Received 4 July 2008/Accepted 10 November 2008

Transcription

1 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2009, p Vol. 75, No /09/$ doi: /aem Copyright 2009, American Society for Microbiology. All Rights Reserved. Efficient Production of Optically Pure D-Lactic Acid from Raw Corn Starch by Using a Genetically Modified L-Lactate Dehydrogenase Gene-Deficient and -Amylase-Secreting Lactobacillus plantarum Strain Kenji Okano, 1 Qiao Zhang, 2 Satoru Shinkawa, 2 Shogo Yoshida, 3 Tsutomu Tanaka, 4 Hideki Fukuda, 4 and Akihiko Kondo 2 * Department of Molecular Science and Material Engineering, Graduate School of Science and Technology, 1 Department of Chemical Science and Engineering, Graduate School of Engineering, 2 Department of Chemical Science and Engineering, Faculty of Engineering, 3 and Organization of Advanced Science and Technology, 4 Kobe University, 1-1 Rokkodaicho, Nada-ku, Kobe , Japan Received 4 July 2008/Accepted 10 November 2008 In order to achieve direct and efficient fermentation of optically pure D-lactic acid from raw corn starch, we constructed L-lactate dehydrogenase gene ()-deficient Lactobacillus plantarum and introduced a plasmid encoding Streptococcus bovis 148 -amylase (AmyA). The resulting strain produced only D-lactic acid from glucose and successfully expressed amya. With the aid of secreting AmyA, direct D-lactic acid fermentation from raw corn starch was accomplished. After 48 h of fermentation, 73.2 g/liter of lactic acid was produced with a high yield (0.85 g per g of consumed sugar) and an optical purity of 99.6%. Moreover, a strain replacing the gene with an amya-secreting expression cassette was constructed. Using this strain, direct D-lactic acid fermentation from raw corn starch was accomplished in the absence of selective pressure by antibiotics. This is the first report of direct D-lactic acid fermentation from raw starch. Poly-lactic acid (PLA) is an important agro-based plastic that can be produced from inexpensive, renewable, and abundantly available biomass resources, including starchy materials. These resources have advantages over limited oil- and fossilbased sources, as they do not result in any net carbon dioxide release to the atmosphere (7). Recently, stereocomplex PLA, which is composed of both poly-l- and -D-lactic acid, has been attracting much attention due to its high thermostability. Stereocomplex-type polymers show a melting point (ca. 230 C) that is approximately 50 C higher than that of the respective single polymers (8). Therefore, D-lactic acid, in addition to L-lactic acid, which has been the focus of production to date, is of significant importance. Lactic acid bacteria (LAB) are promising microorganisms for the efficient production of lactic acid from various sugars, such as glucose, sucrose, and lactose. However, when starchy materials are used as a carbon source, they must be saccharified by physicochemical and enzymatic treatment because most LAB cannot utilize starchy materials directly (13). This makes the whole process less economically viable. Therefore, many researchers have examined the direct production of lactic acid from starchy materials by using wild amylolytic LAB (ALAB) (6, 24, 25) or genetically modified amylase-producing LAB (15, 16). Although D-lactic acid has been produced by fermentation from pretreated substrates such as rice starch (5) and by simultaneous saccharification and fermentation from cellulose (23), there have been no reports on the direct production of D-lactic acid from starchy materials. This is due to a lack of * Corresponding author. Mailing address: Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe University, 1-1 Rokkodaicho, Nada-ku, Kobe , Japan. Phone and fax: akondo@kobe-u.ac.jp. Published ahead of print on 14 November D-lactic acid-producing ALAB and difficulties in gene manipulation of D-lactic acid-producing LAB, such as Lactobacillus delbrueckii (22). We focused on Lactobacillus plantarum, which is an industrially important strain due to its environmental flexibility and its ability to assimilate a wide range of carbohydrates (9). In recent years, several gene manipulation methods for Lactobacillus plantarum have been established (18, 19). Moreover, the complete