Supplemental data. Li et al. (2014). Plant Cell /tpc/114/133140

Transcription

1 MET (CG) CMT (CHG / CHH) DRM (CHH / CG / CHG) Supplemental Figure 1. Phylogenetic Tree of DNA Methyltransferases in Maize and Arabidopsis. Maize genes are indicated by red dots. The DNA methylation sequence contexts on which the enzymes operate are labelled at the right panel, with bold text representing the main working sequence contexts. The phylogenetic tree was built based on full length amino acid sequences ( using the Unweighted Pair-Group Method with Arithmetic mean (UPGMA) method from the MEGA package.

2 CG CHG CHH Methylation ()% Supplemental Figure 2. Methylation Profiles over Genes and Surrounding Regions in Subsets of the B73 WGBS Dataset. Varying number of reads were sub-sampled from the entire B73 dataset, and methylation levels were computed for genic regions and upstream and downstream 1 kb regions. Gene sizes were normalized to 1 kb (0 to 1000), with its upstream regions shown as minus (-1000 to 0) and downstream regions plus 1 kb (1000 to 2000). The observation that the overall trends remain quite similar, even down to 5M reads, suggests that low-coverage sampling of the genome can provide robust trends for DNA methylation profiles over maize genes.

3 WGBS (%) - SeqCap (%) CG CHG CHH Supplemental Figure 3. Comparison of Methylation Levels Measured by Lowcoverage WGBS and SeqCap for Each Sequence Context. Regions that are covered by both methods were identified. Differences in methylation levels between the two methods were calculated and displayed as boxplots using R.

4 A B C D E F 21-nt 22-nt 23-nt 24-nt G H I Supplemental Figure 4. Small RNA Profiles at Different Transposon Types and Sizes. (A-C) Small RNA profiles over three major transposon types, retrotransposons classified as spreading (A), retrotransposons classified as non-spreading (B), and DNA transposons (C). Line colors represent different small RNA sizes. The black filled box at the bottom of each plot represents the transposons. Also shown in each plot are small RNA levels at the 1 kb upstream and downstream regions (separated by dashed vertical lines from the transposon) of each transposon type. (D-I) show similar plots but only include transposons with a size less than 1 kb (D-F), or greater than 3 kb (G-I). Small RNA data were from Regulski et al. (2013). Small RNAs were mapped to the maize genome. Small RNA abundance over 100-bp non-overlapping sliding windows was summarized for each of the four sizes of small RNA (21-nt to 24-nt). The 100-bp tiles that are covered by small RNA and that are within or close (1 kb) to each transposon type were identified. Distances between each tile and the transposon start site were calculated as the distance between the mid-point of a tile and the transposon start site. The distance was further normalized onto a scale of 1 kb for tiles that are within a transposon, giving a total of 3 kb. The tiles were assigned to 60 equal bins with a size of 50 bp. Small RNA levels for each bin were averaged for transposons with the same type and plotted against the mid-point of the bin.

5 WT chr106 zmet2 zmet5 Supplemental Figure 5. Regulation of CHG Methylation by chr106, zmet2, and zmet5 across transposons with different lengths. Methylation was plotted in three transposon types: retrotransposons whose methylation can spread into flanking regions (RTEspreading), retrotransposons whose methylation cannot spread into flanking regions (RTEnonspreading), and DNA transposons (TE). The transposons were shown as black boxes at the middle bottom of each plot. The black line represents the average methylation level (%) in wild-type genotypes calculated from five diverse inbred lines (B73, Mo17, CML322, Oh43, and Tx303), and the grey shade represents the standard deviation of methylation across those five lines. The top row of plots shows profiles for elements less than 1 kb, the middle row of plots shows profiles for elements between 1 and 3 kb and the bottom row of plots shows profiles for elements greater than 3 kb in length.

