WOLBACHIA INFECTION AND CYTOPLASMIC INCOMPATIBILITY IN THE CRICKET TELEOGRYLLUS TAIWANEMMA

Transcription

1 The Journal of Experimental Biology 203, (2000) Printed in Great Britain The Company of Biologists Limited 2000 JEB WOLBACHIA INFECTION AND CYTOPLASMIC INCOMPATIBILITY IN THE CRICKET TELEOGRYLLUS TAIWANEMMA SATORU KAMODA, SHINJI MASUI, HAJIME ISHIKAWA AND TETSUHIKO SASAKI* Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo , Japan *Author for correspondence ( Accepted 25 May; published on WWW 20 July 2000 Wolbachia are cytoplasmically inherited bacteria found in many arthropods. They induce various reproductive alterations in their hosts, including cytoplasmic incompatibility, thelytokous parthenogenesis, feminization and male-killing. In this study, we examined Wolbachia infection and its effects on the host cricket Teleogryllus taiwanemma. In a phylogenetic study based on the wsp gene coding for a Wolbachia surface protein, the Wolbachia strain harboured by T. taiwanemma was clustered together with those harboured by Laodelphax striatellus, Tribolium confusum, Acraea encedon, Trichogramma deion and Adalia bipunctata. Crossing experiments using the Wolbachiainfected and uninfected strains of cricket showed that the infection is associated with the expression of unidirectional cytoplasmic incompatibility: the egg hatch rate in the incompatible cross between the infected males and uninfected females was 20.3 %. We also examined the distribution of Wolbachia within the host using polymerase Summary chain reaction assays; they were detected in the antennae, heads, forewings, hindwings, testes, ovaries, Malpighian tubules, foot muscles and fat bodies. Quantitative polymerase chain reaction assays showed that the bacterial density was highest in the fat bodies, followed by the ovaries and testes. Wolbachia were not detected in the haemolymph or in mature spermatozoa. The spermatozoa of the infected male may be modified by the presence of Wolbachia during its development. To examine this possibility, we compared the profiles of sperm proteins between the infected and uninfected males using twodimensional gel electrophoresis. However, no differences in the protein profiles were observed. Key words: Wolbachia, cricket, Teleogryllus taiwanemma, cytoplasmic incompatibility, bacterial density, two-dimensional gel electrophoresis. Introduction Wolbachia are intracellular bacteria present in a wide range of arthropods, particularly in insects. In a previous field survey by Werren et al. (1995b), Wolbachia were found in more than 16 % of the insects sampled. Phylogenetic analyses of the Wolbachia harboured by various host species have shown that the Wolbachia clade can be divided into two major groups, designated A and B (Werren et al., 1995a). Wolbachia are known to induce various reproductive alterations in their hosts, including cytoplasmic incompatibility, thelytokous parthenogenesis, feminization and male-killing (for reviews, see Werren, 1997; Stouthamer et al., 1999). Cytoplasmic incompatibility is a crossing incompatibility that results in embryonic mortality in diploid species. In haplodiploid species such as wasps, in which haploid embryos develop into males, cytoplasmic incompatibility causes male-biased sex ratios. The effect of cytoplasmic incompatibility on crossability is typically unidirectional: the cross between infected males and uninfected females is incompatible, whereas the reciprocal cross is compatible. In addition, bidirectional incompatibilities are observed when males and females carry different Wolbachia strains. It has been reported that cytoplasmic incompatibility arises from defects in paternal chromatin condensation during mitosis in Drosophila simulans (O Neill and Karr, 1990; Lassy and Karr, 1996; Callaini et al., 1997), Nasonia vitripennis (Reed and Werren, 1995) and Culex pipiens (Jost, 1971). Cytological examinations in several species have revealed that the bacteria in spermatids are released during spermatogenesis and are absent from the mature spermatozoa (Wright and Barr, 1980; Binnington and Hoffmann, 1989; O Neill, 1989). It is assumed that Wolbachia modify the spermatozoa during spermatogenesis and that this modification is responsible for the expression of cytoplasmic incompatibility. However, few investigations have attempted to detect the modification in the spermatozoa of Wolbachiainfected insects, mainly because it is difficult to obtain sperm samples from insects in which cytoplasmic incompatibility has been expressed.

