-ml RNase-free microcentrifuge tube. Pipet the Magnetic Bead suspension slowly to avoid air bubbles and to ensure pipetting of the correct volume. Store unused Magnetic Beads at 4 C. 2. Place each 1.5-ml microcentrifuge tube on the magnetic stand for at least 1 minute (until the solution appears clear). 3. With the 1.5-ml microcentrifuge tube still on the stand, remove and discard the supernatant. Caution: The supernatant contains 0.1% sodium azide. 4. Remove the 1.5-ml microcentrifuge tube from the magnetic stand and add 90 µl of RNase-Free Water to each tube. Mix well by repeated pipetting or vortexing at medium speed. 5. Repeat steps 2, 3 and 4 (i.e. wash the beads a total of 2 times with RNase-Free water). 6. Remove the 1.5-ml microcentrifuge tube from the magnetic stand. Add 35 µl of Magnetic Bead Resuspension Solution to each tube. Mix well by repeated pipetting or vortexing at medium speed. 7. Optional: Add 0.5 µl of RiboGuard RNase Inhibitor to each tube of resuspended Magnetic Beads, and mix briefly by vortexing. 8. Store the microcentrifuge tubes at room temperature until required in Part 3.C. 3.B. Treatment of the Total RNA Sample with Ribo-Zero rrna Removal Solution Required in Part 3.B Component Name Tube Label Cap Color Ribo-Zero Reaction Buffer Ribo-Zero Gold rrna Removal Solution (Epidemiology)) Ribo-Zero Reaction Buffer rrna Removal Solution (Epidemiology) RNase-Free Water RNase-Free Water Clear Additionally required for each reaction (provided by user): Magnetic stand or rack 0.2-ml or 0.5-ml microcentrifuge tube (RNase-free) Important! The maximum volume of the RNA sample and the volume of the Ribo-Zero rrna Removal Solution used per reaction is dependent on the amount of total RNA in the sample (see Table 1). Blue techhelp@epicentre.com (800)

6 Table 1. Volumes of Ribo-Zero rrna Removal Solution. Amount of Input Total RNA Maximum Volume of Total RNA That Can Be Added to Each Reaction Volume of Ribo-Zero rrna Removal Solution Used per Reaction ng 16 μl 2 μl ng 14 μl 4 μl 1. In a 0.2-ml or 0.5-ml RNase-free microcentrifuge tube, combine in the order given: x μl RNase-Free Water 2 μl Ribo-Zero Reaction Buffer μg Total RNA sample (see Table 1) y μl Ribo-Zero rrna Removal Solution (see Table 1) 20 μl Total volume 2. Gently mix the reaction(s) by pipetting and incubate at 68 C for 10 minutes. Store the remaining Ribo-Zero rrna Removal Solution and Ribo-Zero Reaction Buffer at 70 C to 80 C. 3. Remove the reaction tube(s) and incubate each at room temperature for 5 minutes. 3.C. Magnetic Bead Reaction and rrna Removal Required in Part 3.C: 50 C water bath or heating block for 2.0-ml tubes. 1. Using a pipette, add the treated RNA from Part 3.B to the 1.5-ml microcentrifuge tube containing the washed Magnetic Beads and, without changing the pipet tip, immediately and thoroughly mix the contents of the tube by pipetting at least 10 times. Then, vortex the tube immediately at medium setting for 10 seconds and place at room temperature. Repeat this process for each sample. Important! Always add the treated RNA sample to the washed Magnetic Beads and immediately mix by pipetting. Never add the Magnetic Beads to the treated RNA sample. Immediate and thorough mixing prevents the beads from forming clumps that can significantly impact the efficiency of the rrna removal. 2. Incubate the 1.5 ml microcentrifuge tube at room temperature for 5 minutes. 3. Following incubation, mix the reactions by vortexing at medium speed for 5 seconds and then place at 50 C for 5 minutes in an appropriate water bath or heating block. Avoid any significant condensation during this incubation step. 4. After the 5-minute incubation at 50 C, remove the microcentrifuge tubes and immediately place them on a magnetic stand for at least 1 minute (until the solution appears clear). 