6 A Expression level B Expression level C Expression level Supplemental data. Li et al. (2014). Plant Cell /tpc/114/ DAP_Whole seed 12DAP_Endopsperm 12DAP_Whole seed 14DAP_Endopsperm 14DAP_Whole seed 16DAP_Embryo 16DAP_Endosperm 16DAP_Whole seed 18DAP_Embryo 18DAP_Endosperm 18DAP_Pericarp 18DAP_Whole Seed 20DAP_Embryo 20DAP_Endosperm 20DAP_Whole Seed 22DAP_Embryo 22DAP_Endosperm 22DAP_Whole Seed 24DAP_Embryo 24DAP_Endosperm 24DAP_Whole Seed 24H_Germinating Seed 2DAP_Whole Seed 4DAP_Whole Seed 6DAP_Whole Seed 6DAS_GH_Primary Root 8DAP_Whole Seed R1_Anthers R1_Pre-pollination Cob R1_Silks R2_Thirteenth Leaf V1_Pooled Leaves V1_Stem and SAM V13_Immature Tassel V18_Immature Cob V18_Meiotic Tassel V3_Stem and SAM V3_Topmost Leaf V4_Stem and SAM V5_Base of stage-2 Leaf V5_First Internode V5_Shoot Tip V5_Tip of stage-2 Leaf V7_Base of stage-2 Leaf V7_Tip of stage-2 Leaf V9_Eighth Leaf V9_Eleventh Leaf V9_Fourth Internode V9_Immature Leaves V9_Thirteenth Leaf VT_Thirteenth Leaf zmet2 zmet5 chr101 chr106 10DAP_Whole seed 12DAP_Endopsperm 12DAP_Whole seed 14DAP_Endopsperm 14DAP_Whole seed 16DAP_Embryo 16DAP_Endosperm 16DAP_Whole seed 18DAP_Embryo 18DAP_Endosperm 18DAP_Pericarp 18DAP_Whole Seed 20DAP_Embryo 20DAP_Endosperm 20DAP_Whole Seed 22DAP_Embryo 22DAP_Endosperm 22DAP_Whole Seed 24DAP_Embryo 24DAP_Endosperm 24DAP_Whole Seed 24H_Germinating Seed 2DAP_Whole Seed 4DAP_Whole Seed 6DAP_Whole Seed 6DAS_GH_Primary Root 8DAP_Whole Seed R1_Anthers R1_Pre-pollination Cob R1_Silks R2_Thirteenth Leaf V1_Pooled Leaves V1_Stem and SAM V13_Immature Tassel V18_Immature Cob V18_Meiotic Tassel V3_Stem and SAM V3_Topmost Leaf V4_Stem and SAM V5_Base of stage-2 Leaf V5_First Internode V5_Shoot Tip V5_Tip of stage-2 Leaf V7_Base of stage-2 Leaf V7_Tip of stage-2 Leaf V9_Eighth Leaf V9_Eleventh Leaf V9_Fourth Internode V9_Immature Leaves V9_Thirteenth Leaf VT_Thirteenth Leaf zmet3 zmet7 10DAP_Whole seed 12DAP_Endopsperm 12DAP_Whole seed 14DAP_Endopsperm 14DAP_Whole seed 16DAP_Embryo 16DAP_Endosperm 16DAP_Whole seed 18DAP_Embryo 18DAP_Endosperm 18DAP_Pericarp 18DAP_Whole Seed 20DAP_Embryo 20DAP_Endosperm 20DAP_Whole Seed 22DAP_Embryo 22DAP_Endosperm 22DAP_Whole Seed 24DAP_Embryo 24DAP_Endosperm 24DAP_Whole Seed 24H_Germinating Seed 2DAP_Whole Seed 4DAP_Whole Seed 6DAP_Whole Seed 6DAS_GH_Primary Root 8DAP_Whole Seed R1_Anthers R1_Pre-pollination Cob R1_Silks R2_Thirteenth Leaf V1_Pooled Leaves V1_Stem and SAM V13_Immature Tassel V18_Immature Cob V18_Meiotic Tassel V3_Stem and SAM V3_Topmost Leaf V4_Stem and SAM V5_Base of stage-2 Leaf V5_First Internode V5_Shoot Tip V5_Tip of stage-2 Leaf V7_Base of stage-2 Leaf V7_Tip of stage-2 Leaf V9_Eighth Leaf V9_Eleventh Leaf V9_Fourth Internode V9_Immature Leaves V9_Thirteenth Leaf VT_Thirteenth Leaf Supplemental Figure 6. Expression Patterns of Three Paralogous Pairs in Different Tissues of B73. The B73 expression atlas derived from RNAseq dataset (Sekhon et al., 2013) was used to compare the tissue-specific expression for Chr101 / Chr106 (A), Zmet2 / Zmet5 (B), and Zmet3 / Zmet7 (C). Expression level was measured as reads per kilobase per million mapped.

