Supporting Information

Transcription

1 Supporting Information Luminescence sensing for qualitative and quantitative detection of 5-methylcytosine Yushu Yuan,, Tingting Hong,, Yi Chen, Yafen Wang, Xueping Qiu, Fang Zheng, Xiaocheng Weng, *, and Xiang Zhou *, College of Chemistry and Molecular Sciences, Key Laboratory of Biomedical Polymers of Ministry of Education,, Wuhan University, Wuhan, Hubei, , P. R. China. Zhongnan Hospital, Wuhan University, Wuhan, Hubei, , P. R. China. These authors contributed equally. *To whom correspondence should be addressed: (Xiang Zhou) (Xiaocheng Weng) List of Contents: 1. Experimental Methods 2. Table S1 DNA oligonucleotides used in this study. 3. Table S2 The sequences of primers used in this study. 4. Figure S1. Polyacrylamide gel electrophoresis. 5. Figure S2. BGS results of the E-cadherin methylation level of MDA-MB Figure S3. BGS results of the E-cadherin methylation level of HepG2. 7. Figure S4. BGS results of the E-cadherin methylation level of MCF Notes and references. S-1

2 1. Experimental Methods Eectrophoresis analysis of the primer extension reaction: About 70 ng purified PCR products of the five 76-mer target strands were used in each reaction tube respectively. The reactions were performed in 1 µl 10 Klenow Buffer, 1 µl 2 µm FAM-labeled primer, 0.5 Unit KF exo- DNA polymerase. The final concentration for dntps is 20 µm. The mixtures were incubated at 37 C for 30 min, then quenched by adding 30 µl formamide. The mixtures were heated at 90 C for 10 min and cooled down to 4 C immediately. Extension products were separated on 20% denaturing polyacrylamide gels (shown in figure S1). Synthesis of dgppppa: dgppppa was synthesized followed previously reported. 1 ATP (60 mg, 40 µmol) was dissolved in 1 ml anhydrous DMF. Then carbonyldiimidazole (CDI, 25.8 mg, 160 µmol) was added. The mixture was stirred at room temperature for 5 h, after that 50 µl MeOH was added to the system to quench the reaction. The solvents were removed under high vacuum, and 1 ml anhydrous DMF was used to redissolve the residue. Then dgmp in 1 ml DMF and anhydrous MgCl 2 (5 mg) was added. The mixture was stirred for 72 h at room temperature and then acetone (20 ml) was added to precipitate the product. The precipitate was washed twice with 10 ml acetone. The desired product was purified by reverse-phase HPLC (RPHPLC) using a preparative C18 column with mobile phase A (100 mm TEAA buffer, ph 7.0) and B (CH 3 CN) with a flow rate of 1 ml/min at 35 C (B conc.: % / min). After that, the products were further purified by a DEAE Sephadex G-25 anion exchange column, and eluted with 500 mm NH 4 HCO 3. The products were gathered and freeze-dried to yield the final products as a white powder. BGS analysis of genomic methylation level: Bisulfite treated genomic DNA was amplified by PCR, and the PCR product was purified. The concentration was quantified by NanoDrop 2000c. The fragment was inserted into a plasmid T-vector (peasy-t5 Zero Cloning Kit) according to the manufactuer s instructions for Sanger sequencing. For each cancer cell lines, ten individual clones were randomly chosen for sequencing analysis. 2. Table S1. DNA oligonucleotides used in this study. Name Sequence (5 to 3 ) Template-con CCTCACCATCTCAACCAATATTATATTACGCGTATAACGCGTATTGCGCGCTATAATATTGAGGGAGAAGTGGTGA Template-1m CCTCACCATCTCAACCAATATTATATTA m CGCGTATAACGCGTATTGCGCGCTATAATATTGAGGGAGAAGTGGTGA Template-2m CCTCACCATCTCAACCAATATTATATTA m CG m CGTATAACGCGTATTGCGCGCTATAATATTGAGGGAGAAGTGGTGA Template-4m CCTCACCATCTCAACCAATATTATATTA m CG m CGTATAA m CG m CGTATTGGCGCTATAATATTGAGGGAGAAGTGGTGA Template-6m CCTCACCATCTCAACCAATATTATATTA m CG m CGTATAA m CG m CGTATTG m CG m CGCTATAATATTGAGGGAGAAGTGGTGA 3. Table S2. The sequences of primers used in this study. Name Sequence (5 to 3 ) Forward primer-76mer templates GGGTTTTATTATTTTAATTAATATTATATT Reverse primer- 76mer templates TCACCACTTCTCCCTCAAT Extension primer 1 FAM- TCACCACTTCTCCCTCAAT Extension primer 2 TCACCACTTCTCCCTCAATATTATAGC Forward primer-e-cadherin TAGTAATTTTAGGTTAGAGGGTTAT Reverse primer-e-cadherin AAACTCACAAATACTTTACAATTCC Forward primer-acp1 CGGGTATTTATTGTTGTTC Reverse primer-acp1 ACCTTAAACCTAAACGCTC Forward primer-trim58 GAGGAGGGATTTTAGTTAGAAATGTTTA Reverse primer-trim58 ACTCCTACAAAAAATCCAAACACAC 4. Figure S1. Polyacrylamide gel electrophoresis analysis of the extension process for targets containing 0, 1, 2, 4 and 6 methylation sites. S-2

3 5. Figure S2. BGS analysis of genomic E-cadherin methylation level from cancer cell line MDA-MB-231, (a-j) stand for the results from 10 clones, and methylation sites are highlighted. S-3

4 6. Figure S3. BGS analysis of genomic E-cadherin methylation level from cancer cell line HepG2. (a-j) stand for the results from 10 clones, and methylation sites are highlighted. S-4

5 7. Figure S4. BGS analysis of genomic E-cadherin methylation level from cancer cell line MCF-7. (a-j) stand for the results from 10 clones, and methylation sites are highlighted. S-5

6 8. Notes and references (1)Ji, D.; Mohsen, M. G.; Harcourt, E. M.; Kool, E. T. ATP-Releasing Nucleotides: Linking DNA Synthesis to Luciferase Signaling Angew. Chem. Int. Ed. 2016, 55, S-6