character design & illustration: ryuji nouguchi Special Edition

Transcription

1 character design & illustration: ryuji nouguchi Special Edition

2 Hmm... my sirna experiment worked, and now I want to know more about this gene. Can I completely knock out its expression in cells? Hello I'm CRISPR! Leave it to me! Let me know the target sequence of your gene. I will head there to knock it out. If you use genome editing tools, you can easily knock-out your target gene or knock-in any DNA sequence in cells or any organism of interest. 02

3 What is CRISPR? Officially known as the CRISPR-Cas9 system. It comprises of a guide RNA (grna) and Cas9 nuclease. grna plays an important role as the vehicle that navigates Cas9 nuclease to the target site, while Cas9 acts as the "scissors" that cleave the specific part of the genome. G U A C G G C G C U A A A G C G A C G A U U U U U G U A G G U C G C A A A A A G UG A A U A U AA A U G U A U U A G U A G G C A U U UC G G U A UG C A U A UG A A U A A G G C U A G UC C G A UC A C U grna U U A CGTAAAGCCATACGTATACTACC GCATT TCGGTATGCATATGANGG Target sequence PAM Cas9 What is the mechanism of genome editing? When genomic DNA is cleaved, a double strand break occurs which in turn activates the cell's repair mechanism. There are two main repair mechanisms namely, non-homologous end joining (NHEJ) or homology directed repair (HDR). In the absence of a template, NHEJ mediates the direct religation of the broken DNA molecule and in most cases, this gives rise to insertion/deletion (indels). Indels disrupt the coding sequence of a gene by causing a "frame shift" which may then lead to a gene knockout. In the presence of a homologue DNA template, accurate repair of the DNA double-stranded breaks takes place via the exchange of DNA strands of similar or identical nucleotide sequence. This allows for error-free repair of the double-strand DNA breaks and also targeted gene replacement or modification (knock-in). Genomic DNA incision Knock-out NHEJ (Non-Homologous End Joining) Disruption of the ORF due to frame shift HR (Homologous Recombination) donor DNA Knock-in I want to try! Genome editing by CRISPR-Cas9 needs both Cas9 nuclease (scissors) & grna (vehicle). To introduce these tools into cells, there is 3 major ways (see below figure). 1. DNA : Transfect all-in-one expression vector system with a Cas9 nuclease & grna expression cassette 2. mrna : Co-transfect Cas9 mrna with in vitro transcribed guide RNA (IVT grna) or a synthetic grna expression cassette 3. Protein : Transfect ribonucleoprotein (RNP) complex which comprises of Cas9 protein and IVT grna Among these different Cas9 formats, "Cas9 protein" is the most convenient and efficient approach. Let's find out why in the next page! DNA 1. All-in-one vector DNA DNA Transcription Nucleus Nuclear localization Cas9 Cas9 Target cleavage Cas9 nuclease and grna complex Cas9 Protein 3. Ribonucleoprotein (RNP) complex : Cas9 protein & IVT grna Cas9 mrna IVT grna Translation Cas9 Introducing CRISPR-Cas9 into cells mrna 2. Cas9 mrna with IVT grna 03

4 Hey, I'm CRISPR! Just send me into the cell in protein form! My boss is pushing me hard to try genome editing in ips cells. But, I'm not sure if I will succeed, as I know that the transfection efficiency of ipsc is quite low... As soon as a transient pore is formed by the electrical pulse, I can enter the cell! I am faster and have higher efficiency than plasmid DNA and Cas9 mrna for the hard-totransfect cells. For the hard-to-transfect cells, it is highly recommended to transfect the cells with Cas9 nuclease in protein form! 04