5. While still on the magnetic stand, carefully remove each supernatant (50-52 µl) containing the RNA and transfer to a labeled 1.5-ml RNase-free microcentrifuge tube. Important! The supernatant contains rrna-depleted RNA. Optional: If a small amount of Magnetic Beads are still visible in the supernatant, place the collected supernatant onto the magnetic stand for 1 minute. Remove the supernatant containing the rrna-depleted RNA and transfer to a new 1.5-ml RNase-free microcentrifuge tube. 6. Place the supernatant (RNA solution) on ice and immediately proceed to Part 3.D. Alternatively, the supernatant may be stored at 70 C to 80 C before completing Part 3.D. 3.D. Purification of the rrna-depleted Sample The rrna-depleted samples can be purified by three methods: ethanol precipitation, AMPure beads, or spin columns. Ethanol precipitation and the modified RNeasy MinElute procedure provide optimal recovery of small RNAs that may be lost with other purification methods; however, ethanol precipitation can be challenging for inexperienced users. We also provide an alternative protocol using AMPure beads (provided by the user) for ease of automation but this will not quantitatively recover small RNAs. 3.D.1. Ethanol Precipitation of the rrna-depleted Sample Component Name Tube Label Cap Color RNase-Free Water Sodium Acetate (3 M) Glycogen (10 mg/ml) RNase-Free Water Sodium Acetate Glycogen Clear 6

7 Additionally required for each reaction (provided by user): 1.5-ml microcentrifuge tube (RNase-free) Ice-cold 70% and 100% ethanol 1. Adjust the volume of each sample to 180 μl using RNase-Free Water. 2. Add 18 μl of 3 M Sodium Acetate to each tube. 3. Add 2 μl of Glycogen (10 mg/ml) to each tube and mix by gentle vortexing. 4. Add three volumes (600 μl) of ice-cold 100% ethanol to each tube and mix thoroughly by gentle vortexing. 5. Place the tubes at 20 C for at least 1 hour. 6. Centrifuge the tubes at >10,000 x g in a microcentrifuge for 30 minutes. Carefully remove and discard the supernatant. 7. Wash the pellet with ice-cold 70% ethanol and centrifuge at >10,000 x g for 5 minutes. Carefully remove and discard the supernatant. 8. Repeat Step 7 (above) one more time. 9. Centrifuge briefly to collect any residual supernatant. Carefully remove and discard the supernatant and allow the pellet to air dry at room temperature for 5 minutes. 10. Dissolve the pellet in 10 μl of RNase-Free Water or buffer. The Ribo-Zero-treated RNA can be used immediately or stored at 70 C to 80 C. 3.D.2. Agencourt RNAClean XP Kit (Cat. No. A63987, Beckman Coulter) Note: A fresh 80% ethanol solution is required for Steps 5 and 7 below. 1. Vortex the AMPure RNAClean XP Beads until they are well dispersed, then add as follows: Add 100 μl of the mixed AMPure XP Beads to each 1.5-ml microcentrifuge tube containing µl of rrna-depleted RNA from Part 3.D, Step 6. Mix thoroughly by gently pipetting the entire volume 10 times. 2. Incubate the tube(s) at room temperature for 15 minutes. During incubation, prepare 80% ethanol solution required for Steps 5 and Place the tube(s) on the magnetic stand at room temperature for at least 5 minutes (until the liquid appears clear). 4. Remove and discard the supernatant from each tube. Do not disturb the beads. 5. With the tube(s) still on the magnetic stand, add 200 μl of freshly prepared 80% ethanol to each tube, without disturbing the beads. 6. Incubate at room temperature for at least 30 seconds while still on the magnetic stand. Then remove and discard all of the supernatant from each tube. Do not disturb the beads. 7. Repeat Steps 5 and 6 (total of two 80% ethanol washes). 8. Allow the tubes to air dry on the magnetic stand at room temperature for 15 minutes. 9. Add 11 µl of RNase-Free water to each tube. 10. Thoroughly resuspend the beads by gently pipetting 10 times. 11. Incubate the tubes at room temperature for 2 minutes. 12. Place the tubes back onto the magnetic stand at room temperature for at least 5 minutes (until the liquid appears clear). 13. Transfer the clear supernatant from each tube to an appropriate collection tube, always leaving at least 1 μl of the supernatant behind to avoid carryover of magnetic particles. Store on ice for immediate use or store at 70 C or 80 C until required. 3.D.3. RNeasy MinElute Cleanup Kit (Cat. No , Qiagen) Note: RNA purification kits from other suppliers may also be used; however, performance may vary. 1. Adjust the sample to a volume of 100 μl with RNase-Free Water. Add 350 μl of Buffer RLT, and mix well. 3. Add 550 μl of 96%-100% ethanol to the RNA, and mix well by pipetting. Do not centrifuge. 4. Transfer half of the sample (~500 µl) to an RNeasy MinElute spin column placed in a 2-ml collection tube (supplied in the Qiagen kit). Close the lid gently, and centrifuge for 15 seconds at 8,000 x g (~10,000 rpm). Discard the flow-through. Reuse the collection tube for Step Transfer the remaining sample and repeat the centrifugation. Discard the flow-through and collection tube. 6. Place the RNeasy MinElute spin column in a new 2-ml collection tube (supplied in the Qiagen kit). Add 500 μl Buffer RPE to the spin column. Close the lid gently, and centrifuge for 15 seconds at 8,000 x g (~10,000 rpm) to wash the spin-column membrane. Discard the flow-through. Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to Buffer RPE before use. techhelp@epicentre.com (800)

