Animals. Balb/c mice (male) purchased 5 weeks postpartum, were adapted under

Transcription

1 Supplementary Methods Animals. Balb/c mice (male) purchased 5 weeks postpartum, were adapted under standard 12 h light: 12 h dark cycles (LD) for 2 weeks, and then transferred into the constant darkness (DD) conditions. SCN and liver samples were then obtained under DD conditions, every 4 h starting at CT0 over 2 days. We extracted total RNA from the pooled 50 pooled SCNs and 4 pooled livers at each time point. All experiments were carried out under a protocol approved by Administrative Panels on Laboratory Animal Care in Yamanouchi Pharmaceutical Company and Kinki University. Quantitative PCR. Quantitative PCR was performed with the ABI Prism 7700 and SYBR Green Reagents (Applied Biosystems). cdna was synthesized from 0.5 µg of total RNA using Superscript II reverse transcriptase (Invitrogen). Samples contained 1x SYBR Green Master Mix, 0.5 µm primers and 1/40 synthesized cdna in a 25 µl volume. The PCR conditions were as follows: 10 min at 95 ºC, then 40 cycles of 15 s at 94 ºC, 30 s at 60 ºC and 1 min at 72 ºC. Absolute cdna abundance was calculated using the standard curve obtained from murine genomic DNAs. GAPDH expression levels were quantified and used as the internal control. Primer sequences for quantitative PCR are available upon request. Transfection Studies NIH3T3 cells were maintained in DMEM supplemented with 10% FBS (Sigma). The day before transfection, NIH3T3 cells were plated onto 24-well plates at cells/well. The following day, NIH3T3 cells were transfected using LipofectAMINE 2000 reagent (GIBCO) with an internal control prl-tk (2ng, Promega), SV40-dLuc reporter containing wild-type and mutant cis-elements (10ng), in the presence or absence of pci-arntl (100ng), pci-clock (100ng), pci-cry1 (100ng), pcmv-dbp (100ng), pcmv-nfil3 (300ng), pcmv-rora (100ng) and pcmv-nr1d1 (100ng). The 1

2 pci-neo or pcmv-sport6 plasmids were used to adjust the amount of DNA (412ng). At 24h after transfection, transfected cells were harvested and assayed with the Dual-Luciferase Reporter Assay System (Promega). Protein Synthesis and Electrophoretic Mobility Shift Assays (EMSA). The fragment containing N-terminal GST tag and Gateway cassette was digested from pdest15 (Invitrogen) with NdeI and NheI, blunted and inserted into peu3-nii vector (Wakenyaku) at an EcoRV site, which is named as peugw-5 G. mdbp (739bp-978bp from start codon), hnfil3 (193bp-432bp), mnr1d1 (370bp-651bp) and mrora (25bp-300bp) were amplified by PCR and subcloned into pdonr221 vector (Invitrogen), and then inserted into destination vector peugw-5 G using Gateway TM Technology. in vitro transcription/translation of GST-fusion protein from these constructs were performed with the PROTEIOS wheat-germ extract cell-free translation system (Wakenyaku) according to manufacturer s specifications and purified with Glutathione Sepharose 4B (Amersham Bioscience). IRDye800-labeled EMSA were carried out as described previously 7. The complementary IRDye800-labeled oligo (Aloka) and unlabeled oligo (Proligo) were annealed to generated probes representing the E-box, E -box, D-box or RRE elements at the center and 6-base pair adjacent sequences at each side (see also Supplementary Table 3 at the Database for Systems Biology, for the probe sequences). Eight fmole of labeled probe was incubated with ~100ng of purified GST-fusion proteins in 10mM Tris-HCl, ph7.5, 50mM NaCl, 0.5mM EDTA, 2mM MgCl2, 4% Glycerol, 0.5mM DTT, 0.5mg/ml BSA and 0.5µM poly(didc) (Amersham Bioscience), in a final volume of 10µl for 15min at room temperature. 125-fold excess of unlabeled cold DNA probes representing the wild-type or mutant E-box, E -box, D-box or RRE elements at the center and 6-base pair adjacent sequences at each side were used as wild-type and mutant competitors (see also Supplementary Table 3 at the Database for Systems Biology, 2

3 for the probe sequences). After addition of loading buffer (0.015% BPB, 3% Glycerol, 3mM DTT), half of the reaction mixtures were run and scanned on 8% polyacrylamide native gel (79:1) containing 10mM MgCl2 and 2.5% Glycerol in 0.5 x TBE using the modified LI-COR 4000L DNA sequencer 7. Construction of pci-arntl, pci-clock, pci-cry1, pcmv-dbp, pcmv-nfil3, pcmv-rora and pcmv-nr1d1 vectors Construction of Arntl, Clock and Cry1 expression plasmids (pci-arntl, pci-clock and pci-cry1) are described elsewhere 8. pcmv-rora (BC003757) and pcmv-nr1d1 (BC008989) are purchased from Resgen and sequence-verified. We re-cloned mouse Dbp and human Nfil3 ORF into pcmv-sport6 vector since MGC clones containing full-length mdbp or hnfil3 (BC for mdbp and BC for hnfil3, Resgen) lack Kozak sequences and have relatively long 5 untranslated regions (UTRs). First, we amplified mdbp and hnfil3 ORF from these vectors by PCR with a forward primer containing Kozak sequence and SalI (for mdbp) or KpnI (for hnfil3) recognition sequence and a reverse primer containing HindIII recognition sequence. PCR products were digested with SalI (for mdbp) or KpnI (for hnfil3) and HindIII, and re-cloned into pcmv-sport6 vectors and termed as pcmv-dbp and pcmv-nfil3. Primer sequences for Dbp amplification: Dbp-Forward: GATCGATCGTCGACGCCGCCACCATGGCGCGGCCTCTGAGCGACAGGAC Dbp-Reverse: GATCGATCAAGCTTTCACAGTGTCCCATGCTGGGCC Primer sequences for Nfil3 amplification: 3

