A DNA based method for directed self assembly of cellulose nanocrystals into advanced nanomaterials

Transcription

1 A DNA based method for directed self assembly of cellulose nanocrystals into advanced nanomaterials Anand Mangalam John Simonsen Oregon State University Corvallis, OR A.S. Benight Portland State University Portland, OR

2 Outline Concept Background The experimental results preliminary study Conclusions

3 Application = tissue engineering A need exists for biomedical implants that can match the mechanical properties of the tissue, then dissolve in the body at a predetermined rate to match the body s regeneration of the tissue, e.g. bone, skin

4 concept ssdna + + molecular coupler DNAcoupler graft CNXL ssdna/coupler/cnxl c-ssdna + + Duplex DNA/coupler/CNXL Hybrid nanomaterial

5 SOURCES OF: CELLULOSE NANOCRYSTALS

6 Wood J. Harrington

7 Sugar Beets

8 Cotton

9 Barnacles (tunicin)

10 Bacterial Cellulose

11 CELLULOSE BIOSYNTHESIS R.M. Brown, J. Mat. Sci. Pure Appl. Chem. A33(10):

12 Slide from Wankei Wan, U. W. Ontario, London, ON, Canada

13 CELLULOSE NANOCRYSTAL PRODUCTION Native cellulose - Semi crystalline Polymer (~70% crystalline). Crystalline portion Amorphous portion CONTROLLED ACID HYDROLYSIS

14 TEM image of cellulose nanocrystals

15

16 ~ 7 nm

17 ~150 nm

18 CELLULOSE NANOCRYSTALS Cellulose source Tunicate Algal (Valonia) Bacterial Length 100 nm microns Cross section Aspect ratio nm 5 to > 100 (high) > 1000 nm 10 to 20 nm 50 to > 10 nm (high) 100 nm microns 5-10 x nm Cotton nm 5 nm Wood nm 3 5 nm 2 to > 100 (medium) 20 to 70 (low) 20 to 50 (low) Beck-Candanedo, et. al. Biomacromol. (2005) 6:

19 Surface Area m 2 /g E-glass fibers * ~1 Paper fibers 4 Graphite Fumed silica Fully exfoliated clay ~ 500 Cellulose nanocrystals ** 250 Carbon nanotubes*** ~ 100 -? * ** Winter, W. presentation at ACS meeting, San Diego, March 2005 ***

20 MECHANICAL PROPERTIES Material Tensile strength GPa Modulus GPa cellulose crystal Glass fiber Steel wire Graphite whisker Carbon nanotubes Marks, Cell wall mechanics of tracheids Sturcova, et al. (2005) Biomacromol. 6, Yu, et al Science (2000) 287, 637

21 DNA

22 Branched structures Sticky ends cube Seeman 2003

23 Pinto 2005

24 Pinto 2005

25 Y. Lu et al. / Chemical Physics Letters 419 (2006)

26 Xiaoyang Xu, Nathaniel L. Rosi, Yuhuang Wang, Fengwei Huo, and Chad A. Mirkin* JACS 2006, 128,

27 CNXL-DNA experiment

28 Surface modification of CNXLs CNXLs TEMPO NaBr NaClO C.CNXLs Titration of C.CNXLs indicated the presence of 1.4 mmols of acid/ g CNXLs. Araki et.al, Langmuir, 17: 21-27, 2001

29 AFM of Carboxy-CNXLs CNXLs

30 Oligomers Dodecyl linker: 5'-amino-C12- CAGTCAGATCAGGACATGAGATCAT GCTAGTCAGCTACGGTCACTGCTAGTCCGTAC GTACCATGTCATAGTGTAGGT-3 And compliment GC content = 49% T m = 70 C Purchased from IDT, Inc.

31 Hexamer linker: Oligomers 5 -amino-c6-gct CTA CCT GAC TAG CTC GT-3 and compliment GC content = 55% T m = 56 C Purchased from Oligos, etc.

32 Classic EDC reaction EDC = 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide Hydrochloride Voicu 2004 Araki 2001 Deen 1990

33 Optimization of grafting reaction 50 EDC/CNXL ratio DNA(ug)/g of CNXL act ph4.5 act ph6 act ph Molar ratio of EDC: COOH on CNXL

34 Optimization of grafting reaction 50 DNA/CNXL ratio 40 umole ssdna/g CNXL Low CNXL concentration Molar ratio ssdna/co2h

35 FTIR 1. Carboxy-CNXL, protonated 2. EDC-NHS activated carboxy-cnxl, ph ph 7.5

36 Mix the complimentary strands together ssdna-cnxl Duplex DNA-CNXL Carboxy-CNXL

37 Dynamic light scattering (DLS) Sample chamber laser Signal processing, mathematical modeling done by computer Laser optics Scattered light (90 ) Detector optics Avalanche photodiode detector Spherical shape assumed by software

38 DLS equipment Sample cell Temp controller laser photodiode

39 Dynamic light scattering results Particle Diameter (D h ) at 25 o C CNXL nm Carboxy-CNXL ssdna-cnxl dsdna-cnxl duplex nm nm nm

40 DLS temperature cycling experiment 1200 Effective diameter (nm) Time (min) 80 Exp #1 Exp # Temp ( 0 C)

41 AFM of carboxy-cnxls

42 AFM image ssdna-cnxl

43 AFM image duplex DNA-CNXL

44 AFM image duplex DNA-CNXL

45 AFM image duplex DNA-CNXL

46 Section analysis of particle height

47 Particle height from section analysis 40 % of total count Carboxy CNXL ssdna-cnxl dsdna-cnxl Supports data from DLS Diameter or height (nm)

48 Conclusions CNXLs were successfully carboxylated Carboxy-CNXLs CNXLs were successfully grafted with DNA oligomers The DNA on the grafted CNXLs duplexed and bound the CNXLs together The duplex formation was reversible via raising the temperature above the DNA melting point While the goal of a new tissue engineering material remains distant, we believe we have shown that this concept has potential for use in thermoplastically formable implants with programmable in vivo dissolution and other bio-based based nanomaterials