Authors: Adam Cheng (Undergraduate), Clarence Pasion (Undergraduate), Xiulin Shen (Graduate Student), Jiayu Liao (Assistant Professor)

Transcription

1 Authors: Adam Cheng (Undergraduate), Clarence Pasion (Undergraduate), Xiulin Shen (Graduate Student), Jiayu Liao (Assistant Professor) A novel strategy of protein engineering in dissecting SUMO interactions within the JAK/STAT pathway. Adam Cheng, Clarence Pasion, Xiulin Shen, and Jiayu Liao, Department of Bioengineering Abstract SUMOylation is one of many post-translational modifications that occurs in all eukaryotes and is involved in the signal transduction and transcription processes as well as genome integrity. Small ubiquitin-like modifiers (SUMOs) are involved in the JAK/STAT (Signal Transducer and Activator of Transcription) signal transduction pathway, which is responsible for antiviral immune response in human. STAT is regulated by PIAS (Protein Inhibitors of Activated STATs), which acts as an E3 ligase for SUMO conjugation to STAT protein and inhibits the transcription. However, SUMO can be cleaved from STAT by SENP (sentrin-specific protease) in vivo. To analyze the regulation of this pathway, specific amino acids of SUMO were mutated to alanine or a stop codon TAG. Using recently developed methods for unnatural amino acid incorporation, these mutants will be transfected into eukaryotic cells along with SENP, where the alanine-mutated SUMOs will lose SENP-SUMO interaction, while TAG mutated SUMOs may show SENP-SUMO crosslinked complexes when engineered trna and trna synthetase are co-expressed. This incorporation of cross-linker unnatural amino acid with a benzophenone functional group, will allow the dissection of specific interactions between each of the members of STAT, SUMO, SENP and PIAS, and will be an invaluable tool to elucidate the complex interactions among SUMO networks. 1

2 Introduction The JAK/STAT signaling pathway controls the production of Th1 cell differentiation 1 and a wide variety of other immune system functions 2, which endows importance in the analysis of the pathway. The pathway is implicated in the immune response to the H5N1 Avian Flu virus and the H1N1 Spanish Flu virus 3. Studies done on the influenzas indicate that they may hyperinduce cytokine production in a phenomenon called the cytokine storm 4,5, which is an autoimmune response that often results in death. In light of the pathway s importance in these past and possible future pandemics, finding new and solid methods to study the regulation of the pathway is desirable. The JAK/STAT pathway is stimulated when a cytokine, such as interferon, binds to the cytokine receptor embedded in the membrane. This activates the Janus Kinase (JAK) protein, which phosphorylates a tyrosine residue on the receptor. JAK then recruits STAT, phosphorylating it. Two STAT peptides subsequently are dimerized into an active form, which is able to stimulate transcription of the immune response genes 2. This response can be regulated through a key mechanism: SUMOylation of STAT. SUMO1 is a short 101 amino acid protein that has regulatory properties in the JAK/STAT1 pathway. 2

3 Figure 1: SUMO's molecular structure. It cascades down a series of intermediate proteins similar to ubiquitination, finally being ligated to the STAT dimer by PIAS. The presence of PIAS has an inhibitory effect on the DNA binding ability of the STAT dimer, effectively disabling transcription of the immune response genes 6. SUMO1 can be cleaved from STAT by sentrin-specific protease 2 (SENP2). This will reenable transcription of the products of this pathway. Figure 2: SUMO is passed from enzyme to enzyme in a mechanism similar to ubiquitination. Two key protein engineering techniques are used to analyze the pathway. The first method is to incorporate a photocrosslinking amino acid, p-benzoylphenylalanine, into SUMO1 through engineering the main components of the protein synthesis pathway. By inserting the crosslinking amino acid into the active site of SUMO1, the protein can be covalently linked to any other proteins, namely SENP2, that may be interacting with it at that binding domain. The mechanism of bonding is shown in Figure 3. 3

4 Figure 3: The mechanism by which benzophenone crosslinks to another carbon molecule by activation with light. The second method used to analyze the JAK/STAT1 pathway is to mutate amino acids at the active sites on SUMO1 so that any interaction between SUMO1 and other proteins will be destroyed. Since SENP2 can cleave SUMO1 from STAT1, inactivation of this reaction will lead to a permanent attachment of SUMO1 to STAT1 and therefore will disable transcription activation. 4