5 Why are DNA cutting scissors (Cas9 nuclease) delivered in a protein form? The efficiency of genome editing is dramatically increased when the CRISPR components are delivered as Cas9 RNP complex. Cas9 RNPs consist of purified Cas9 protein in complex grna which are assembled in vitro and delivered directly to cells via electroporation or transfection techniques. In comparison to Cas9 plasmid and mrna which relies on cellular transcription/ translation processes to generate functional CRISPR system, the Cas9 RNPs can execute its function immediately upon delivery into the cells (bypassing trasncription/translation) hence giving the highest editing efficiency. Moreover, rapid clearance of Cas9 RNPs from the cell via protein degradation pathway increases target specificity by reducing the amount of time that Cas9 is available in the cell for off-target cleavage. Invitrogen GeneArt Platinum Cas9 Nuclease has nuclear localization signal, with >99% purity and low endotoxin level that can help to achieve cleavage efficiencies of up to 94% in many cell lines (See P12). How to prepare the guide RNA (grna)? The guide RNA (grna) plays an important role in guiding the Cas9 nuclease correctly to the target site. Invitrogen TrueGuide grna are full length, predesigned, ready-to-transfect grnas that are created using our CRISPR design tool and selected for maximum editing efficiency without compromising specificity (see P10). They provide fast, effective knockout of human target genes when they are co-transfected with Invitrogen GeneArt Platinum Cas9 Nuclease, GeneArt CRISPR mrna, or if they are transfected directly into the cells that stably express Cas9 nuclease.for any other customized grnas, the Invitrogen GeneArt Precision grna Synthesis Kit is recommended. Starting with two short single-stranded oligos that code for the target sequence, the grna template can be synthesized in as little as four hours (please see P11 for more details). Step 1: Design grna Choose a target sequence nucleotides in length that is adjacent to an NGG proto-spacer adjacent motif (PAM) on the 3' end of the target sequence. Both sense and anti-sense strand can be targeted. In the example below, PAMs are depicted as red boxes and 5 potential targets as blue lines. 3 PAM sequence CTCTAGCCAG AGTCTTGCAT TTCTCAGTCC GAGATCGGTC TCAGAACGTA AAGAGTCAGG 4 TAAACAGGGT AATGGACTGG CA...-3 ATTTGTCCCA TTACCTGACC GT Step 2: Prepare grna DNA template The grna DNA template sequence is composed of the T7 promoter sequence, the target specific sequence, and the constant region of the crrna/tracrrna (P11). PCR is used for assemble of each DNA fragments to compose grna DNA template. Step 3: In vitro transcription & purification A single strand grna is generated by in vitro transcription reaction using T7 polymerase in the kit. After the IVT grna is generated, it is then purified into transfection-grade grna using the included Clean-Up kit. RNA DNA in vitro transcription grna T7 Promoter T7 RNA polymerase Target-specific crrna TracrRNA Target-specific cr RNA TracrRNA Coding grna Target genome DNA sequence PAM Structure of grna DNA template grna structure and how to bind to target DNA site 05

6 Don't waste your time to confirm the cleavage, just proceed to the assay as soon as possible. Otherwise, the other groups will overtake us! There are too many samples to confirm cleavage by sequencing. I wish there is a simpler way to confirm cleavage. Yes there is indeed! With the cleavage detection kit, targeted DNA region is first amplifed by PCR using primers flanking the region. The PCR product is then denatured and re-annealed to produce heteroduplex mismatches where double strand breaks have occurred, resulting in indel introduction. These mismatches are recognized and cleaved by the detection enzyme. The DNA cleaved by the enzyme can easily be confirmed using the electrophoresis method. 06