genome sequence has been decoded for L. plantarum NCIMB 8826 (9). Based on whole-genome analysis, L. plantarum possesses two types of lactate dehydrogenase (LDH), L- LDH and D-LDH, which convert pyruvate into L- and D-lactic acid, respectively. Ferain et al. (4) reported that chromosomal deletion in the gene of L. plantarum NCIMB 8826 provoked an absence of L-LDH activity and produced D-lactic acid from glucose. In the present study, to produce D-lactic acid directly from starch, we constructed an L-LDH-deficient, -amylase-secreting L. plantarum strain. The engineered strain expressed -amylase from Streptococcus bovis 148 (AmyA) (20) and efficiently degraded raw starch with the aid of a C-terminal starch-binding domain (11). Using this strain, we achieved the direct and efficient fermentation of optically pure D- lactic acid from raw corn starch. MATERIALS AND METHODS Bacterial strains and media. The bacterial strains used in this study are listed in Table 1. Escherichia coli VE 7108 (12) was used for pg host9-based DNA manipulation (10). It was grown in Luria-Bertani (LB) medium containing 250 g/ml erythromycin and 10 g/ml kanamycin at 37 C. L. plantarum NCIMB 8826 and its derivative were grown in MRS broth (Difco Laboratories, Detroit, MI) or MRS broth containing 25 g/ml erythromycin at 37 C. For solid media, 1.5% (wt/vol) agar was added to the media described above. Plasmid construction. The oligonucleotides and plasmids used in this study are summarized in Table 1. PCR was carried out using KOD-Plus polymerase 462

2 VOL. 75, 2009 D-LACTIC ACID PRODUCTION FROM RAW CORN STARCH 463 TABLE 1. Strains, plasmids, and oligonucleotide primers used in this study Strain, plasmid, or primer Relevant phenotype and description or sequence (5 3 ) a Source or reference Strains Escherichia coli strains VE7108 Kanamycin resistance marker; contains the wild-type repa plasmid gene (not thermosensitive); 12 host for pg host9 DNA manipulation VE6838 Kanamycin resistance marker; VE7108 carrying pg host9 12 Lactobacillus plantarum strains WT NCIMB 8826 WT strain NCIMB NCIMB 8826 strain This study ::amya NCIMB 8826 strain with gene replaced with amya-secreting expression cassette This study Plasmids pcus A Vector for secreting -amylase; erythromycin resistance marker 16 pg host9 Thermosensitive replicon; erythromycin resistance marker 10 pgh9- Vector for deletion of gene of NCIMB 8826; erythromycin resistance marker This study pgh9-::amya Vector for replacement of gene of NCIMB 8826 with amya-secreting expression cassette; erythromycin resistance marker This study Oligonucleotide primers -_F -_R -_F -_R -_seq -_seq a For primers, restriction enzyme sites are underlined. CCGCTCGAGAATCCGGTGATTAGTTGCCG ACGCGTCGACGAGCTCAGATCTAATAAGTCATCCTCTCGTAGTGAAAA CCCGATATCGTCGACTCATTTCATACGATTAAATGTATGATGAACG GGACTAGTAACAGCGTTTTGGTCTAAACTTACTTT AAATCTTCTCACCGTCTTGAAAAG TGGTTAAATCTTTTTTAGTATTGATTGTAATACC (Toyobo Co. Ltd., Osaka, Japan). The plasmid for disrtion of the L-LDH gene () was constructed as follows. The 1,000-bp stream region from the start codon of and the 1,000-bp stream region from the stop codon of were amplified by PCR from the genome of L. plantarum NCIMB 8826, using oligonucleotide primers -_F plus -_R and -_F plus -_R, respectively. The resulting fragments were digested with SalI and ligated. Using the ligated fragment (2,000 bp) as a template, the same fragment was amplified by PCR using oligonucleotide primers -_F and -_R. The amplified fragment was digested with XhoI and SpeI and subsequently inserted into the XhoI and SpeI sites of the plasmid pg host9 (10). The resulting plasmid was designated pgh9- (Fig. 1a). The plasmid to replace with an amya-secreting expression cassette was constructed as follows. The expression cassette of amya consisted of a clpc UTLS promoter, which consists of the clpc core promoter and an untranslated leader sequence (14), the amya signal sequence, the mature region of amya, and the terminator of the conjugated bile acid hydrolase gene (cbh) (2) and was obtained from pcus A (Fig. 1b) (16) by digestion with BglII and SacI. It was subsequently inserted into the BglII and SacI sites of plasmid pgh9- (Fig. 1a). The resulting plasmid was designated pgh9-::amya. Disrtion and