5 Results Oligonucleotides for SUMO1 with inherent and deliberate mutations were designed (Table 1) and inserted into a polymerase chain reaction with the wild-type SUMO1 template. The mutations were then copied into the SUMO1 inserts, creating pieces of DNA with targeted mutations within different parts of the molecule. The codons corresponding to leucine 62, glutamic acid 93, and threonine 95 were all mutated to TAG, the amber stop codon, while arginine 63 and glutamine 94 were mutated to GCA, the codon for alanine. Table 1: Oligonucleotides yielding the mutated constructs. Amino Acid Leucine 62 Glutamic Acid 93 Threonine 95 Amino Acid Arginine 63 Glutamine 94 Amber codon mutations Important oligonucleotides Forward middle CCAATGAATTCATAGAGGTTTCTCTTT Reverse middle AAAGAGAAACCTCTATGAATTCATTGG 3' Reverse GCGGCCGCTTAACCCCCCGTTTGCTACTGATAAACTTC 3' Reverse GCGGCCGCTTAACCCCCCTATTGTTCCTGATA Alanine mutations Important oligonucleotides Forward middle ATGAATTCACTCGCATTTCTCTTTGAG Reverse middle CTCAAAGAGAAATGCGAGTGAATTCAT 3' Reverse GCGGCCGCCTAACCCCCCGTTGCTTCCTGATAAAC Then, the SUMO1 DNA molecules were inserted into the pcrii-topo vector, which were digested using the SalI and NotI restriction enzymes. The digested fragments were ligated to a mammalian expression vector, pcmv-ha. The SUMO1 mutation constructs involving 5

6 mutagenesis of amino acids to alanine were transfected into HEK-293 cells. As seen in Figure 4, the Western Blot shows expression of SUMO1 and STAT1. STAT1 Antibodies targeting STAT1 Antibodies targeting the HA tag Figure 4: Western Blot for alanine mutated SUMO1 constructs. 6

7 Discussion A technique needed for analysis of the regulation of the JAK/STAT pathway involves incorporating unnatural amino acids into proteins in vivo. Most organisms have a set genetic code that only uses 20 natural amino acids. This technique involves engineering the central constituents of the protein synthesis machinery in order to expand the genetic code 7. First, the aminoacyl-trna synthetase s (aars) active site must be engineered in a way that it only binds the unnatural amino acid and no others. Also, it must only recognize an engineered trna, not any endogenous ones. This trna has a special anticodon that corresponds to a sequence that does not appear in any other sites on the protein, and is only recognized by the designed synthetase. When these two tools are incorporated into an organism s genetic code, the result is an organism that transcends the twenty amino acid limit, incorporating 21 amino acids into its proteins. By using a photocrosslinking amino acid, any carbon molecule that enters the vicinity of the benzophenone at the active site will become covalently and permanently crosslinked to the unnatural amino acid. The benefit to protein-protein analysis here is obvious, where the covalent bonding allows SUMO1 to fish out any molecules that interact with it at that specific mutation site. Mutation sites were chosen based on the distance between the two molecules and any interactions between the postulated interacting molecules, SUMO1 and the SENP family. Two main interacting sites are shown in figures 5 and 6. SUMO1 s 63 rd amino acid, arginine, and its 94 th amino acid, glutamine, form one and two salt bridges respectively with aspartic acid 413 on SENP2. These interactions likely make them key constituents of the catalytic power of SENP2 to cleave SUMO1 from STAT. Therefore, the mutation sites selected for SUMO1 were glutamine 94 and arginine 63. 7

8 Figure 5: Arginine 63 has one strong interaction. Figure 6: Glutamine 94 has two salt bridges with aspartic acid 413. At this point, two strategies to analyze the interaction were developed. The first was to mutate the interacting amino acids, arginine 63 and glutamine 94, to alanine. This would destroy any salt bridges between the amino acids and aspartic acid 413. Therefore, if the interaction is destroyed, SENP2 will not be able to destroy the interaction between STAT and SUMO. The second strategy developed was to mutate the surrounding amino acids, leucine 62, glutamic acid 93, and threonine 95, to the amber stop codon, TAG, so that unnatural amino acid incorporation could occur. These amino acids are optimal for the unnatural amino acid mutation because the interacting amino acids 63 and 94 will pull the active site together, while the neighboring amino acids will be close enough to be stimulated by light and react with an amino acid on SENP2. 8