7 Expected segregation ab (1/2) ab (1/2) ab (1/2) aabb (1/4) aabb (1/4) ab (1/2) aabb (1/4) aabb (1/4) Two scenarios for recovering less than expected number of double mutants ab (1/2) ab (1/2) Potential observed segregations ab (1/1) aabb (1/2) aabb (1/2) ab - - OR ab (1/1) aabb:aabb = 1/2:1/2 = 1:1 ab (1/2) ab (1/2) aabb (1/2) aabb (1/2) ab - - aabb:aabb:aabb 1:2:1 -/-; +/- (aabb) ab (1/2) ab (1/2) self ab (1/2) aabb (1/4) aabb (1/4) ab (1/2) aabb (1/4) - aabb:aabb = 1/4:2/4 = 1:2 Supplemental Figure 7. Two Scenarios Leading to Reduced Recovery of Double Mutants. This figure illustrates possible segregation ratios in the offspring of a parental line that is homozygous mutant for one gene (aa) and heterozygous for the other gene (Bb). In scenario 1, the double mutant gamete is only viable/transmittable through one parent, either paternal or maternal parent (shown as dark grey for non-viable/transmittable gamete). This leads to failure of recovering double mutants and predicts a segregation ratio of 1:1 for BB:Bb genotypes. In scenario 2, the double mutant gamete is viable/transmittable through both parents but the resulting double mutant zygote has no/reduced viability (shown by dark grey). In this scenario, a segregation ratio of 1:2 of BB:Bb genotypes would be observed in the offspring.

8 Supplemental Table 1. Summary of Mutants. Gene-allele Mutation position Coordinate (ZmB73V2) Genetic background Maize gene name Maize gene ID chr101-m1 Mu insertion in promoter (-140 bp) chr2: 236,357,495 B73 > 4 generations Chr101 GRMZM2G chr101-m3 Mu insertion within exon 1 chr2: 236, 356,941 B73 > 4 generations Chr101 GRMZM2G chr106-m1 Mu insertion within exon 15 chr1: 270,257,824 B73 > 4 generations Chr106 GRMZM2G chr106-t11 zmet2-m1 Nonsynonymous change at codon 296 (C to T, Q296 -> *) chr1: 270,253,818 TILLING allele in W22 Chr106 GRMZM2G Mu insertion within exon 18 (codon 837) chr10: 142,188,814 B73 > 4 generations Zmet2 GRMZM2G zmet2-m2 Mu insertion within exon 1 chr10: 142,194,642 zmet5-m1 Mu insertion within exon 1 chr2: 10,338,282 B73 > 4 generations Zmet2 GRMZM2G B73 > 4 generations Zmet5/DMT105 GRMZM2G zmet7-m1 Mu insertion within exon 2 chr1: 2,937,946 zmet7-m2 Mu insertion within exon 8 chr1: 2,941,139 Mo17 > 4 generations Zmet7/DMT107 GRMZM2G Mo17 > 4 generations Zmet7/DMT107 GRMZM2G zmet7-t03 Nonsynonymous change at codon 321 (C to T, Q321 -> *) chr1: 2,941,063 TILLING allele in B73 Zmet7/DMT107 GRMZM2G tgr1 EMS (unknown) unknown Uncharacterized genetic background Tgr1 unknown tgr9 EMS (unknown) unknown Uncharacterized genetic background Tgr9 unknown mop1 Mu insertion within exon 4 chr2: 40,503,090 W23/K55; back-crossed into B73 > 6 generations Mop1 GRMZM2G vim102-1 Mu insertion within exon 1 chr8: 135,212,348 UniformMu allele in W22 Vim102 GRMZM2G zmet5-m2 Mu insertion within exon 1 chr2: 10,337,843 UniformMu allele in W22 Zmet5/DMT105 GRMZM2G G to A transition at exon 7 (E1136K, mop2 glutamic acid to lysine) chr2: 6,336,767 W23/K55 Mop2 GRMZM2G G to A transition at acceptor site of mop3 intron 13 (AG --> AA) chr1: 188,772,899 W23/K55 Mop3 GRMZM2G007681