substitution of gene of L. plantarum. Disrtion and substitution of the gene of L. plantarum NCIMB 8826 were carried out using pg host plasmid-based double-crossover homologous integration as described by Biswas et al. (1). pgh9- was introduced into L. plantarum NCIMB 8826 by electroporation, as described previously (15), and then, utilizing the thermosensitivity of the pg host9 plasmid, and ::amya mutants were obtained according to the scheme illustrated in Fig. 1a. L. plantarum possessing pgh9- was cultivated at 42 C under selective conditions by addition of antibiotics, and the first recombination event (integration) occurred through the region, after which pgh9- was integrated into the L. plantarum chromosome. Integrants were cultivated at 28 C under nonselective conditions, and the second recombination event (excision) occurred. mutants were obtained as the strain underwent gene excision through the region, as excision through the region restored the parental chromosome structure. substitution with the amya-secreting expression cassette was carried out by the same procedure, using plasmid pgh9-::amya. Deletion and substitution of the gene were confirmed by PCR using primers -_seq and -_seq, which are forward and reverse primers and anneal the stream region (bp 477 to 500) and stream region (bp 467 to 500) of, respectively. pcus A (16) was then introduced into both the L. plantarum NCIMB 8826 wild-type (WT) strain and the strain for secretion of AmyA. The resulting transformants were designated WT/pCUS A and /pcus A, respectively. Fermentation experiments using a 2.0-liter bioreactor. All fermentation experiments were performed in a 2.0-liter bioreactor (Able & Biott, Tokyo, Japan) with a 700-ml working volume. The fermentor, containing liquid modified MRS medium (MRS without glucose, beef extract, sodium acetate, and Tween 80), was heat sterilized (121 C, 15 min). Next, heat-sterilized glucose solution or nonsterilized raw corn starch (Wako Pure Chemical Industries, Ltd., Osaka, Japan) was added to the fermentor (to a final concentration of 100 g/liter). Erythromycin (in the case of fermentation using the WT/pCUS A and / pcus A strains) or cycloheximide (in the case of fermentation using the ::amya strain) was then added to a final concentration of 25 or 10 g/ml, respectively. Subsequently, 10 M H 2 SO 4 was added to the medium to adjust the ph to 5.5, and 7 ml of inoculum (adjusted to an optical density at 600 nm [OD 600 ] of 10 with sterile distilled water) was added to the fermentor. Prior to this addition, the inoculum was grown in MRS medium and subcultured at regular intervals (12 h) to stabilize the growth rate. The temperature was maintained at 37 C, the agitation speed was kept at 100 rpm, and the ph was kept at approximately 5.5 ( 0.03) by the automatic addition of 10 M NH 3 solution. After incubation, the culture was regularly harvested and subjected to analysis. Growth of L. plantarum NCIMB 8826 cells was monitored by measuring the OD 600 or counting viable cells by the pour plate method, using bromocresol purple plate count agar (Nissui Pharmaceutical Co., Tokyo, Japan). The glucose concentration was measured using the Glucose CII test (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Total sugar concentrations of raw corn starch were determined by colorimetric assay based on the phenol-sulfuric acid reaction described by Dubois et al. (3) as the glucose equivalent. Lactic acid concentrations were measured by high-performance liquid chromatography, as described previously (15). The optical purity of produced lactic acid was measured using a BF-5 biosensor (Oji Scientific Instruments, Hyogo, Japan). For the detection of L-lactic acid, an L-lactic acid enzyme electrode was used, and for the detection of D-lactic acid, a D-lactic acid enzyme electrode and D-lactic acid kits were used in accordance with the manufacturer s instructions. The optical purity of lactic acid is defined as follows: optical purity (%) D-lactic acid concentration L-lactic acid concentration /(D-lactic acid concentration L-lactic acid concentration) Amylase activity in the culture sernatant was measured as described previously (16), using an -amylase measurement kit (Kikkoman Co., Chiba, Japan).