9 The expected results vary between the two mutation methods. The alanine mutation is expected to destroy the interactions between SUMO1 and SENP2, which would yield a permanently bonded STAT1-SUMO1 complex. In contrast, the unnatural amino acid mutations are expected to covalently bond SUMO1 and SENP2, yielding a SUMO1-SENP2 complex (Figure 7). These results will be visible on the Western Blot, which is simulated in Figure 8. Figure 7: A 3D rendering of a crystallized SUMO1-SENP2 complex. Figure 8: Schematic diagram of Western blot of the final result pattern. Looking at the Western Blot shown in Figure 4, the STAT1 targeted half shows that the STAT1 protein is produced in significant levels. The HA-tag half, which is able to detect SUMO1, has much more activity, which shows the importance of SUMO1 as a regulator in 9

10 many different cellular processes. A clear band for STAT1 is shown for the mutated SUMO1 constructs, which indicate that the mutations likely create a loss of activity between SUMO1 and SENP2. The unnatural amino acid section of this experiment is yet to be performed, but will provide a more decisive picture of this pathway when completed. 10

11 Materials and Methods Mutations. Five separate SUMO1 mutations were created by using the polymerase chain reaction (PCR). By exchanging codons on the wild type DNA sequence at the appropriate sites for a certain target sequence, primers could be designed to incorporate these codon mutations. The mutations to the 93 rd, 94 th, and 95 th amino acids were created by mutating the reverse primer at the appropriate sites. The amino acids in the middle of the protein were mutated by creating forward and reverse primers for each half of the protein with the appropriate mutation, and running the PCR reaction. Then the individual halves of SUMO1 s DNA were inserted into the same solution with the wild-type forward and reverse primers in order to create the finalized mutations. Leucine 62, glutamic acid 93, and threonine 95 were mutated to TAG, the amber stop codon. Glutamine 63 and aspartic acid 94 were mutated to alanine. Creation of transfectable constructs. In order to analyze the interactions within systems applicable to human health, the SUMO1 mutations must be able to be expressed within mammalian cells. To accomplish this, the mutations were inserted into a mammalian expression vector. After the PCR mutations, the DNA was inserted into the TOPO pcrii cloning vector (Invitrogen). The PCR inserts were then released from the cloning vector using restriction enzymes NotI and XhoI, the expression vector digested with the same enzymes, and the two fragments were ligated together using T4 DNA Ligase at room temperature. Expression of proteins. The DNA constructs with the alanine mutations, along with proteins expressing STAT1 protein, were transfected into HEK-293 mammalian cells using Fugene 6 (Roche Diagnostics). After the cells were allowed to recover, the cytokine interferon was added into solution to stimulate the pathway. The cells were given time to express the protein, and the cells were lysed and frozen for later analysis. 11

12 In contrast, the TAG mutated SUMO constructs will be co-transfected with the DNA constructs coding for the engineered trna and aminoacyl-trna synthetase. Six hours after transfection, the unnatural amino acid must be added to solution in order for the cells to incorporate it into SUMO1. Light will be used to activate the benzophenone, and stimulate covalent bonding of the interacting proteins. Analysis. The analysis of the interactions that occurred was done using Western Blots. The film was developed and the protein sizes could be analyzed to see what interactions occurred. 12

13 References 1 Kaplan, Mark H. and Michael J. Grusby. Regulation of T helper cell differentiation by STAT molecules. J. Leukoc. Biol (1998) 64: Levy, David E., J.E. Darnell Jr. STATs: Transcriptional Control and Biological Impact. Nature Reviews (2002). 3: Zeng, Hui, C. Goldsmith, P. Thawatsupha, M. Chittaganpitch, S. Waicharoen, S. Zaki, T. M. Tumpey, and J. M. Katz.. Highly pathogenic avian influenza H5N1 viruses elicit an attenuated Type I interferon response in polarized human bronchial epithelial cells. Journal of Virology (2007). T581: Chan, MCW, CY Cheung, WH Chui, SW Tsao, JM Nicholls, YO Chan, RWY Chan, HT Long, LLM Poon, Y Guan and JSM Peiris. Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells. Respiratory Research (2005), 6:135 5 Hsieh YC, TZ Wu, DP Liu, PL Shao, LY Chang, CY Lu, CY Lee, FY Huang, LM Huang. Influenza pandemics: past, present and future. J Formos Med Assoc. (2006). 105(1): Liu, Bin, J.Y. Liao, X.P. Rao, S.A. Kushner, C.D. Chung, D.D. Chang, and K. Shuai. Inhibition of Stat1-mediated gene activation by PIAS1. Proc. Natl. Acad. Sci. USA. (1998) 95: Chin, Jason W., A. B. Martin, D. S. King, L. Wang, and P. G. Schultz. Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli. PNAS (2002). 99(17):