8 7. Add 500 μl of 80% ethanol to the RNeasy MinElute spin column. Close the lid gently, and centrifuge for 2 minutes at 8,000 x g (~10,000 rpm) to wash the spin-column membrane. Discard the flow-through and collection tube. Note: After centrifugation, carefully remove the RNeasy MinElute spin column from the collection tube so that the column does not contact the flow-through. Otherwise, carryover of ethanol will occur. 8. Place the RNeasy MinElute spin column in a new 2-ml collection tube (supplied in the Qiagen kit). 9. Open the lid of the spin column, and centrifuge at full speed for 5 minutes. Discard the flow-through and collection tube. 10. To avoid damage to the spin-column lids, place the spin columns into the centrifuge with at least one empty position between columns. Orient the lids so that they point in a direction opposite to the rotation of the rotor (i.e., if the rotor rotates clockwise, orient the lids counterclockwise). 11. It is important to dry the spin-column membrane since residual ethanol may interfere with downstream applications. Centrifugation with the lids open ensures that no ethanol is carried over during RNA elution. 12. Place the RNeasy MinElute spin column in a new 1.5-ml collection tube (supplied in the Qiagen kit). Add 12 μl of RNase-Free Water directly to the center of the spin-column membrane. Close the lid gently, and centrifuge for 1 minute at full speed to elute the RNA. Recovery is usually 10 μl. The eluted RNA can be used immediately or stored at 70 C to 80 C. 4. Before Proceeding to ScriptSeq v2 Library Preparation For the yield of the Ribo-Zero-treated RNA, use Table 2 as a guide to the maximum volume of the purified RNA to use in ScriptSeq v2 library preparation. The indicated volume corresponds to ~500 ng total RNA prior to Ribo-Zero treatment. The lower limit corresponds to ~100 ng of total RNA prior to Ribo-Zero treatment. Note: Ribo-Zero-treated RNA purified by any of the three methods described in Part 3.D will be recovered in approximately 10 µl of RNase-Free Water. Table 2. Volume of Ribo-Zero -treated RNA to use in ScriptSeq v2 library preparation. RNA Sample Human/Mouse/Rat Amount of Total RNA Used in the Ribo-Zero Procedure Maximum Volume of Purified Ribo-Zero- Treated RNA for ScriptSeq v2 Reaction 500 ng 9 µl 100 ng 9 µl 8

9 Quick Protocol for ScriptSeq v2 RNA-Seq Library Preparation Kit For experienced users only! Step Procedure Pages Fragment RNA If using RNA from FFPE samples, go to Appendix Mix the following: 9 µl Ribo-Zero treated RNA (Table 2 in Part 4) 1 µl RNA Fragmentation Solution 2 µl cdna Synthesis Primer 11 Synthesize cdna Terminal-Tag cdna 12 µl Total volume 2. Incubate at 85 C for 5 minutes in thermocycler then place on ice. 1. Mix the following: 3.0 µl cdna Synthesis PreMix 0.5 µl 100 mm DTT 0.5 µl StarScript Reverse Transcriptase 4 µl Total Volume of cdna Synthesis Master Mix 2. Add 4 µl of cdna Synthesis Master Mix to each reaction. Mix by pipetting. 3. Incubate at 25 C for 5 min followed by 42 C for 20 min. 4. Cool reaction to 37 C. 5. Add 1.0 µl of Finishing Solution to each reaction. Mix by pipetting. 6. Incubate at 37 C for 10 min. 7. Incubate at 95 C for 3 min, cool to 25 C and Pause the thermocycler. 1. Mix the following: 7.5 µl Terminal Tagging Premix 0.5 µl DNA Polymerase 8.0 µl total volume of Terminal Tagging Master Mix Solution is viscous! Mix thoroughly by pipetting. 2. Add 8.0 µl of Terminal Tagging Master Mix to each reaction. Mix by pipetting. 3. Incubate reaction at 25 C for 15 minutes. 4. Incubate reaction at 95 C for 3 minutes. Cool to 4 C. The cdna is now di-tagged Purify cdna Choose Qiagen MinElute or Agencourt AMPure purification. Elute in 22.5 µl. 12 PCR If adding optional barcodes, go to p. 14 of protocol and skip this Quick Reference Protocol. If not adding barcodes: Mix in a 0.2-ml PCR tube: 22.5 µl di-tagged cdna 25 µl FailSafe PCR PreMix E 1 µl Forward PCR Primer 1 µl Reverse PCR Primer 0.5 µl FailSafe PCR Enzyme 50 µl total volume 13 Purify Library PCR cycle conditions: Denature the dsdna at 95 C for 1 minute followed by 15 cycles of: 95 C for 30 seconds 55 C for 30 seconds 68 C for 3 minutes Incubate at 68 C for 7 minutes after the final cycle AMPure purification. Qiagen purification only suggested for very short FFPE RNA samples (<200 nt) and will result in adaptor-dimer contamination. QC Library Quantify by Qubit or PicoGreen and visualize on Agilent BioAnalyzer Epicentre I Madison, WI I Phone: I I Fax: techhelp@epicentre.com (800)