7 What is Mismatch Detection Enzyme? Mismatch Detection Enzyme is an enzyme that recognizes and cleaves a mismatch of heteroduplex. In genome editing, as soon as the double-stranded DNA is cleaved by CRISPR/Cas9 or TALEN, insertion/deletion (indel) will occur to repair the cleavage. Therefore, after the cell samples have been lysed and amplified by PCR using a pair of primers that flank the target region. The PCR product will be denatured and re-annealed, mismatch of heteroduplex is created at the site of the indel. The mismatches are subsequently detected and cleaved by a Mismatch Detection Enzyme and the resultant bands are analyzed by gel electrophoresis. Invitrogen GeneArt Genomic Cleavage Detection Kit is a reliable and convenient kit for the evaluation of cleavage efficiency with no purification step of genome DNA & positive controls required. START! The site of genomic insertions or deletions (indels) Mismatches (1) indel (-) (2) indel (+) (1) (2) PCR amplification of loci where the gene-specific double-strand breaks occur Denatured and re-annealed Detected and cleaved by Detection Enzyme Gel electrophoresis How to design PCR primer for the assay? Genomic DNA cleavage assay using mismatch detection enzyme needs a pair of PCR primers. A pair of primers should be designed to ensure that the PCR product is approximately 400 bp to 500 bp in length, encompassing the region of the break in the double stranded genome DNA, which is targeted by CRISPR-Cas9. It is important to make sure that the position of the break is not in the middle of the double stranded DNA, but at either the left or right side of the PCR amplification product, so that two bands of different length can be detected by the electrophoresis. The specificity of the PCR amplification product can be verified by conducting a homology search using the primer- Tm>55 C Primer length: bp Genome Fw primer GC contents: 45%~60% PCR Amplicon: 400 bp~500 bp loci where the gene-specific double-strand breaks occur Rv primer blast tool. For all human and mouse genes, PCR primes for cleavage assay can be designed and order in CRISPR Search & Design tool ( Don't need to do DNA sequencing in addition to cleavage detection assay? At the last step of genome editing workflow, DNA sequencing is definitely needed to check if the target site is correctly edited after single cell cloning. Screening cells to look for successful edits followed by single cell expansion is a time-consuming and laborious task. In order to reduce the amount of time spent on screening cells with successful edits, high editing efficiency is of utmost importance. Selecting the best grna designed for the DNA target site as well as using the correct transfection method are the first few steps to achieve the highest editing efficiency. GeneArt Genomic Cleavage Detection Kit provides a simple, reliable and rapid method for the detection of locus-specific double-strand break formation. 07

8 Genome editing sounds pretty easy! B u t I h e a rd f ro m s o m e o n e t h a t TALENs is also a kind of genome editing tool. What is the difference between CRISPR and TALENs? We, TALENs are here! Unlike CRISPR, we TALENs use proteins as guide molecules. Additionally, when we cut genomic DNA, we work as a team! The latest TAL effector enables us to target ANY desired sequence within the genome. Thus it can work as a pinch hitter of CRISPR sometime and also be used to perform more interesting functional experiments. Go to the next page! 08

9 What are TALENs? Officially known as TAL Effector Nucleases, it comprises of the FokI nuclease that acts as scissors to cleave DNA and TAL Effector Proteins that bind to the target sequence of the genome. Unlike CRISPR, this system uses a pair of Forward and Reverse TALENs to identify the location of interest in the genome. As such, it cleaves the double-stranded DNA with high specificity. Zoom-in! Structure of the TAL Effector Protein Nuclear Localization Signal Transcriptional Activation Domain (for plants) Repeat domain NLS AD NUCLEASE N-terminal C-terminal L T P E Q V V A I A S H D G G K Q A L W T V Q R L L P V L C Q A H G Two amino acids to determine each base for binding There is a central repeat domain in the middle of the 120kD protein in which each repeat is made up of 34 amino acids. The DNA base to be bound is determined by the combination of the 12th and 13th amino acids. I want to try! The mechanism of editing the cleaved genome is the same as that of CRISPR (Please refer to P3). Invitrogen GeneArt PerfectMatch TALs are highly recommended. TAL effector nucleases with a new design that removes the 5' base constraint and therefore can be designed to target any desired sequence within the genome. For example when there is a need to do SNP genome editing but PAM sequence is not found nearby target site, then PerfectMatch TALs work as a pinch hitter of CRISPR. We also offer Invitrogen GeneArt Precision TALs for site-specific delivery of activators, repressors, chromatin modifiers, genomic labels, and cross-linking molecules. You can choose other functional molecules fused to TAL effector! In addition, the expression of the target gene can be modulated, as the TAL effector can be fused with either transcriptional activator (VP16,64) or transcriptional repressor (KRAB), instead of FokI nuclease. You can also fuse other functional molecules to the TAL effector at any preferable location by using a vector containing a multiple cloning site (MCS) at the back of the TAL. For example, you can try out various experiments with histone acetylation enzymes or DNA methylases targeted to your preferred location in the genome. FokI attl2 Kanamycin Incision TAL Effector Activator VP16, VP64 Activation TAL FokI Entry Vector puc ori TAL Effector PROMOTER 18 repeatrvd attl1 Repressor KRAB PROMOTER Inactivation TAL N-term V5 An example of a GeneArt PerfectMatch TALs vector We provide it as a Gateway entry clone, so you can use it immediately after it is transferred into an expression vector driven by any promoter. Various functions Truncated TAL FokI(Fw & Rv paired) 2 Native TAL VP64 Activator Truncated TAL Multi Cloning Site Native TAL FokI(Fw & Rv paired) 3 Native TAL Multi Cloning Site Modified KRAB Repressor Native TAL VP16 Activator The entire target site recognition sequence length 1 is either 18bp or 24bp. Turnaround time is 4 weeks without exception. 1 Sequence recognition length except "T" from 5' end. You can choose either 18bp or 24bp. 2 Truncated Type is recommended for animal cell experiments. 3 Native Type is recommended for non-animal cell experiments such as plant. 09

