Homogeneous noncompetitive luminescent immunodetection of small molecules by ternary protein fragment complementation

Transcription

1 Supporting Information for Homogeneous noncompetitive luminescent immunodetection of small molecules by ternary protein fragment complementation Yuki Ohmuro-Matsuyama and Hiroshi Ueda * Laboratory for Chemistry and Life Science, Institute of Innovative Research, Tokyo Institute of Technology, Yokohama, Kanagawa -85, Japan. *Phone/Fax: ueda@res.titech.ac.jp Table of Contents SI Materials and Methods S- SI References S- Table S-. Oligonucleotide primers used in this study. S-5 Figure S-. Scheme and purity of the probe constructs. S- Figure S-. Optimization of protein concentrations. S-7 Figure S-. Confirmation of antigen-binding S-8 Figure S-. Reconstitution using LcBiT and SmBiT peptides. S-8 Figure S-5. Higher signal obtained with V L -SmBiT variants. S-9 Figure S-. Reconstitution using SmBiT8 peptide. S-9 Figure S-7. Luminescence time course. S- S-

2 SI Materials & Methods Materials TALON metal affinity resin and KOD FX neo were from Takara Bio (Otsu, Japan). Ligation High ver. was from Toyobo (Osaka, Japan). Tween, petb and, 5,5 -tetramethylbenzidine were form Merck (Darmstadt, Germany). HRP-conjugated anti-his antibody was form Roche Diagnostics (Basel, Switzerland). Immunoblock was from DS Pharma (Osaka, Japan). The full length cdnas for Nanoluc and LgBiT, furimazine substrate and PureYield plasmid miniprep kit were from Promega (Madison, WI, USA). Synthesized peptides including BGP-C7 (NH -RRFYGPV-COOH), BGP-CdV (NH -EAYRRFYGP-COOH), biotinylated BGP-C (biotin-qeayrrfygpv-cooh), LcBiT, SmBiT, and SmBiT8 were from Lifetein (Somerset, NJ, USA). The synthesized gene for MidBiT, and PCR primers including those for constructing SmBiT, SmBiT8, SmBiT99, and SmBiT were from Eurofins Genomics (Tokyo, Japan). Restriction enzymes and Escherichia coli (E. coli) SHuffle T7 Express lysy were from New England Biolabs (Ipswich, MA, USA). Other reagents, purchased in the highest grade available, were from Wako Pure Chemical Industries (Osaka, Japan). Construction of plasmids LgBiT was amplified by PCR using the primers NotILgBiTBack and XhoILgBiTFor, and digested with NotI and XhoI, and inserted between the same restriction sites in petb vector to yield pet-lgbit. The V H gene of the affinity-matured anti-bone gla protein (BGP) antibody was amplified by PCR using the primers NcoIRAback and NotIRAfor, digested with NcoI and NotI, and inserted between the same restriction sites in pet-lgbit to give pet-v H -LgBiT. V L gene of anti-bgp was amplified by PCR using the primers NcoIV L back and NotIV L for, digested with NcoI and NotI, and inserted between the same sites in pet-lgbit to give pet-v L -LgBiT. A primer dimer was generated using the primers EagIGSback and NotIGSfor, digested with EagI, and inserted to the unique NotI site of pet-v H -LgBiT and pet-v L -LgBiT to give pet-v H -G S-LgBiT and pet-v L -G S-LgBiT, respectively. Similarly, a primer dimer was generated using the primers EagISmBiTback and XhoISmBiTfor, digested with EagI and XhoI, and inserted S-