3 464 OKANO ET AL. APPL. ENVIRON. MICROBIOL. (a) (b) BglII Em r P-clpCUTLS S.S. RESULTS pgh9- Ts ori 5,715 bp Em r Integration through region Construction of -deficient and substitution strains. Construction of L. plantarum mutants having the gene disrted or replaced with an amya-secreting expression cassette was carried out (Fig. 1a). On agarose gel electrophoresis, the -deficient strain showed a smaller band due to lack of the gene, while the substitution strain showed a larger band (Fig. 1c) than that of the WT strain. These shifts corresponded with the expected changes Emr Through region BglII, SacI Wild type Ts ori Excision Gene deletion Through region (c) kbp Rep M pcusαa 6,265 bp SacI Tcbh amya-cassette FIG. 1. (a) Strategy of double-crossover deletion and substitution utilizing thermosensitivity of pg host plasmids. Ts ori, temperaturesensitive replication origin; Em r, erythromycin resistance gene;, 1,000-bp stream region of gene;, 1,000-bp stream region of gene. (b) Schematic illustration of -amylase secretion plasmid. P-clpCUTLS, clpc UTLS promoter; S.S., signal sequence of amya gene; Tcbh, terminator of cbh gene; Rep, replication origin; Em r, erythromycin resistance gene. The amya-secreting expression cassette is obtained by digestion with BglII and SacI. (c) Agarose gel electrophoresis after gene deletion and integration and schematic illustration of amplified regions by PCR. Lanes and/or illustrations: M, marker DNA with base pairs indicated; 1, WT; 2, strain; 3, ::amya strain. 1 2 amya ( 963 and 1,621 bp, respectively). These results confirmed the deletion or replacement of the gene. Further confirmation was carried out by DNA sequencing analyses (data not shown). Lactic acid fermentation from glucose by WT/pCUS A and /pcus A strains. In order to confirm the effects of gene deletion on fermentative performance and heterologous protein production, lactic acid fermentation from glucose was carried out using the WT/pCUS A and /pcus A FIG. 2. Lactic acid fermentation from glucose by L. plantarum NCIMB 8826 WT (closed symbols) and (open symbols) strains harboring pcus A. (a) OD 600 of culture (triangles) and -amylase activity in culture sernatant (diamonds). (b) Glucose (squares) and lactic acid (circles) concentrations. Data points represent means and standard deviations for three independent experiments.