10 5' 500 pg to 50 ng Ribo-Zero rrna-depleted treated or poly(a) RNA + RNA (AAAA) Random Hexamer with Tagging Sequence 3' NNNNNN Tagging Sequence Fragment RNA Anneal cdna Synthesis Primer Synthesize cdna 5' 3' NNNNNN 3' NNNNNN (AAAA) Remove RNA 3' 5' Terminal-Tagging Oligo (TTO) 3'-end blocked 5' NNNNNX Tagging Sequence Anneal TTO Synthesize DNA 5' NNNNNX 3' 5' Purify cdna Di-tagged cdna 3' 5' PCR Primers Amplify by PCR Index/Bar Code (optional) 5' 3' 3' 5' Adaptor-tagged RNA-Seq library for directional sequencing Bar Code (optional) Figure 1. An overview of the procedure for the ScriptSeq v2 RNA-Seq Library Preparation Kit. 10

11 5. ScriptSeq Kit Procedure Remove all components except enzymes and Finishing Solution, allow to thaw, and store on ice. Centrifuge briefly to collect liquid at bottom of tube. It is highly recommended that enzyme solutions and Finishing Solution be stored in a benchtop cooler ( 20 C) to avoid repeated freeze-thaws. 5.A. Fragment the RNA and Anneal the cdna Synthesis Primer Important! 1. If using severely fragmented RNA, such as that obtained from FFPE samples, use the procedure described in Appendix 1. Required in Part 5.A. 2. The RNA can be fragmented by methods other than those described in Part 5.A. If fragmenting the RNA by other methods, the fragmented RNA must be purified and dissolved in a maximum of 9 μl of Nuclease-Free Water. Then, use the procedure described in Appendix 1 to anneal the cdna synthesis primer and perform cdna synthesis. Component Name Tube Label Cap Color cdna Synthesis Primer RNA Fragmentation Solution cdna Primer Fragmentation Solution Green Nuclease-Free Water Nuclease-Free Water Clear 1. In a 0.2-ml PCR tube, assemble the following reaction mixture. If a no template control reaction is performed, substitute Nuclease-Free Water for the RNA sample. Ribo-Zero-treated RNA amounts shown in Table 2 in Part 4. x μl Nuclease-Free Water y μl Ribo-Zero-treated RNA (Table 2 in Part 4) 1 μl RNA Fragmentation Solution 2 μl cdna Synthesis Primer 12 μl Total reaction volume 2. Fragment RNA: Incubate at 85 C for 5 minutes in a thermocycler. 85 C 3. Stop the fragmentation reaction by placing the tube on ice. 5.B. Synthesize cdna Required in Part 5.B. Component Name Tube Label Cap Color cdna Synthesis PreMix cdna PreMix 100 mm DTT 100 mm DTT StarScript Reverse Transcriptase ScriptSeq Finishing Solution StarScript Reverse Transcriptase Finishing Solution Red 5:00 Thermocycler settings for Part 5.B: 25 C for 5 minutes (cdna synthesis) 42 C for 20 minutes (cdna synthesis) 37 C Pause 25 C 42 C 37 C 37 C for 10 minutes (Finishing Solution) 95 C for 3 minutes (Inactivate Finishing Solution) 25 C Pause 1. On ice, prepare the cdna Synthesis Master Mix: For each reaction, combine on ice: 3.0 μl cdna Synthesis PreMix 0.5 μl 100 mm DTT 0.5 μl StarScript Reverse Transcriptase 4.0 μl Total volume Gently but thoroughly mix the cdna Synthesis Master Mix by pipetting. 5:00 20:00 Pause 37 C 95 C 25 C 10:00 3:00 Pause techhelp@epicentre.com (800)

12 2. Add 4 μl of the cdna Synthesis Master Mix to each reaction on ice from Part 5.A, Step 3, and mix by pipetting. 3. Incubate at 25 C for 5 minutes followed by 42 C for 20 minutes. 4. Cool the reactions to 37 C and Pause the thermocycler. 5. Remove one reaction at a time from the thermocycler, add 1.0 µl of Finishing Solution, and mix gently but thoroughly by pipetting. Return each reaction to the thermocycler before proceeding with the next. 6. Incubate at 37 C for 10 minutes. 