4 Nfil3-Forward: GATCGATCGGTACCGCCGCCACCATGCAGCTGAGAAAAATGCAGACCG Nfil3-Reverse: GATCGATCAAGCTTTTACCCAGAGTCTGAAGCAGA Construction of dluc and SV40-dLuc vectors Luciferase was amplified using PfuTurbo DNA polymerase (Stratagene) with a forward primer containing a NcoI recognition sequence and a reverse primer containing a EcoRV sequence. The stop codon of Luciferase was deleted to make a continuous sequence with PEST. The proteolytic PEST sequence modified from mouse ornithine decarboxylase was amplified from pd1egfp-n1 (Clontech) using PfuTurbo DNA polymerase (Stratagene) with a forward primer containing an EcoRV recognition sequence and a reverse primer containing an XbaI sequence. dluc and SV40-dLuc vectors were generated by a three-fragment ligation using the first NcoI/XbaI-digested fragment from pgl3-basic or pgl3-promoter expression vector (Promega), the second NcoI/EcoRV-digested fragment from luciferase PCR products, and the third EcoRV/XbaI-digested fragment from PEST PCR products. Primer sequences for PEST amplification: PEST-Forward: TACAAGGATATCAGCCATGG PEST-Reverse: TCGCGGCCTCTAGACTACACATTG Primer sequences for Luc amplification: Luc-Forward: TGGTAAAGCCACCATGGAAG 4

5 Luc-Reverse: CGACTCTAGATATCCACGGCG Construction of mper2-dluc vector A mouse genomic library ( clones) from the Balb/c mouse (Clontech) was screened using a 5 -portion of mper2 cdna as a probe, and several mouse phage clones were isolated. One fragment encoded the 5 upstream region. The positive clones were digested with restriction enzymes EcoT22I and SnaBI, and the 3517bp 5 upstream fragment (chr1: bp-chr1: bp on Mouse Genome Feb Assembly of UCSC Genome Browser: containing mper2 exon1 was inserted into the SmaI/XhoI site of the dluc vector and named mper2-dluc vector. Construction of marntl-dluc vector A mouse genomic library ( clones) from the Balb/c mouse (Clontech) was screened using a 5 -portion of marntl cdna as a probe, and one fragment encoded the 5 upstream region. The positive clones were digested with restriction enzymes BglII and BbeI, and the 4049bp 5 upstream fragment (chr7: bp-chr7: bp on Mouse Genome Feb Assembly of UCSC Genome Browser) containing the transcriptional start site of marntl was inserted into the SmaI site of the dluc vector and named marntl-dluc vector. Construction of mper3-dluc vector The 581 bp 5 upstream fragment (chr4: bp-chr4: bp on Mouse Genome Feb Assembly of UCSC Genome Browser) containing the transcriptional start site of mper3 was amplified by PCR and inserted into the SmaI site of the dluc vector and named mper3-dluc vector. 5

6 Primer sequences for mper3 promoter amplification: mper3-forward: pgcgcgttatgtaaggtactcgg mper3-reverse: pttggtccctgccatcgccttcg Construction of SV40-dLuc vector containing wild-type or mutant cis-elements The sequences containing tandem repeats of the wild-type or mutant cis-elements were inserted into MluI/BglII site of the SV40-dLuc vector (see also Supplementary Table 4 at the Database for Systems Biology, for the inserted sequences). Network Analysis The transcriptional circuits underlying mammalian circadian rhythms was represented as a connectivity matrix, M, such that M = 1 if a transcription factor encoded by gene i activates the transcription of gene j, M = 1 if a transcription factor encoded ij by gene i represses the transcription of gene j, and M = 0 otherwise. We scanned all ij ij n n submatrices of M, generated by choosing n nodes that lie in a connected graph to detect positive and negative feedback loops for n = 1, n = 2 and n = 3, and to detect coherent and incoherent feedforward loops for n = 3. 6

7 Supplementary References 1. Ueda, H.R. et al. A transcription factor response element for gene expression during circadian night. Nature 418, (2002). 2. Balsalobre, A. et al. Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289, (2000). 3. Preitner, N. et al. The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110, (2002). 4. Lee, T.I. et al. Transcriptional regulatory networks in Saccharomyces cerevisiae. Science 298, (2002). 5. Shen-Orr, S.S., Milo, R., Mangan, S. & Alon, U. Network motifs in the transcriptional regulation network of Escherichia coli. Nat Genet 31, 64-8 (2002). 6. Milo, R. et al. Network motifs: simple building blocks of complex networks. Science 298, (2002). 7. Sano, M., Ohyama, A., Takase, K., Yamamoto, M. & Machida, M. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer. Biotechniques 31, , 1060, 1062 (2001). 8. Hida, A. et al. The human and mouse Period1 genes: five well-conserved E-boxes additively contribute to the enhancement of mper1 transcription. Genomics 65, (2000).