10 I want to start the genome editing experiment right away! Which designing tool for grna is recommended? I would definitely recommend TrueGuide grna for knock-out human gene, and the CRISPR Search & Design tool is recommended for mouse and others. You want to try knock-out any human genes, don't you? We have good news for you! TrueGuide grna are full length, predesigned, ready-to-transfect grnas for almost all human genes. In this way, you can focus on creating cell models to drive your research forward instead of spending time creating editing tools. In TrueGuide sgrna selection tool, grna can be searched by gene name, and easily selected and ordered. For the purpose of knock-out mouse genes, CRISPR Search & Design tool is useful. By using this tool for mouse experiments, the ideal sequence for the genome editing of the target gene can be found in no time by searching through the database of more than 600,000 pre-designed grna. Since the information regarding the off-target risk is displayed for each of the multiple candidate grna, along with its ranking, it is easy to know which grna would be more suitable for your experiment. In addition, once the grna is chosen, custom oligo DNAs which are needed for Precision grna synthesis kit can be ordered online by just clicking the order button on the screen. To log in the tool, Thermo Fisher Cloud account is needed! If you are targeting genes from other organisms or performing specific knock-in then the grna has to be designed manually (please refer to Step 1 in P5). After the grna is designed, it is then necessary to blast the grna sequence against the target genome to look for potential off-target effects. For further details on how to design grna manually, please go to the next page otherwise you may also consider our genome editing custom service which provides you one-stop solution from design to synthesis. Objective Target organism Recommended site Human Invitrogen TrueGuide grna Knock-out Mouse Other organism CRISPR Search & Design tool After search & order a custom oligo DNA through above site, IVT grna is prepared by Precision grna Synthesis Kit. Please refer the next page or contact us at GEMServices@thermofisher.com Knock-in Human, Mouse & Others Please refer the next page or contact us at GEMServices@thermofisher.com 10