3 between the NotI XhoI sites of pet-v H -G S-LgBiT and pet-v L -G S-LgBiT to yield pet-v H -G S-SmBiT and pet-v L -G S-SmBiT, respectively. To make pet-v H -G S-LcBiT, the primers EagILcBiTback and XhoILcBiTfor were used to make a primer dimer, digested with EagI and XhoI, and inserted between the NotI and XhoI sites to replace LgBiT of pet-v H -G S-LgBiT. Similarly, primer dimers were generated using the primers EagISmBiT8back and XhoISmBiT8for, EagISmBiTback and XhoISmBiT99for, and NotISmBiTback and XhoISmBiTfor, digested with EagI and XhoI, and inserted between the NotI XhoI sites of pet-v H -G S-LgBiT to yield pet-v H -G S-SmBiT8, pet-v H -G S-SmBiT99 and pet-v H -G S-SmBiT, respectively. A synthetic gene for E. coli codon-optimized LnBiT appended with NotI and XhoI sites at its 5 and ends, respectively, was digested with NotI and XhoI, and inserted to the same sites in petb to give pet-lnbit. The Nluc gene in pnl. was amplified by PCR using the primers NcoINlucBack and XhoINlucFor, digested with NcoI and XhoI, and inserted to the same sites in petb to give pet-nluc. Protein purification The proteins were expressed in E. coli SHuffle T7 Express lysy and purified using TALON metal affinity resin as described previously. ELISA Streptavidin type II ( µg/ml in µl PBS: mm phosphate, 7 mm NaCl,.7 mm KCl, ph 7.) (Wako, Osaka, Japan) was immobilized in transparent microplate (Greiner 55, Tokyo, Japan) wells at C overnight. The wells were blocked with % Immunoblock. After trice washes with PBST (PBS containing.% Tween), biotinylated BGP-C peptide ( µg/ml in µl PBS) was added and incubated for h at room temperature. After trice washes with PBST, samples were applied and incubated for h at room temperature. After washes with PBST, 5,-fold diluted horseradish peroxidase (HRP)-conjugated anti-his antibody was applied and incubated for min at room temperature. After washed with PBST, HRP activity was detected using µg/ml, 5,5 -tetramethylbenzidine and.% H O in mm sodium acetate, ph.. S-

4 Luminescence measurement The mixture of probes and sample (5 µl) in -fold concentration was incubated for 5 min at room temperature in a well of a 9-well half area white plate (9, Coning-Costar, NY, USA). In Figures -, S-S5, the probes and antigen sample were mixed in % Immunoblock/PBST, while in Figure, they were mixed in 5% Immunoblock/PBST. Then the wells were added with ~-fold diluted furimazine substrate (Nano-Glo, Promega) in 5 µl PBS, and the luminescent intensities measured using Luminescencer-JNR (ATTO, Tokyo, Japan). The signals were stable up to min. The photograph in Figure was taken using a digital camera (PowerShot G, Canon, Tokyo, Japan) in a dark room. The data obtained was analyzed using a Kaleida Graph (Synergy Software, Reading, PA). The dose-response curves were fitted to a four parameters equation as follows, where c is taken as EC 5 : The limit of detection was obtained as the minimum antigen concentration that shows the mean blank value plus times the standard deviation. SI References () Iwai, H.; Ozturk, B.; Ihara, M.; Ueda, H. Protein Eng. Des. Sel.,, () Ohmuro-Matsuyama, Y.; Chung, C. I.; Ueda, H. BMC Biotechnol.,,. S-

5 Table S-. Oligonucleotide primers used in this study. Primer name Primer sequence (5 ) NotILgBiTBack GGCGCGCCGCGGCCGCCGTCTTCACACTCAAG XhoILgBiTFor GGCGCGCCTCGAGGCTGTTGATGGTTACTCG NcoIRAback GAATTCCATGGCT GAGGTACAGCTGGAGGAGTC NotIRAfor GAATTCTGCGGCCGC TGAGGAGACGGTGACCG NcoIVLback GAATCCATGGCTGATATTGTGCTGACCCA NotIVLfor GAATTCTGCGGCCGCCCGTTTTATTTCCAGC EagIGSback ATCTGCGGCCGAGCCGGTGGCGGAGGCTCA NotIGSfor ATCTGCGGCCGCTGAGCCTCCGCCACC EagILcBiTback GACAAGCTTGCGGCCGGTGGTGGCGGGAGCGGCTC CATGCTGTTCCGAGTAACC XhoILcBiTfor GGTGGTGGTGCTCGAGGCTCCCGCCACCACCGCTGT TGATGGTTACTCGGAACAGC EagISmBiT8back GACAAGCTTGCGGCCGGTGGTGGCGGGAGCGTGTC CGGCTGGCGGCTGTTCAAGA XhoISmBiT8for GGTGGTGGTGCTCGAGGCTCCCGCCACCACCACTAA TCTTCTTGAACAGCCGCCAG EagISmBiTback GACAAGCTTGCGGCCGGTGGTGGCGGGAGCGTGACCGGCT ACCGGCTGTTCGAGA XhoISmBiT99for GGTGGTGGTGCTCGAGGCTCCCGCCACCACCACTAATCTTC TCGAACAGCCGGTAG XhoISmBiTfor GGTGGTGGTGCTCGAGGCTCCCGCCACCACCACTTTCCTTC TCGAACAGCCGGTAG NcoINlucBack ACGACAAGGCCATGGTGGTCTTCACACTCGAAGAT XhoINlucFor GTGGTGGTGCTCGAGCGCCAGAATGCGTTCGCA S-5