9 Supplemental Table 1. Summary of Mutants (continued). Gene-allele Arabidopsis ortholog Arabidopsis gene full name Putative gene function Reference for mutant (or population) chr101-m1 DDM1 defective in DNA methylation 1 snf2 family chromatin remodeler McCarty and Meeley 2009 chr101-m3 DDM1 defective in DNA methylation 1 snf2 family chromatin remodeler McCarty and Meeley 2009 chr106-m1 DDM1 defective in DNA methylation 1 snf2 family chromatin remodeler McCarty and Meeley 2009 chr106-t11 DDM1 defective in DNA methylation 1 zmet2-m1 CMT3 chromomethylase 3 methyltransferase snf2 family chromatin remodeler Till et al McCarty and Meeley 2009; Papa et al zmet2-m2 CMT3 chromomethylase 3 methyltransferase McCarty and Meeley 2009; Makarevitch et al zmet5-m1 CMT3 chromomethylase 3 methyltransferase McCarty and Meeley 2009 zmet7-m1 DRM1/2 zmet7-m2 DRM1/2 domain rearranged methyltransferase 1/2 domain rearranged methyltransferase 1/2 de novo DNA methyltransferase McCarty and Meeley 2009 de novo DNA methyltransferase McCarty and Meeley 2009 zmet7-t03 DRM1/2 domain rearranged methyltransferase 1/2 de novo DNA methyltransferase Till et al tgr1 unknown transgene reactivated 1 Unknown Madzima et al tgr9 unknown transgene reactivated 9 Unknown Madzima et al RNA-dependent RNA polymerase 2 RNA-dependent RNA polymerase Dorweiler et al mop1 RDR2 methylcytosinebinding vim102-1 VIM1 variant in methylation 1 protein Settles et al zmet5-m2 CMT3 chromomethylase 3 methyltransferase Settles et al mop2 NRPD2/E2 mop3 NRPD1 Second largest subunit of RNA polymerse IV and V Largest subunit of RNA polymerase IV nuclear RNA polymerase D2/E2 Sidorenko et al nuclear RNA polymerase D1 Sloan et al. in press

10 Supplemental Table 2. Mapping Summary of Whole-genome Bisulfite Sequencing Dataset. Genotype Reads (initial) % duplicate reads Mapped with Mapping efficiency(%) # unique best hit # no alignment # not unique CG% CHG% CHH% Conversion (%) SRA # zmet2-m1 21,560, N 1 -L 25 -p 4) 64 13,138,160 1,906,943 5,485, SRX zmet2-m2 17,695, N 1 -L 25 -p 4) ,813,039 1,353,891 4,762, SRX zmet5-m1 15,621, N 1 -L 25 -p 4) ,374,116 1,111,876 4,242, SRX mop1 19,096, N 1 -L 25 -p 4) ,878,556 1,367,153 4,074, SRX tgr1 18,866, N 1 -L 25 -p 4) ,921,389 2,791,971 4,455, SRX tgr9 20,341, N 1 -L 25 -p 4) ,201,907 2,440,587 4,942, SRX chr101-m1 19,190, N 1 -L 25 -p 4) ,489,695 3,611,486 5,986, SRX chr101-m3 21,527, N 1 -L 25 -p 4) ,449,496 2,111,926 5,886, SRX chr106-m1 21,787, N 1 -L 25 -p 4) ,908,474 1,843,497 5,891, SRX chr106-t11 22,639, N 1 -L 25 -p 4) ,468,073 4,406,203 6,713, SRX zmet7-m1 22,855, N 1 -L 25 -p 4) ,148,406 1,616,794 6,166, SRX zmet7-m2 19,407, N 1 -L 25 -p 4) ,209,987 1,395,687 4,981, SRX zmet7-t03 24,054, N 1 -L 25 -p 4) ,223,165 1,770,833 6,468, SRX vim ,700, N 1 -L 25 -p 4) ,968,178 4,322,262 8,238, SRX B73 167,762, per file); bismar ,248,366 12,835,485 75,909, SRR Mo17 143,155, per file); bismar ,838,004 29,397,283 68,400, SRR Oh43 160,563, per file); bismar ,354,128 28,600,416 73,492, SRX CML ,299, per file); bismar ,571,692 33,828,981 88,047, SRX Tx ,478, per file); bismar ,347,056 31,066,308 78,317, SRX731434