11 What do I need to prepare for designing & building grna by myself? All you need is Precision grna Synthesis Kit and 2 pair of custom DNA oligos for a piece of target specific grna CTCTAGCCAG AGTCTTGCAT TTCTCAGTCC TAAACAGGGT AATGGACTGG CA GAGATCGGTC TCAGAACGTA AAGAGTCAGG ATTTGTCCCA TTACCTGACC GT nt target PAM 1: TGCATTTCTCAGTCCTAAAC AGGG 2: GCATTTCTCAGTCCTAAACA GGGG 3: TCCTAAACAGGGTAATGGAC TGGG 4: GACTGAGAAATGCAAGACTC TGGG 5: GCCAGTCCATTACCCTGTTT AGGG cut site The grna has two molecular components: a targetspecific CRISPR RNA (crrna, 20 bases) and a transactivating crrna (tracrrna, 80 bases) that have been combined into one transcript. This full length transcript is always needed to prepare for each target. The GeneArt Precision grna Synthesis Kit is a complete system for rapid synthesis of guide RNA (grna). Once you have identified the final target sequences, you need to design the forward and reverse oligonucleotides that will be PCR assembled with the Tracr Fragment + T7 Primer Mix included in the kit to generate your grna DNA template. Two 34- to 38-bp oligonucleotides are needed to assemble the synthetic grna template: a Target F1 forward primer harboring the T7 promoter sequence and a Target R1 reverse primer that overlaps with the Target F1 primer and the 5 end of the crrna/tracrrna constant sequence as shown in the figure below. Please note that Target R1 primer is complementary to the target DNA. During the PCR assembly of the grna DNA template, the forward and reverse overlapping oligonucleotides that contain the target DNA sequence (i.e., CRISPR sequence) and the Tracr Fragment + T7 Primer Mix are annealed to their complements, and act both as a primer and a template in the PCR to generate the full length grna DNA template. Next, the assembled DNA template containing the T7 promoter and the grna sequence undergo in vitro transcription (IVT) reaction to generate grna using the TranscriptAid Enzyme Mix included in the kit. Lastly, purify the grna using the grna Clean Up Kit (Box 2 of the GeneArt Precision grna Synthesis Kit) to generate transfection-ready grna. These common 3 DNA fragments are attached in the kit T7 promoter Target (20 nt) crrna/tracrrna constant region (80 nt) 5 TAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA...GTCGGTGCTTTT 3 Universal forward primer 18 nt nt Target F1 primer nt 15 nt (34 38 nt) Target R1 primer (34 38 nt) These 2 DNA fragments are needed to be prepared by target 80-bp crrna/tracrrna fragment Universal reverse primer grna DNA Tracr Fragment Primers for template + grna template sequence T7 Primer Mix assembly Target F1: TAATACGACTCACTATAG + first nt of the target sequence Target R1: TTCTAGCTCTAAAAC + first nt of the target sequence reverse complement 11

12 Oh no! The cleavage efficiency is too low! What should I do next? The first thing you can do is to try to use several different grna. To select for the grna with the highest cleavage efficiency, each grna should be individually complexed with Cas9 nuclease protein and delivered into cells for comparison. Gene: CHKA mrna: NM_ Total No. Exons: 12 Targeted Exons: 2(1.2) The table below shows a comparison of genome editing efficiency in a variety of cell lines using Cas9 nuclease protein delivered via two different methods: lipid-based transfection and electroporation.for cells that are easier to transfect, the lipid-based transfection reagent CRISPRMAX is able to give up to 75% indels. On the other hand, suspension cells, especially hematopoietic cells, which are difficult to transfect by such conventional lipid reagents require the electroporation approach for optimal editing efficiency. Since the optimal condition for electroporation varies depending on the type of cell, it is worth checking out the paper we presented below* 1 and the database of transfection condition for each cell* 2. If your target cell is nondividing cell, you may wish to use our secret weapon - lentivirus CRISPR/Cas9. Cell line Source Lipofectamine CRISPRMAX (% Indel) Neon electroporation (% Indel) 1 mesc Mouse embryonic stem cell 75 ± 3 74 ± 4 2 N2A Mouse liver carcinoma 70 ± 5 81 ± 2 3 3T3 Mouse embryonic fibroblast 57 ± 4 50 ± 2 4 CHO Hamster ovary 57 ± 1 5 COS-7 Monkey kidney 44 ± 3 6 A549 Human lung carcinoma 48 ± 3 66 ± FT Human kidney 85 ± 5 88 ± 3 8 HEK293 Human kidney 75 ± 5 9 HCT116 Human colon carcinoma 85 ± 5 10 HEKa Human primary epidermal keratinocytes 14 ± 2 32 ± 2 11 HeLa Human cervical cancer 50 ± 7 12 HepG2 Human liver cancer 30 ± 3 52 ± 3 13 HUVEC Human umbilical vein endothelium 9 ± 3 26 ± 2 14 ipsc Human induced pluripotent stem cell 55 ± 3 85 ± 2 15 MCF-7 Human mammary gland 8 ± 4 22 ± 5 16 MDA-MB-231 Human breast cancer 39 ± 5 17 U2OS Human osteosarcoma 55 ± 4 70 ± 3 18 Jurkat Human T cell leukemia 19 ± 3 94 ± 2 19 K562 Human lymphoblastoid 20 ± 2 91 ± 1 20 THP-1 Human monocytes 12 ± 3 31 ± 3 21 SC-1 Human B lymphoblasts 0 44 ± 2 22 Raji Human B lymphocyte 0 50 ± 5 23 NK-92 Human peripheral blood 0 31 ± 5 *1 Mouse Rosa26, human HPRT1, monkey Nr0b1, and hamster COSMC loci were selected for genome editing. The average and standard deviation from Neon electroporation were calculated based on the top three protocols. Detailed electroporation protocol was described in Table 4s of published journal (Xin Yu et al/biotechnolo Lett. 2016; 38: ) *2 thermofisher.com/neon 12