6 a Trx-His V H LgBiT(-58)-His Trx-His V L LgBiT(-58)-His Trx-His V H SmBiT(59-9)-His Trx-His V L SmBiT(59-9)-His Trx-His V H LcBiT(8-58)-His Trx-His LnBiT(-7)-His Trx-His V L SmBiT8-His Trx-His Nluc(-9)-His b Trx-V H -LgBiT Trx-V L -SmBiT Trx-V H -SmBiT Trx-LnBiT Trx-V H -LcBiT Trx-V L -SmBiT Trx-Nluc Figure S. Summary of the probe constructs used in this study. (a) Scheme and (b) purified proteins analyzed by SDS-PAGE and Coomassie Brilliant Blue staining. The numbers in the parenthesis indicate corresponding residue numbers to those of the wild-type Nluc. S-

7 a RLU ( s - ) 8 S/B ratio: 9. RLU ( s - ) S/B ratio: nm.5 nm b RLU ( s - ) RLU ( 5 s - ) nm S/B ratio: 7. 5 nm RLU ( s - ) S/B ratio:.5 5 nm S/B ratio: 8. S/B ratio: 9..5 S/B ratio: RLU ( s - ) 5 nm RLU ( s - ) 5 nm RLU ( s - ) S/B ratio:.8 S/B ratio: 5. S/B ratio: RLU ( s - ) 5 nm 7 nm 8 nm RLU ( s - ) Figure S. Optimization of probe concentrations. (a) LnBiT, V H -LcBiT and V L -SmBiT at the same concentration as indicated or (b) LnBiT at the indicated concentration together with 5 nm each of V H -LcBiT and V L -SmBiT were mixed in the presence or absence of.5 µm BGP-C7 in PBST, and measured for the luminescent activity. Error bar, s.d. (n=). S-7

8 .5 A5 A Antigen V H V L Figure S. Confirmation of antigen binding activity. Binding of SmBiT-fused V L and/or LcBiT-fused V H to immobilized antigen was detected by ELISA. Error bar, s.d. (n=). a SmBiT b 7 RLU (s - ) 5 LnBiT Reconstituted Nluc LcBiT SmBiT & LcBiT (nm) Figure S. Reconstitution of Nluc activity using LnBiT in the presence of LcBiT and SmBiT peptides. (a) Schematic representation. (b) SmBiT- and LcBiT-dependent luminescent activity of LnBiT (5 nm). Error bar, s.d. (n=). S-8

9 a b c d RLU ( s - ) 8 Cdv C7 RLU ( s - ) 5 Cdv C7 RLU ( 5 s - ) Cdv C7 SmBiT8 SmBiT SmBiT99 SmBiT8 SmBiT SmBiT99 SmBiT SmBiT WT (original) (K d :.7-9 M) (K d :.8-7 M) (K d :.5 - M) (K d :.9 - M) RLU ( s - ) 5 Cdv C7 Figure S5. Higher antigen-dependent signal obtained with V L -tethered higher affinity SmBiT variants. BGP-C7 antigen and irrelevant BGP-CdV peptide were detected using 5 nm Trx-LnBiT, 5 nm Trx-V H -LcBiT and one of Trx-V L -SmBiT variants at 5 nm. K d values of each SmBiT variant against LgBiT are shown below. Error bar, s.d. (n=).. RLU ( 7 s - ).5..5 SmBiT8 (nm) Figure S. Reconstitution of Nluc activity with varied concentration of SmBiT8 peptide in the presence of 5 nm LnBiT and 5 nm V H -LcBiT. S-9

10 a RLU ( 7 s - ) Time (min) nm. nm nm nm nm nm b Bound (%) Time (s) nm nm µm Figure S7. Luminescence kinetics. (a) Luminescence time course measured with 5 nm each of Trx-LnBiT, Trx-V H -LcBiT and Trx-V L -SmBiT8 in the presence of BGP-C7 as indicated. Error bar, s.d. (n=) (b) Antigen binding time course of this antibody (V H + V L ) at indicated concentrations, based on previously measured k on / k off values. Simulated by BIAevaluation. software (Biacore AB, Uppsala, Sweden). S-