7. Incubate each reaction at 95 C for 3 minutes. Then, cool the reactions to 25 C and Pause the thermocycler. During the 95 C incubation, prepare the Terminal Tagging Master Mix as described in Part 5.C, Step C 25 C 37 C 5:00 20:00 Pause 37 C 95 C 25 C 10:00 3:00 Pause 5.C. 3 -Terminal-Tag the cdna Required in Part 5.C. Component Name Tube Label Cap Color ScriptSeq v2 Terminal-Tagging Premix Tagging PreMix DNA Polymerase DNA Polymerase Blue Important! The Terminal-Tagging PreMix is a viscous solution. Mix it thoroughly before use by pipetting. Thermocycler settings for Part 5.C: 25 C for 15 minutes (DNA Polymerase) 95 C for 3 minutes (Inactivate DNA Polymerase) 4 C Hold or ice 1. On ice, prepare the Terminal Tagging Master Mix. For each reaction, combine on ice: 7.5 μl Terminal Tagging Premix 0.5 μl DNA Polymerase 8 μl Total volume Thoroughly mix the viscous Terminal Tagging Master Mix by pipetting up and down several times or by flicking the tube. 2. Remove one reaction at a time from the thermocycler (from Part 5.B, Step 7) and add 8.0 μl of the Terminal Tagging Master Mix. Gently but thoroughly mix the reaction by pipetting. Return each reaction to the thermocycler before proceeding with the next. 3. Incubate each reaction at 25 C for 15 minutes. 25 C 95 C 4. Incubate each reaction at 95 C for 3 minutes. Then, cool the reactions to 4 C on ice or in the thermocycler. 5.D. Purify the cdna The cdna must be purified prior to PCR amplification. We recommend using the MinElute PCR Purification Kit (Qiagen) or the Agencourt AMPure XP system (BeckmanCoulter). If working with FFPE RNA, you must use the MinElute PCR Purification kit. If using the MinElute PCR Purification Kit, follow the manufacturer s directions. Elute the cdna using 25 μl of the EB Buffer (Elution Buffer) that is provided in the MinElute Kit. The 25-μl volume typically yields a final volume of 22.5 μl. However, if necessary, adjust the eluate to 22.5 μl with EB Buffer. If using a column purification method other than the MinElute PCR Purification Kit, adjust the eluate volume to 22.5 μl. If using the AMPure XP System, the purification can be done in a 96-well plate or in the microfuge tubes containing the di-tagged cdna from Part 5.C, Step 4. The procedure described uses a 1.8X AMPure XP purification scheme. 1. Warm the AMPure XP beads to room temperature. While the beads warm, prepare 400 µl of fresh 80% ethanol at room temperature for each sample. 2. If performing the AMPure XP procedure using a 96-well plate format, transfer each di-tagged cdna from Part 5.C, Step 4 independently into a well of the plate. 3. Important! Vortex the AMPure XP beads until they are a homogeneous suspension. 25 C 95 C 4. Add 45 μl of the beads to each well of the 96-well plate or to each microfuge tube containing di-tagged cdna from Part 5.C, Step 4. 15:00 15:00 4 C 3:00 Pause 4 C 3:00 Pause 12

13 5. Mix thoroughly by gently pipetting the entire volume of each well/tube 10 times. 6. If using microfuge tubes, transfer each 70-μl volume to a separate 1.5-ml tube. 7. Incubate the 96-well plate or 1.5-ml microfuge tubes at room temperature for 15 minutes. 8. Place the 96-well plate or the 1.5-ml tubes in a magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 9. Remove and discard the supernatant from each well/tube using a pipette. Some liquid may remain in each well/tube. Take care not to disturb the beads. 10. With the plate or 1.5-ml tubes remaining on the magnetic stand, add 200 μl of 80% ethanol to each well/tube without disturbing the beads. 11. Incubate the plate or 1.5-ml tubes at room temperature for at least 30 seconds, then remove and discard all of the supernatant from each. Take care not to disturb the beads. 12. Repeat steps 10 and 11 one more time for a total of two 80% ethanol washes. 13. Allow the plate or tubes to air-dry on their magnetic stands for 15 minutes at room temperature. 14. Add 24.5 µl of Nuclease-Free Water to each well/tube and remove from the magnetic stand. 15. Thoroughly resuspend the beads by gently pipetting 10 times. 16. Incubate the plate or tubes at room temperature for 2 minutes. 17. Place the plate or tubes on the magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 18. Transfer 22.5 μl of the clear supernatant, which contains the di-tagged cdna, from each well/tube to a new 0.2-ml PCR tube. 19. Place the tubes on ice and proceed to Part 5.E or place at 20 C for longer-term storage. 