13 How will I know if gene editing was successful on my target gene? First of all, I recommend you to check efficiency of indels by mismatch recognition enzyme. When the DNA near the target site of genome editing is re-annealed after the amplification of DNA by PCR, a double-stranded mismatched heteroduplex is formed at the position of the insertion or deletion (indel). This mismatch is identified and cleaved by a specific enzyme, and the DNA fragments are confirmed by gel electrophoresis. The GeneArt Genomic Cleavage Detection Kit provides a simple, reliable, and rapid method for the detection of double-strand break formation without the need for DNA extraction and purification. Indel (Where the bases are inserted or deleted) Denaturation & Re-annealing Mismatch Is there a way to know more about the success of knock-in/knock-out? 1 2 Incision activated by Mismatch Recognition Enzymes Electrophoresis 1. Wild type 2. Indel detected Absolutely! Direct sequencing and deep sequencing is the answer. Expand selected colonies and clone the DNA near the target site. You can directly check the presence of indels by sequencing. A next-generation sequencer is best suited for off-target evaluation and changes in genomewide expression patterns. Deep sequencing with the Ion PGM system provided by Thermo Fisher Scientific is recommended. 13

14 Cleavage has been confirmed by mismatch detection enzyme. What is next? Okay, now we can start with cloning of the knock-in/knock-out cells of the target genes. After confirming the grna that can give you the highest cleavage efficiency, you can start preparing the transfected cells using the relevant conditions. When transfected cells have been obtained, dilute the cell samples, and repeat the step of PCR amplification of the target site followed by sequencing. Since it is not practical to isolate a single cell from the beginning, try to cultivate multiple cells, for example, 10 to 20 cells in a 96 well plate (in some types of cultured cells 1 cell in a 96 well plate works), amplify the target site region using PCR, and examine the sequence after cloning into TOPO vector. PCR amplification Fw Sequencing Rv What is the procedure for knock-in experiments? With gene synthesis, you don't have to be afraid of anything when constructing donor plasmid DNA. The length and format of the donor DNA template depends on the length of the edit. For a short DNA modification such as SNP, single-stranded oligo DNA with 40-45bp of homology arms is recommended for optimal homologous recombination. For larger edits, donor DNA plasmid with longer homology arms of approximately bp is required. Our Invitrogen GeneArt Gene Synthesis service offers chemical synthesis, cloning, and sequence verification of virtually any desired genetic sequence providing you the best assistance in the design and synthesis of the donor template. Doublestranded DNA incision 500bp~600bp 500bp~600bp Within 100bp Homologous Recombination L arm gene? R arm 14