11 Supplemental Table 3. Mapping Summary of Targeted Bisulfite Sequencing Dataset. Genotype Reads (initial) Mapping efficiency(%) # unique best hit # no alignment # not unique CG% CHG% CHH% Conversion rate (%) chr101-m1 7,471, ,224,812 1,547, , % 12.60% 1.40% SRX chr101-m3.run1 2,950, ,144, , , % 41.50% 2.80% SRX chr101-m3.run2 2,848, ,015, , , % 36.40% 2.20% SRX chr106-m1 3,381, ,466, , , % 33.00% 1.60% SRX chr106-t11 4,362, ,892, , , % 12.10% 1.30% SRX mop1 5,314, ,012, , , % 21.70% 1.00% SRX mop2 3,912, ,311,112 2,400, , % 20.90% 0.80% SRX mop3 4,247, ,140,470 1,720, , % 26.90% 1.20% SRX tgr1 3,707, ,286, , , % 24.10% 1.20% SRX tgr9 2,651, ,903, , , % 26.70% 1.90% SRX vim102-1.run1 2,504, ,379, , , % 42.40% 2.60% SRX vim102-2.run2 2,598, ,457, , , % 34.20% 2.20% SRX zmet2-m1.run1 2,649, ,032, , , % 25.90% 1.50% SRX zmet2-m1.run2 2,527, ,880, , , % 26.30% 1.40% SRX zmet2-m2 2,575, ,883, , , % 11.90% 1.10% SRX zmet5-m1 3,218, ,439, , , % 33.90% 1.70% SRX zmet5-m2 5,108, ,647,577 1,719, , % 31.30% 2.00% SRX zmet7-m1.run1 2,979, ,273, , , % 33.20% 1.50% SRX zmet7-m1.run2 2,793, ,117, , , % 36.00% 1.70% SRX B73 3,257, ,553, , , % 34.40% 2.10% SRX B73SC1 2,684, ,158, , , % 33.40% 2.10% SRX B73SC2 3,084, ,471, , , % 34.50% 2.10% SRX Mo17 3,383, ,975, , , % 32.90% 2.20% SRX Mo17SC1 2,949, ,810, , , % 26.20% 2.00% SRX Oh43 2,987, ,650, , , % 35.10% 2.30% SRX Oh43_rep2 3,517, ,289, , , % 13.80% 1.50% SRX CML322 5,109, ,467,165 2,029, , % 29.40% 2% SRX W22 4,250, ,227,883 1,552, , % 40.20% 2.80% SRX SRA #

12 Supplemental Table 4. Isolation of Double Mutants. Gamete B:b Gamete A:a CHISQ.Bb CHISQ.Aa # Expected mutant gamete # Expected WT gamete # b gamete # B gamete # a gamete # A gamete bb Bb BB aa Aa AA AAbb AABb AABB Aabb AaBb AaBB aabb aabb aabb Obs. double mutants Exp. double mutants # off-spring Parental Genotype zmet2-m1/+;zmet5- m1/zmet5-m1 self zmet2-m1/zmet2-m1; zmet5-m1/+ self zmet2-m1/+; zmet zmet2-m2/+; zmet chr101-m3/chr101-m3; chr106-m1/+ self

13 Supplemental Table 5. Primers Used in This Study. Gene-allele Primer Name Primer 1 sequence Primer 2 sequence Representative gel picture zmet2-m1 zmet2-f101/r101 TCATTACCGAACATGTTGTCCAC CGTTCCCGACTTGAATGTACCTA zmet2-m2 zmet2-f103/r103 GAGGAAGAAGAAGGGGGATG GCACGCACAATAAATCAGCA zmet5-m1 zmet5-f10/r10 GGTAAGAAGAGGGTGGGGAGAAGGAG GCAGCAGCAGCATGACAAATAAAGGC zmet5-m2 DMT105-1_F1/R1 TTTCCACATTTGACCGATCCTCTT CTTCTCGGTCTCCCCCTTCTTCTT chr101-m1 chr101f2/chr101r4 AAAGCTTCCGTTTCCTTCAGTTCAC CTCCAGTAGTCGCTCTTCCTCCTTC chr101-m3 chr101f3/chr101r2 GAAGAGGCTGCTAGACTTGCTTTTG TCTTCTACCTGTGGCTGTTCAGCTTGAG chr106-m1 chr106f4/chr106r4 GACGAAGACCTCTTGAAGCTGATG TACATCATAGAACGCAGCAACAGAAG chr106-t11 chr106tf1/chr106tr1 (MATTGCAGGGATGATGATGTGCTGGTT TGCACCCAGTCATTGGAATTTGTGTC zmet7-m1 Zmet7F7/ZmetR7 GATCGAGTTAGGGACCTGCATTTTGG GTGTCGCTGTACGCTAATCATGATCC zmet7-m2 Zmet7F8/ZmetR8 GCCGGACCATTGGACAAGACC GCCTTGTGGGTACCTATCCTTGAGG zmet7-t03 dmt107tf1-dmt107tr1 CCCCTGTTCACTGATCATGCACCTT CACCAGTCGACCTTCAAATCATTCACA sequence F1 vim102-1 VIM102-1_F1/R1 GAGGTCGGTCGGAACTGGAAAT TTCACGTTCAGGGATCCAACTTTT Mu primer 9242 AGAGAAGCCAACGCCWCGCCTCYATTTCGTC - -