5.E. Amplify the Library and Add an Index (Barcode) This step generates the second strand of cdna, completes the addition of the Illumina adaptor sequences, incorporates an Index or a user-defined barcode, if desired, and amplifies the library by PCR. Typically, PCR cycles are performed. At least one PCR cycle must be done. More PCR cycles can be performed if a greater yield of the library is needed. Adding an Index Read or a user-defined barcode. The standard ScriptSeq v2 reaction using the Reverse PCR Primer that is included in the kit produces a nonbarcoded library. To add: An Illumina Index, replace the Reverse PCR Primer that is included in this kit with one of the ScriptSeq Index PCR Primers, available separately from Epicentre (see Related Products). Only Epicentre s ScriptSeq Index PCR Primers are compatible with the ScriptSeq v2 Kit procedure. A user-defined barcode, see Appendix 3. Choice of PCR enzyme. This kit is optimized for use with Epicentre s FailSafe PCR Enzyme. We do not recommend using other PCR enzymes, as the yield and quality of the final library may be adversely affected. Required in Part 5.E. Component Name Tube Label Cap Color FailSafe PCR PreMix E Forward PCR Primer Reverse PCR Primer FailSafe PCR PreMix E Forward PCR Primer Reverse PCR Primer Yellow Nuclease-Free Water Nuclease-Free Water Clear Provided by the user: FailSafe PCR Enzyme Mix (Epicentre). Important! If you are adding an Index or user-defined barcode to the library, do not use the Reverse PCR Primer that is included in this kit! Instead, use the Index- or barcode-containing oligo as the Reverse PCR Primer in this procedure. 1. In a 0.2-ml PCR tube, add on ice: 22.5 μl di-tagged cdna from Part 5.D 25 μl FailSafe PCR PreMix E 1 μl Forward PCR Primer 1 μl Reverse PCR Primer (or ScriptSeq Index PCR Primer, or user-defined barcode Reverse PCR Primer) 0.5 μl FailSafe PCR Enzyme (1.25 U) 50 μl Total volume techhelp@epicentre.com (800)

14 2. Perform PCR 15 cycles Denature the ds DNA at 95 C for 1 minute Followed by 15* cycles of: 95 C for 30 seconds 55 C for 30 seconds 68 C for 3 minutes *Fewer PRC cycles can be performed. After the appropriate number of PCR cycles, incubate at 68 C for 7 minutes. During the PCR, read Part 5.F to determine which post-pcr purification procedure is best suited to your sample. After the PCR procedure is complete, proceed immediately to Part 5.F. 5.F. Purify the RNA-Seq Library Use the AMPure XP system (Beckman Coulter) to purify the ScriptSeq v2 kit libraries, except for libraries prepared from FFPE RNA with an average size <200 nt. The AMPure XP System is best at removing the primer-dimers that can occur during PCR. Note: Use the MinElute PCR Purification system (Qiagen) only for purifying libraries made from FFPE RNA with an average size <200 nt. Libraries purified using the MinElute columns will be contaminated with primer-dimers. 5.F.1. AMPure XP Purification 1. Warm the AMPure XP beads to room temperature. While the beads warm, prepare 400 µl of fresh 80% ethanol at room temperature for each sample. 2. If using a 96-well plate format, transfer each amplified library from Part 5.E, Step 2, independently into a well of the plate. 3. Important! Vortex the AMPure XP beads until they are a homogeneous suspension. 4. Add 50 μl of the beads to each well of the 96-well plate or to each PCR tube. 5. Mix thoroughly by gently pipetting the entire volume up of each well/tube 10 times. 6. If using microfuge tubes, transfer each 100-μl volume to a separate 1.5 ml tube. 7. Incubate the 96-well plate or 1.5-ml microfuge tubes at room temperature for 15 minutes. 8. Place the 96-well plate or the 1.5-ml tubes in a magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 9. Remove and discard the supernatant from each well/tube using a pipette. Some liquid may remain in each well. Take care not to disturb the beads. 10. With the plate or 1.5-ml tubes remaining on the magnetic stand, add 200 μl of 80% ethanol to each well/tube without disturbing the beads. 11. Incubate the plate or 1.5-ml tubes at room temperature for at least 30 seconds, then remove and discard all of the supernatant. Take care not to disturb the beads. 12. Repeat steps 9 and 10 one more time for a total of two 80% ethanol washes. 13. Allow the plate or tubes to air-dry on their magnetic stands for 15 minutes at room temperature. 14. Add 20 µl of Nuclease-Free Water to each well/tube and remove the plate or 1.5-ml tubes from their magnetic stand. 