4 VOL. 75, 2009 D-LACTIC ACID PRODUCTION FROM RAW CORN STARCH 465 TABLE 2. Various parameters in lactic acid fermentation a Parameter Glucose fermentation Starch fermentation WT/pCUS A /pcus A WT/pCUS A /pcus A ::amya strain Max volumetric productivity (g/liter/h) Yield (g lactic acid produced per g of total sugar consumed) Optical purity of produced lactic acid (%) a The values represent means standard deviations for three independent experiments. strains. Although one of the two LDHs was disrted in the -deficient strain, similar cell growth (Fig. 2a), glucose consumption, and lactic acid production (Fig. 2b) were observed in both WT/pCUS A and /pcus A. Production of AmyA was confirmed by Western blotting for both strains (data not shown). In /pcus A, a slightly higher maximum -amylase activity (0.672 U/ml) than that of WT/ pcus A (0.505 U/ml) was observed (Fig. 2a). After 36 h of fermentation, both strains consumed all sugar and produced 86.0 and 86.6 g/liter of lactic acid, respectively. These results suggest that deletion of the gene has little effect on fermentative performance and that the -deficient mutant is capable of producing heterologous protein similarly to the WT strain. We then analyzed the optical purity of the produced lactic acid. The lactic acid produced by WT/pCUS A consisted of approximately the same amounts of both isomers, and the optical purity of the produced lactic acid was 12.6% (Table 2). In contrast, the lactic acid produced by /pcus A consisted mainly of D-lactic acid, and the optical purity was very high, at 99.7% (Table 2). Lactic acid fermentation from raw corn starch, using the WT/pCUS A and /pcus A strains. Encouraged by these findings, we carried out lactic acid fermentation from raw corn starch, using the WT/pCUS A and /pcus A strains. As shown in Fig. 3a, both WT/pCUS A and / pcus A showed similar -amylase activities in culture sernatants, and these activities reached and U/ml, respectively, at 18 h of incubation. With the aid of -amylase activity, both strains were able to grow in raw starch as the sole carbon source (Fig. 3a), while the corresponding plasmid-free strains could not (data not shown). After 18 h of fermentation, viable cell counts reached and CFU/ml, respectively. After 48 h of fermentation, WT/pCUS A and /pcus A consumed 87.1 and 86.2 g/liter sugar and produced 72.6 and 73.2 g/liter lactic acid, respectively (Fig. 3b). In addition, the optical purity of lactic acid produced by /pcus A had an extremely high value (99.6%), while that produced by WT/pCUS A had a low value (4.0%) (Table 2). These results confirm direct and efficient D-lactic acid fermentation from raw corn starch by /pcus A. Lactic acid fermentation from raw corn starch by ::amya strain. In order to conduct stable expression of amya without selective pressure by antibiotics to maintain the plasmid, chromosomal replacement with an amya-secreting expression cassette was carried out. Using the ::amya strain, fermentation from raw corn starch was then performed. As shown in Fig. 4a, the integrated amya gene was successfully expressed and exhibited its activity. The maximum -amylase activity of ::amya was U/ml (Fig. 4a). The ::amya strain was also able to grow using raw starch as the sole carbon source (Fig. 4a and b) and efficiently produced lactic acid (Fig. 4b). After 72 h of fermentation, the ::amya strain consumed 72.2 g/liter sugar and produced 61.9 g/liter lactic acid. In addition, the optical purity of the produced lactic acid had a high value (99.2%) (Table 2). These results confirm the successful D-lactic acid fermentation from raw corn starch by the ::amya strain under cost-efficient, nonselective conditions. FIG. 3. Lactic acid fermentation from raw corn starch by L. plantarum NCIMB 8826 WT (closed symbols) and (open symbols) strains harboring pcus A. (a) Viable cell counts in culture (triangles) and -amylase activity in culture sernatant (diamonds). (b) Total sugar (squares) and lactic acid (circles) concentrations. Data points represent means and standard deviations for three independent experiments. FIG. 4. Lactic acid fermentation from raw corn starch by L. plantarum NCIMB 8826 ::amya strain. (a) Viable cell counts in culture (closed triangles) and -amylase activity in culture sernatant (open diamonds). (b) Total sugar (closed squares) and lactic acid (open circles) concentrations. Data points represent means and standard deviations for three independent experiments.