2 2504 S. KAMODA AND OTHERS Males of orthopteran insects release spermatophores containing pure spermatozoa when they mate. Because of this habit, samples of pure spermatozoa can be collected from the males of this insect group. However, despite this advantage, no laboratory strain of an orthopteran insect has been established as an insect model for the study of cytoplasmic incompatibility. Masui et al. (1997) previously reported that a laboratory strain of the cricket Teleogryllus taiwanemma was infected with B-group Wolbachia, although the effect of the infection was unclear. In this study, we further investigated Wolbachia infection in T. taiwanemma. The phylogenetic position of the Wolbachia was estimated on the basis of the wsp gene that codes for a Wolbachia surface protein. To clarify the phenotype induced by the Wolbachia, we performed crossing experiments and demonstrated that cytoplasmic incompatibility is expressed, giving relatively high embryonic mortality. We also examined the presence of Wolbachia in various tissues of the host using the polymerase chain reaction (PCR). In addition, the bacterial density in each tissue was determined by quantitative PCR assays. After we had confirmed that the spermatozoa did not contain Wolbachia, we compared the profiles of sperm proteins between the infected and uninfected males. Materials and methods Insects A strain of the cricket Teleogryllus taiwanemma infected with a B-group Wolbachia strain (wtai) was maintained under 16 h:8 h light:dark cycle at 25 C. The crickets were fed an insect food purchased from Oriental Yeast, Tokyo, Japan, and provided with tap water. To establish a Wolbachia-free strain, the infected insects were given an aqueous solution of tetracycline hydrochloride (0.5 % w/v) for two generations. This strain was reared without tetracycline for at least two generations (approximately 5 months) before being subjected to experiments. DNA extraction The antennae, heads, forewings, hindwings, testes, ovaries, Malpighian tubules, foot muscles and fat bodies were obtained by dissection from adult insects. Haemolymph, which oozed out through the incision when a hindleg was cut, was collected in a small pipette. To obtain pure sperm samples, we cut the end of a spermatophore and immersed it in phosphate-buffered saline (PBS; 137 mmol l 1 NaCl, 8.1 mmol l 1 Na 2 HPO 4, 2.68 mmol l 1 KCl, 1.47 mmol l 1 KH 2 PO 4, ph 7.5). The spermatozoa released into PBS was collected by centrifugation. These samples were homogenized in saline/tris/edta (STE; 100 mmol l 1 NaCl, 10 mmol l 1 Tris ph 8.0, 1 mmol l 1 EDTA, ph 8.0) containing proteinase K at 0.4 mg ml 1. After incubation at 55 C for 90 min, DNA was purified by phenol/chloroform extraction followed by ethanol precipitation. Phylogenetic analysis The wsp gene was amplified from the DNA solution prepared from testis by PCR using the general wsp primers (Braig et al., 1998) wsp81f (5 -TTGTCCAATAAGTGAA- GAAAC-3 ) and wsp691r (5 -AAAAATTAAACGCTACT- CCA-3 ). These primers amplify a DNA fragment of approximately 600 base pairs (bp). The cycling conditions consisted of 5 min at 94 C, followed by 35 cycles of 30 s at 94 C, 30 s at 52 C, and 1 min at 72 C, and a final cycle of 5 min at 72 C. The PCR products were directly ligated into pgem-t vectors (Promega), and five independent clones were sequenced using an ABI PRISM 310 genetic analyzer (PE Applied Biosystems). The wsp sequence has been submitted to the GenBank database under accession number AB This sequence was aligned to the wsp sequences reported by Zhou et al. (1998) and Hurst et al. (1999). A 41 bp region (positions ) corresponding to the third hypervariable region of the gene (Braig et al., 1998) was omitted from the analysis because it could not be aligned with confidence (Zhou et al., 1998). Sites with gaps were also excluded from the aligned data set. The resulting alignment of approximately 500 bases was used to construct a neighbour-joining tree (Saitou and Nei, 1987) with Kimura s two-parameter distance (Kimura, 1980) using the program package Clustal W (Thompson et al., 1994). A bootstrap test (Felsenstein, 1981) was performed with 1000 replications. Detection of Wolbachia The presence of Wolbachia in various tissues of T. taiwanemma was tested by PCR using the primer sets ftszbf (5 -CCGATGCTCAAGCGTTAGAG-3 ) and ftszbr (5 - CCACTTAACTCTTTCGTTTG-3 ), which specifically amplify the ftsz cell cycle gene of B-group Wolbachia (Werren et al., 1995a). The PCR cycling conditions consisted of 5 min at 94 C, followed by 35 cycles of 30 s at 94 C, 30 s at 55 C, and 1 min at 72 C, and a final cycle of 5 min at 72 C. To confirm successful DNA extraction, the samples were also subjected to PCR using primers specific for the insect pgi gene that codes phosphoglucose isomerase (Katz and Harrison, 1997). The primers used were pgif (5 -AACAAGGAGATATGGAATCTAATGG-3 ) and pgir (5 -TTCCAGGTTCACCCCACA-3 ). The cycling conditions were the same as those for the amplification of the ftsz gene. Quantitative PCR To determine the Wolbachia density in each tissue, quantitative PCR was performed in a LightCycler (Roche Diagnostics). A 294 bp fragment of the internal region of the VirD4 gene (GenBank accession number AB041342) was amplified using the primers VirD4F (5 - ATCAGAGAAAGACATACGAAAAGCAGG) and VirD4R (5 -CAATGGCTTACCCCATCTGGC). The 20 µl reaction mixture consisted of 10 % (v/v) LightCycler DNA master SYBR Green I (Roche Diagnostics), 3 mmol l 1 MgCl 2, 0.2 µmol l 1 of each primer, 2 µl of template DNA and 0.16 µl of TaqStart Antibody (Clontech). For the amplification, 50 cycles consisting of 0 s at 95 C, 5 s at 57 C and 30 s at 72 C were performed. The fluorimetric intensity of SYBR Green I, a dye specific for double-stranded DNA, was measured at the end of each elongation phase, and the original concentration of the VirD4

3 Wolbachia infection in cricket 2505 gene in the template DNA solution was determined by analysis of the amplification kinetics. Standard reactions were performed with the template solutions containing VirD4 PCR products at known concentrations. The primer set used amplified the VirD4 gene without production of primer dimers or non-specific background, which was confirmed by a melting-curve analysis as recommended by the manufacturer. On the basis of the observation that the VirD4 gene of wtai is a single copy gene (S. Masui, unpublished data), the number of Wolbachia cells in each sample was calculated from the concentration of the gene. Crossing experiments Crossing experiments were performed using single pairs of virgin individuals. Females and males were separated at the late nymphal stage; they were paired on adult emergence and kept in a cage with a 50 ml tube containing moistened tissue paper. Approximately 1 week after they had been paired, the female laid eggs on the tissue paper. The eggs were washed off the tissue paper and placed onto moistened filter papers in a plastic dish. More than 100 eggs were collected from each pair to count the number of hatched nymphs. After the eggs had been collected, all individuals used in the experiment were diagnosed by the PCR using the ftszb primers to confirm the infection status. The DNA samples were prepared from the testes or ovaries. Electrophoresis of sperm proteins Spermatozoa were dissolved in 240 µl of the lysis buffer [9.8 mol l 1 urea, 0.5 % (v/v) Triton-X, 2 % Ampholine, (ph ), % (w/v) dithiothreitol and a small amount of Orange G], then applied to gels (Immobiline DryStrip, ph 3 10, 11 cm; Amersham Pharmacia Biotech). The gels were rehydrated for 12 h and then subjected to electrophoresis in a Multiphor II electrophoresis unit (Amersham Pharmacia Biotech). Isoelectric focusing was performed at 15 C with voltage limits of 300 V for 1 h, a gradient from 300 V to 3500 V for 3 h, and 3500 V for 17 h. The current limit was 0.5 ma per strip throughout the electrophoresis. In the second dimension, SDS PAGE was performed as described by Laemmli (1970) using slab separation gels of 10 % polyacrylamide. The proteins were visualized by silver staining using twodimensional silver stain II DAIICHI (Daiichi Pure Chemicals). The protein profiles were compared between infected and uninfected males by superimposing the two gels on a light box. Results Phylogenetic relationship To estimate the relative phylogenetic position of Wolbachia infecting T. taiwanemma (wtai), the wsp gene was sequenced and aligned to those previously reported from other host species. The phylogenetic analysis suggested that wtai is closely related to Wolbachia strains infecting the small brown planthopper Laodelphax striatellus (wstri), the flower beetle Tribolium confusum (wcon), the butterfly Acraea encedon (wenc), the wasp Trichogramma deion (wdei) and the ladybird Adalia Table 1. Crossing experiments in Teleogryllus taiwanemma Number Number Number Percentage Cross of of eggs of eggs of eggs male female crosses collected hatched hatched Infected infected ±10.9 Infected uninfected ±18.7* Uninfected infected ±10.4 Uninfected uninfected ±7.1 *Mann-Whitney U-test (compared with all other crosses): P< Values are means ± S.D. bipuntata (wbipa, wbipb). These Wolbachia strains constituted a monophyletic group supported by the bootstrap probability of 98.9 %, although the branches within this clade were not strongly supported except for the branch consisting of wbipa and wbipb (Fig. 1). In terms of sequence divergence, wtai differed by at least 7 % from all other Wolbachia strains. According to the grouping criterion of a 2.5 % sequence difference as proposed by Zhou et al. (1998), wtai represents a new group. Crossing experiments The expression of cytoplasmic incompatibility, a possible reproductive alteration induced by the Wolbachia, was examined by crossing experiments between the infected insects and those from which the Wolbachia had been removed by tetracycline treatment. When uninfected females were mated with infected males, the egg hatch rates were %, with a mean rate of 20.3 % (Table 1). In each of the other three crosses, more than 80 % of the eggs hatched. The egg hatch rate in the crosses between infected males and uninfected females was statistically different from those in the other combinations (Mann Whitney U-test, P<0.001). The duration of embryonic development was approximately 3 weeks at 25 C. In the compatible crosses, the eggs swelled within a few days of oviposition. Most eggs from the incompatible cross did not swell, suggesting that embryonic death had occurred at a relatively early stage of the development. Distribution of Wolbachia To examine the distribution of Wolbachia in T. taiwanemma, DNA was prepared from the antennae, heads, forewings, hindwings, testes, ovaries, Malpighian tubules, foot muscles, fat bodies, haemolymph and spermatozoa. In the PCR assay using ftszb primers, we detected Wolbachia in all samples examined, except in the haemolymph and spermatozoa (Fig. 2A). The success of the DNA extraction was confirmed by PCR using pgi primers (Fig. 2B). We also performed quantitative PCR to determine the densities of Wolbachia in the tissues in which the bacteria had been detected. The total number of bacteria per tissue was highest in the ovaries ( bacteria) and relatively high in the fat bodies, testes and heads. The bacterial density, estimated by normalising the total bacterial number by the wet mass for each tissue, was highest in the fat bodies

4 2506 S. KAMODA AND OTHERS 0.01 wstri (Laodelphax striatellus) 564 Fig. 1. A phylogenetic tree 655 based on wsp sequences. The wsp sequence from wtai was 522 aligned with wsp sequence data of B-group Wolbachia, with 998 A-group wri and wcaua as wcon (Tribolium confusum) wenc (Acraea encedon) wdei (Trichogramma deion) wtai (Teleogryllus taiwanemma) outgroups, and analyzed wbipa (Adalia bipunctata A) B using the neighbour-joining 579 algorithm. Bootstrap values out 1000 wbipb (Adalia bipunctata B) of 1000 replications are indicated above the branches. The scale bar indicates genetic distance in units of nucleotide wcaub (Ephestia cautella) wori (Tagosedes orizicolus) substitutions per site. The righthand vertical lines show A- and 712 walbb (Aedes albopictus) B-groups identified by Werren et al. (1995a) and detailed wnou (Drosophila simulans Noumea) grouping based on the wsp 1000 wpip (Culex pipiens) sequence (Zhou et al., 1998). The GenBank accession numbers for wsp sequences are AF for wri, AF wcaua (Ephestia cautella) wri (Drosophila simulans Riverside) A for wcaua, AF for wcaub, AF for wcon, AF for wdei, AF for wori, AF for wstri, AF for wpip, AF for wnou, AF for walbb, AJ for wenc, AJ for wbipa and AJ for wbipb. Table 2. Infection level of Wolbachia in the tissues of Teleogryllus taiwanemma Total number of Bacterial density 10 3 Tissue bacteria 10 3 (µg 1 tissue) Antenna 135±73 415±168 Head ± ±91 Forewing 218±159 53±30 Hindwing 76±30 27±13 Testis ± ±91 Ovary ± ±584 Malpighian tubules 5 960± ±425 