15. Thoroughly resuspend the beads by gently pipetting 10 times. 16. Incubate the plate or tubes at room temperature for 2 minutes. 17. Place the plate or tubes on the magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 18. Transfer the clear supernatant, which contains therna-seq library, from each well/tube to an appropriate collection tube for assessment of library quantity and quality. 5.F.2. MinElute PCR Purification Kit for Highly Fragmented RNA Samples Use the MinElute PCR Purification Kit to purify ScriptSeq libraries made from FFPE RNA of average size <200 nt. This procedure uses the Exonuclease I enzyme provided in the ScriptSeq Kit. 1. Remove excess PCR primers by adding 1 μl of Exonuclease I to each reaction and incubate the reactions at 37 C for 15 minutes. 2. Purify the library using the MinElute Kit procedure described by the manufacturer. 5.G. Assess Library Quantity and Quality 95 C 95 C 55 C :30 :30 3:00 7:00 The library should be quantified by your laboratory s standard methods. The size distribution can be assessed using the 2100 Bioanalyzer (Agilent). 1:00 68 C 68 C 14

15 6. Appendices Appendix 1: Preparing a Library from Severely Fragmented RNA Use this procedure when preparing libraries of Ribo-Zero treated RNA: That is highly fragmented, such as sometimes obtained from FFPE samples. That has been fragmented using a procedure different than that described in Part 5.A. 6.1.A. Anneal the cdna Synthesis Primer Required in Part 6.1.A. Component Name Tube Label Cap Color cdna Synthesis Primer cdna Primer Green Nuclease-Free Water Nuclease-Free Water Clear 1. If a no template control reaction is performed, substitute Nuclease-Free Water for the RNA sample. x μl Nuclease-Free Water y μl Ribo-Zero treated FFPE RNA (Table 2 in Part 4) 2 μl cdna Synthesis Primer 11 μl Total volume 2. Incubate at 65 C for 5 minutes in a thermocycler. 3. Stop the reaction by placing the tube on ice. 6.1.B. Synthesize cdna Required in Part 6.1.B. 65 C 5:00 Component Name Tube Label Cap Color RNA Fragmentation Solution Fragmentation Solution Green cdna Synthesis Premix cdna PreMix 100 mm DTT 100 mm DTT StarScript Reverse Transcriptase StarScript Reverse Transcriptase Red ScriptSeq Finishing Solution Finishing Solution Nuclease-Free Water Nuclease-Free Water Clear Thermocycler settings for Part 6.1.B: 25 C for 5 minutes (cdna synthesis) 42 C for 20 minutes (cdna synthesis) 37 C Pause 25 C 5:00 42 C 37 C 20:00 Pause 37 C for 10 minutes (Finishing Solution) 95 C for 3 minutes (Inactivate Finishing Solution) 25 C Pause 37 C 95 C 25 C Note: The RNA Fragmentation Solution is added to supplement Mg 2+ in the cdna synthesis reaction. 1. Prepare the cdna Synthesis Master Mix. For each reaction, combine on ice: 1.0 μl Fragmentation Solution 3.0 μl cdna Synthesis Premix 0.5 μl 100 mm DTT 0.5 μl StarScript Reverse Transcriptase 5 μl Total volume Gently but thoroughly mix the cdna Synthesis Master Mix by pipetting 10 times. 2. Add 5 μl of the cdna Synthesis Master Mix to each reaction on ice from Part 6.1.A, Step 3 and mix gently but thoroughly. 10:00 3:00 Pause techhelp@epicentre.com (800)

16 3. Incubate at 25 C for 5 minutes followed by 42 C for 20 minutes. 4. Cool the reactions to 37 C and pause the thermocycler. 5. Remove one reaction at a time from the thermocycler, add 1.0 µl of Finishing Solution, and mix gently but thoroughly by pipetting. Return each reaction to the thermocycler before proceeding with the next. 6. Incubate at 37 C for 10 minutes. 7. Incubate each reaction at 95 C for 3 minutes. Then, allow the reactions to cool to 25 C and Pause the thermocycler. During the 95 C incubation, prepare the Terminal Tagging Master Mix as described in Part 5.C, Step Continue with the standard kit procedure beginning at Part 5.C. 42 C 25 C 37 C 5:00 20:00 Pause 37 C 95 C 25 C 10:00 3:00 Pause Appendix 2: Sequencing a ScriptSeq v2 Library Note: Oligonucleotide sequences Illumina, Inc. All rights reserved. ScriptSeq RNA-Seq libraries are compatible with TruSeq Cluster Kits and can be sequenced on GAII, HiSeq and MiSeq sequencers. Rd 2 SP TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG 5 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ---cdna (sense orientation) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC(Barcode)ATCTCGTATGCCGTCTTCTGCTTG 3 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA---cDNA (antisense orientation)--- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG(Barcode)TAGAGCATACGGCAGAAGACGAAC 5 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Rd 1 SP 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Index SP Figure 3. Sequencing a ScriptSeq v2 library. Red = sequence incorporated by the Terminal Tagging process and PCR amplification. Blue = sequence incorporated during reverse transcription and PCR amplification. Black = sequence of the cdna. Rd 1 SP = sequence generated is that of the sense strand of the original fragmented RNA molecule. Rd 2 SP = sequence generated is that of the antisense strand of the original fragmented RNA molecule. Index SP = first nucleotide read is that of the Index or barcode. Appendix 3: Adding a User-Defined Barcode to the Library Note: Some nucleotide sequences shown in Appendix 3 are copyrighted to Illumina, Inc. Oligonucleotide sequences Illumina, Inc. All rights reserved. A barcode is added by the Reverse PCR Primer in Part 5.E of the procedure. A Reverse PCR Primer containing a user-defined barcode sequence must be synthesized by the user and is then used as the Reverse PCR Primer in Part 5.E of the procedure. The user-defined Reverse PCR Primer(s) must be the following sequence: 5 CAAGCAGAAGACGGCATACGAGAT desired barcode s GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 reverse complement The primer(s) should be dissolved to a concentration of 10 μm in nuclease-free water. Important! The user-defined barcode sequence of the of the custom synthesized Reverse PCR Primer should be the reverse complement of the sequence read. For example, using the Illumina Multiplexing Index Read Sequencing Primer, the user-defined barcode sequence: 5 ACGTAC 3 will be read as: 5 GTACGT 3 Please contact Epicentre s Technical Support if you have questions about adding user-defined barcodes or synthesizing custom reverse PCR primers. 16

17 Appendix 4: Profiles of ScriptSeq Complete RNA-Seq Libraries. Fig. 4 shows representative 2100 Bioanalyzer (Agilent) profiles of RNA-Seq libraries produced by the ScriptSeq Complete Gold Kit (Epidemiology) Low Input. A B Figure 4. Representative profiles of ScriptSeq Complete libraries. Aliquots (0.1 ug and 0.5 ug) of a 2:1:1 mixture of Universal Human Reference, Gram-positive, and Gram-negative bacterial total RNA were treated with the Ribo-Zero Gold Kit (Epidemiology) as outlined in Table 1. Following rrna depletion, an aliquot corresponding to either 100 ng (A) or 500 ng (B) total RNA equivalence was used as input for the ScriptSeq v2 process. Average yields based on NanoDrop quantitation were ~15 ng/µl and ~50 ng/µl, respectively. Libraries were purified using AMPure XP beads and approximately 2 ng of each library was analyzed on an Agilent 2100 Bioanalyzer using the high-sensitivity DNA assay. techhelp@epicentre.com (800)

18 7. Related Products Cat. # FailSafe PCR Enzyme Mix FSE51100 FSE5101K ScriptSeq Index PCR Primers (Set 1) RSBC10948 ScriptSeq Index PCR Primers (Set 2) SSIP1202 ScriptSeq Index PCR Primers (Set 3) SSIP1203 ScriptSeq Index PCR Primers (Set 4) SSIP1204 ScriptSeq Index PCR Primers (Sets 1-4) SSIP1234 ScriptSeq Complete Gold Kit (Epidemiology) BEP1206 BEP1224 ScriptSeq Complete Gold Kit (Human/Mouse/Rat) BG1206 BG1224 ScriptSeq Complete Gold Kit (Human/Mouse/Rat)-Low Input SCL6H SCL24H ScriptSeq Complete Kit (Plant Leaf) BPL1205 ScriptSeq Complete Kit (Plant Seed/Root) BSR1206 ScriptSeq Complete Kit (Bacteria) BB1206 BB1224 ScriptMiner Small RNA-Seq Library Preparation Kit SMMP Prepares singleplex or barcoded Illumina -compatible libraries from small RNA. Quantity 100 Units 1,000 Units 48 Reactions each of 12 Primers 48 Reactions each of 12 Primers 48 Reactions each of 12 Primers 48 Reactions each of 12 Primers 48 Reactions each of 48 Primers 6 Reactions 24 Reactions 6 Reactions 24 Reactions 6 Reactions 24 Reactions 6 Reactions 6 Reactions 6 Reactions 24 Reactions 12 Reactions FailSafe, Ribo-Zero, ScriptMiner, ScriptSeq, and StarScript are trademarks of Epicentre, Madison, Wisconsin. Illumina is a registered trademark and TruSeq is a trademark of Illumina Inc., San Diego, California. AMPure is a registered trademark of Beckman Coulter, Inc., Danvers, Massachusetts. MinElute is a registered trademark of Qiagen Inc., Valencia, California. Visit our technical blog: epicentral.blogspot.com 18