15 I want to know when to select CRISPR or TALENs. TAL effector can be fused not only to FokI nuclease but also another functional molecule for epi-genome editing or gene expression testing. Also, especially since GeneArt PerfectMatch TALs allows to target any sequence across genome, it sometimes work for SNP genome editing which has to be designed in restricted sequence. TAL effector can also be designed to function as a transcriptional activator that will increase transcription of a gene near the TAL effector's DNA-binding site, or decrease transcription by fused to KRAB or other multi functional molecule such as acetyltransferase (P9). GeneArt PerfectMatch TALs eliminate the 5' T constraint of GeneArt Precision TALs and also allows the targeting of any sequence across the genome. This is useful in cases like SNP genome editing or site-specific knock-in whereby PAM sequence is not available for CRISPR Cas9 approach. Such challenges can be addressed by designing PerfectMatch TALs within 30-50bp of the target sequence and delivered into cells in mrna form along with the donor template. Recommended transfection method for this case is Invitrogen Lipofectamine MessengerMAX Transfection Reagent. What exactly is off-target? What is the trick to suppress it? Off-target means that genome editing occurs at a different site from the original target. If there is a sequence that is similar to the target sequence, grna may make a mistake and guide the Cas9 nuclease to the wrong place. There is a report showing that it is critical to ensure that 8 to 12 bases adjacent to a PAM sequence have no homology to another region in the genome. Based on the results of our experiment, it has been revealed that off target can be kept low when using Cas9 nuclease protein. off/on target ratio Off-target Indel production DNA RNA Protain DNA RNA Protain OT3-2 OT3-18 Off-target mutation of VEGFA T3 target caused by Cas9 plasmid DNA, mrna or protein transfection. Percentages of on-target mutation as well as OT3-2 and OT3-18 off-target mutations were determined by sequencing. What is a good method for transfect Cas9 nuclease & grna complex? We highly recommend the use of electroporation method to deliver the Cas9 RNP complex (Cas9 protein and IVT grna). With Invitrogen Neon Transfection System, you can adjust the parameters to achieve optimal transfection efficiency. For a gentler and cost-effective approach, we recommend to use the Lipofectamine CRISPRMAX Cas9 Transfection Reagent which is the first optimized lipid nanoparticle transfection reagent for CRISPR-Cas9 protein and IVT grna delivery. 15

16 Welcome! Science Wonderland If you are interested in genome editing technology, or feel like trying some of the genome editing experiments, please check out our genome editing special site now! On this site, you can find a lot of useful information regarding genome editing technology, including a summary of the principle of genome editing technology, actual experimental workflows, and many useful tools. Start here! Step Product name Size Cat.No. IVT grna + Cas9 Nuclease (Protein) (Cas9 RNP) Knock-out for human gene IVT grna TrueGuide grna 4 µg thermofisher.com/trueguidegrna Genome editing tool Cas9 Nuclease (Protein) GeneArt Platinum Cas9 protein 25 µg B25640 Knock-out for mouse gene grna Custom Oligo DNA (34 mer, FW & RV) 50 nmol (desalting) lifetechnologies.com/crisprdesigner Genome editing tool grna Precision grna Synthesis Kit 25 reactions A29377 Cas9 Nuclease (Protein) GeneArt Platinum Cas9 protein 25 µg B25640 Knock-out other organism gene, Knock-in grna Custom Oligo DNA (34 mer, FW & RV) 50 nmol (desalting) Please refer P11 Genome editing tool grna Precision grna Synthesis Kit 25 reactions A29377 Cas9 Nuclease (Protein) GeneArt Platinum Cas9 protein 25 µg B25640 Transfection, Check genomic DNA cleavage efficiency Transfection Check genomic DNA cleavage efficiency (Lipofection) Lipofectamine CRISPRMAX Cas9 Transfection Reagent 25 reactions CMAX00003 (Electroporation) Neon Transfection System 1 instrument MPK5000 GeneArt Genomic Cleavage Detection Kit 20 rxns A24372 lentivirus CRISPR/Cas9, PerfectMatch TALs, custom services For more information contact us at GEMServices@thermofisher.com character design & illustration: ryuji nouguchi art direction & design: masami furuta, yuka uchida (opportune design) For Research Use Only. Not for use in diagnostic procedures Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. IVC044-A1508HS / DOC097