Foot muscle 4 313± ±79 Fat body ± ±2 128 Samples were collected from adult individuals less than 1 week after the final ecdysis. Values are means ± S.D. (N=4). (5105 µg 1 ), followed by the ovaries, testes and Malpighian tubules (Table 2). Analysis of sperm proteins The absence of Wolbachia in the spermatozoa of the infected T. taiwanemma suggested that the Wolbachia modified the spermatozoa to induce cytoplasmic incompatibility during sperm development. For this reason, any difference between the spermatozoa of infected and uninfected males should have been related to the expression of cytoplasmic incompatibility. A a h fw hw t o mt fm fb hl s nc m B Fig. 2. Polymerase chain reaction (PCR) assay using ftszb primers for detection of Wolbachia in various tissues of Teleogryllus taiwanemma (A). Successful DNA extraction was confirmed by PCR with primers for the pgi gene coding for phosphoglucose isomerase (B). Lanes: a, antenna; h, head; fw, forewing; hw, hindwing; t, testis; o, ovary; mt, Malpighian tubules; fm, foot muscle; fb, fat body; hl, haemolymph; s, spermatozoa; nc, negative control; m, 1 kb DNA ladder (GIBCO BRL). In an attempt to find such a difference, we analyzed the profiles of sperm proteins using two-dimensional gel electrophoresis. However, no repeatable difference in protein profile was detected between infected and uninfected individuals (Fig. 3). Discussion Reproductive incompatibilities have been reported in allopatric field populations of Gryllus crickets (Harrison, 1983;

5 Wolbachia infection in cricket 2507 kda A B Fig. 3. Silver-stained two-dimensional gel electrophoresis of proteins from mature spermatozoa of infected (A) and uninfected (B) Teleogryllus taiwanemma. Smith and Cade, 1987; Cade and Tyshenko, 1990). Recently, some of them were found to be infected with Wolbachia (Werren et al., 1995a; Giordano et al., 1997). In the present study with T. taiwanemma, we generated a Wolbachia-free strain from the infected strain to perform crossing experiments, and observed that the cross between the infected males and uninfected females was incompatible, giving an embryonic mortality at 79.7 %. To our knowledge, this is the first clearcut evidence for the association between Wolbachia infection and unidirectional cytoplasmic incompatibility in an orthopteran insect. It is known that the strength of cytoplasmic incompatibility varies depending on the Wolbachia strain and host species. For example, Wolbachia induce almost complete incompatibility in the almond moth Ephestia cautella (Sasaki and Ishikawa, 1999), in Laodelphax stritellus (Noda, 1984) and in the genus Tribolium (Stevens and Wade, 1990), while Drosophila melanogaster shows weak expression of cytoplasmic incompatibility with an embryonic mortality lower than 30 % (Hoffmann, 1988; Hoffmann et al., 1994). In comparison with other host species, the strength of cytoplasmic incompatibility observed in T. taiwanemma may be considered as intermediate or relatively high. Phylogenetic analysis based on the wsp gene (Fig. 1) suggested that wtai is phylogenetically close to wstri, wcon, wenc, wdei, wbipa and wbipb. Interestingly, these Wolbachia strains induce different reproductive phenotypes: wstri and wcon induce cytoplasmic incompatibility, wdei causes thelytokous parthenogenesis (Stouthamer et al., 1993) and the others are male-killers (Hurst et al., 1999). Thus, closely related Wolbachia have different effects on their host, as was also described in a recent study by Van Meer et al. (1999). One explanation for the lack of congruence between Wolbachia phylogeny and their phenotypes is that the host, rather than Wolbachia, plays a major role in the determination of the phenotype. It is also possible that Wolbachia easily acquire the ability to induce various effects. Different phenotypes may evolve rapidly if the genes responsible for them are similar or if these genes are located on a transposable element that can move between strains. It has been demonstrated that the genome of wtai contains transposon-like sequences (Masui et al., 1999) and phages (S. Masui, unpublished data). In the PCR assay using ftszb primers, Wolbachia were detected in all the samples examined, except in the spermatozoa and haemolymph (Fig. 2). Since Wolbachia are maternally transmitted through the egg cytoplasm and induce reproductive alterations, it has been assumed that they infect the reproductive tissues of the hosts. Contrary to this assumption, we have shown here that Wolbachia are widely distributed in the tissues of T. taiwanemma, a finding consistent with the previous reports on Wolbachia infections in Drosophila simulans, the mosquitoes Aedes albopictus and Culex pipiens, the moth Ephestia cautella (Dobson et al., 1999) and the isopod Armadillidium vulgare (Martin et al., 1973). In the present study, we further examined the somatic infection of the Wolbachia in terms of bacterial density. The quantitative PCR assays (Table 2) showed that the density in fat bodies was higher even than that in the ovaries or testes. The bacterial density differed greatly among tissues, suggesting that some tissues, such as the muscle and brain, are not suitable for the proliferation of wtai. The distribution and density of Wolbachia in the tissues of adult insects may also be related to the bacterial localization in the host egg, which has not yet been examined for T. taiwanemma. To explain the mechanism of cytoplasmic incompatibility, it has often been postulated that Wolbachia secrete a protein that remains in mature spermatozoa (Hurst, 1991; Lassy and Karr, 1996). When Sasaki et al. (1998) analyzed sperm proteins from Drosophila simulans, no protein specific to the infected flies was detected. Compared with Drosophila spp., T. taiwanemma has some features suitable for sperm analysis: (i) mature spermatozoa can be obtained easily from spermatophores without contaminating the spermatids; (ii) spermatophores can be collected from a male repeatedly without killing it; and (iii) spermatophores contain sufficient

6 2508 S. KAMODA AND OTHERS volumes of spermatozoa for biochemical and molecular biological analyses. In this study, we took advantage of these features of T. taiwanemma to analyze larger numbers of spermatozoa and performed isoelectric focusing over a wider range than in the previous study with D. simulans. In spite of these improvements in the methodology, we were still unable to detect any repeatable difference in the protein profiles between the infected and uninfected individuals. This could mean that the amount of the protein involved in cytoplasmic incompatibility expression is extremely small or that the pi and/or molecular size of the protein are out of range of the twodimensional gel system employed. It is also possible that cytoplasmic incompatibility is caused by such a small modification in protein structure that it could not be detected. Alternatively, the molecule responsible for cytoplasmic incompatibility may not be a protein, but some other molecule, such as a nucleic acid or a compound of low molecular mass. To examine these possibilities, further experiments are needed. References Binnington, K. C. and Hoffman, A. A. (1989). Wolbachia-like organisms and cytoplasmic incompatibility in Drosophila simulans. J. Invertebr. Path. 54, Braig, H. R., Zhou, W., Dobson, S. L. and O Neill, S. L. (1998). Cloning and characterization of a gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis. J. Bacteriol. 180, Cade, W. H. and Tyshenko, M. G. (1990). Geographic variation in hybrid fertility in the field crickets Gryllus integer, G. rubens and Gryllus sp. Can. J. Zool. 68, Callaini, G., Dallai, R. and Riparbelli, M. G. (1997). Wolbachiainduced delay of paternal chromatin condensation does not prevent maternal chromosomes from entering anaphase in incompatible crosses of Drosophila simulans. J. Cell Sci. 110, Dobson, S. L., Bourtzis, K., Braig, H. R., Jones, B. F., Zhou, W., Rousset, F. and O Neill, S. L. (1999). Wolbachia infections are distributed throughout insect somatic and germ line tissues. Insect Biochem. Mol. Biol. 29, Felsenstein, J. (1981). Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17, Giordano, R., Jackson, J. J. and Robertson, H. M. (1997). The role of Wolbachia bacteria in reproductive incompatibilities and hybrid zones of Diabrotica beetles and Gryllus crickets. Proc. Natl. Acad. Sci. USA 94, Harrison, R. G. (1983). Barriers to gene exchange between closely related cricket species. I. Laboratory hybridization studies Gryllus pennsylvanicus, Gryllus firmus. Evolution 37, Hoffmann, A. A. (1988). Partial cytoplasmic incompatibility between two Australian populations of Drosophila melanogaster. Ent. Exp. Appl. 48, Hoffmann, A. A., Clancy, D. J. and Merton, E. (1994). Cytoplasmic incompatibility in Australian populations of Drosophila melanogaster. Genetics 136, Hurst, G. D. D., Jiggins, F. M., von-der-schulenburg, J. H. G., Bertrand, D., West, S. A., Goriacheva, I. I., Zakharov, I. A., Werren, J. H., Stouthamer, R. and Majerus, M. E. N. (1999). Male-killing Wolbachia in two species of insect. Proc. R. Soc. Lond. B 266, Hurst, L. D. (1991). The evolution of cytoplasmic incompatibility or when spite can be successful. J. Theor. Biol. 148, Jost, E. (1971). Meiosis in the male of Culex pipiens and Aedes albopictus and fertilization in the Culex pipiens-complex. Can. J. Genet. Cytol. 13, Katz, L. A. and Harrison, R. G. (1997). Balancing selection on electrophoretic variation of phosphoglucose isomerase in two species of field cricket: Gryllus veletis and G. offnsylvanicus. Genetics 147, Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, Lassy, C. W. and Karr, T. L. (1996). Cytological analysis of fertilization and early embryonic development in incompatible crosses of Drosophila simulans. Mech. Dev. 57, Martin, G., Juchault, P. and Legrand, J. J. (1973). Mise en évidence d un micro-organisme intracytoplasmique symbiote de l oniscoïde Armadillidium vulgare L., dont la présence accompagne l intersexualité ou la féminisation totale des males génétiques de la lignée thélyghne. C.R. Acad. Sci. Ser. D 276, Masui, S., Kamoda, S., Sasaki, T. and Ishikawa, H. (1999). The first detection of the insertion sequence ISW1 in the intracellular reproductive parasite Wolbachia. Plasmid 42, Masui, S., Sasaki, T. and Ishikawa, H. (1997). groe-homologous operon of Wolbachia, an intracellular symbiont of arthropods: a new approach for their phylogeny. Zool. Sci. 14, Noda, H. (1984). Cytoplasmic incompatibility in allopatric field populations of the small brown planthopper, Laodelphax striatellus, in Japan. Ent. Exp. Appl. 35, O Neill, S. L. (1989). Cytoplasmic symbionts in Tribolium confusum. J. Invertebr. Path. 53, O Neill, S. L. and Karr, T. L. (1990). Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348, Reed, K. M. and Werren, J. H. (1995). Induction of paternal genome loss by the paternal-sex-ratio chromosome and cytoplasmic incompatibility bacteria (Wolbachia): a comparative study of early embryonic events. Mol. Reprod. Dev. 40, Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, Sasaki, T., Braig, H. R. and O Neill, S. L. (1998). Analysis of Wolbachia protein synthesis in Drosophila in vivo. Insect Mol. Biol. 7, Sasaki, T. and Ishikawa, H. (1999). Wolbachia infections and cytoplasmic incompatibility in the almond moth and Mediterranean flour moth. Zool. Sci. 16, Smith, C. J. and Cade, W. H. (1987). Relative fertility in hybridization experiments using three song types of the field crickets Gryllus integer and Gryllus rubens. Can. J. Zool. 65, Stevens, L. and Wade, M. J. (1990). Cytoplasmically inherited reproductive incompatibility in Tribolium flour beetles: the rate of spread and effect on population size. Genetics 124, Stouthamer, R., Breeuwer, J. A. J. and Hurst, G. D. D. (1999). Wolbachia pipientis: microbial manipulation of arthropod reproduction. Annu. Rev. Microbiol. 53, Stouthamer, R., Breeuwer, J. A. J., Luck, R. F. and Werren, J.

7 Wolbachia infection in cricket 2509 H. (1993). Molecular identification of microorganisms associated with parthenogenesis. Nature 361, Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, Van Meer, M. M. M., Witteveldt, J. and Stouthamer, R. (1999). Phylogeny of the arthropod endosymbiont Wolbachia based on the wsp gene. Insect Mol. Biol. 8, Werren, J. H. (1997). Biology of Wolbachia. Annu. Rev. Ent. 42, Werren, J. H., Zhang, W. and Guo, L. R. (1995a). Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proc. R. Soc. Lond. B 261, Werren, J. H., Windsor, D. and Guo, L. R. (1995b). Distribution of Wolbachia among neotropical arthropods. Proc. R. Soc. Lond. B 262, Wright, J. D. and Barr, A. R. (1980). The ultrastructure and symbiotic relationships of Wolbachia of mosquitoes of the Aedes scutellaris group. J. Ultrastruct. Res. 72, Zhou, W., Rousset, F. and O Neil, S. L. (1998). Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc. R. Soc. Lond. B 265,