5 466 OKANO ET AL. APPL. ENVIRON. MICROBIOL. DISCUSSION The aim of this study was to achieve the direct fermentation of optically pure D-lactic acid from biomass resources in order to reduce the production costs of PLA. We initially investigated the construction of D-lactic acid-producing LAB from gene manipulation-facilitated D,L-lactic acid-producing strains, as gene manipulation of D-lactic acid-producing LAB is known to be difficult (22). Ferain et al. (4) reported that chromosomal deletion of the gene of L. plantarum has little effect on fermentative kinetics and that the strain exclusively produces D-lactic acid with 20 g/liter glucose as a carbon source. These features prompted us to use L. plantarum as a host strain. However, the mass production of lactic acid from high-concentration substrate or biomass resources, including starchy materials, and heterologous protein expression using the strain have not been attempted. Therefore, we attempted fermentation from high-concentration glucose (100 g/liter) and the expression of amya. As shown in Fig. 2, disrtion of had little effect on fermentative kinetics and /pcus A exclusively produced D-lactic acid (99.7% optical purity) (Table 2), even with high concentrations of glucose. Moreover, with expression of amya (Fig. 2b), /pcus A showed a higher maximum -amylase activity (0.672 U/ml) than that of WT/pCUS A (0.505 U/ml). It has been reported that LDH is a strongly expressed protein in lactobacilli such as Lactobacillus casei and Lactobacillus helveticus (17, 21). One possible explanation is that in the L. plantarum strain, the absence of strongly expressed L-LDH provokes the increased expression of other proteins. Therefore, the strain is considered to be a useful host for heterologous protein production, the same as the WT strain. Subsequently, lactic acid fermentation from raw corn starch was carried out. As with fermentation from glucose, / pcus A exclusively produced D-lactic acid (99.6% optical purity) (Table 2). Despite a low initial fermentation rate compared to that of glucose fermentation, which was attributed to the initial degradation of starch, the maximum volumetric productivity of lactic acid in starch fermentation (3.86 g/liter/h) was comparable to that in glucose fermentation (4.54 g/liter/h) by /pcus A (Table 2). The yields of lactic acid (g of lactic acid per g of consumed sugar) were also approximately the same between starch (0.85) and glucose (0.89) fermentation by /pcus A (Table 2). These values are comparable to those in previous reports describing direct L-lactic acid fermentation or a mixture of L- and D-lactic acid fermentation from raw starch, using wild ALAB, S. bovis 148 (0.88) (13), and L. plantarum A6 (0.84) (6). Based on these results, direct and efficient D-lactic acid fermentation from starch was successful. The L. plantarum strain we developed is an attractive host for D-lactic acid production from biomass resources, such as not only starchy materials but also cellulosic or hemicellulosic materials, in the future. In an effort to test industrial applications, a strain with the gene replaced with the amya-secreting expression cassette was constructed. Since this ::amya strain does not require selective culture with antibiotics to retain the plasmid and possesses amya in the chromosome, it is considered to be advantageous with regard to both cost and genetic stability compared to /pcus A. As shown in Fig. 4, successful D-lactic acid fermentation was achieved using the ::amya strain, with a high yield (0.86 g per g of consumed sugar) and high optical purity (99.2%) (Table 2). However, the maximum volumetric productivity was lower (2.06 g/liter/h) (Table 2) than that of /pcus A (3.86 g/liter/h), and this may be due to low -amylase activity (14-fold lower than that of /pcus A). An increase of the chromosomal copy number of amya and an improved expression system will improve the -amylase activity and increase lactic acid productivity. We also confirmed by Western blotting that no degradation of AmyA was present after 36 h, which suggests that the decreased -amylase activity was caused by inactivation of AmyA. Unfortunately, the cause of this inactivation of AmyA is uncertain, but stabilization of AmyA is a promising method for improving lactic acid productivity. In conclusion, our results successfully demonstrated the direct and efficient fermentation of optically pure D-lactic acid from raw corn starch by -deficient AmyA-secreting L. plantarum. The results obtained in this study strongly indicate that L. plantarum -deficient and substitution strains are useful as hosts for D-lactic acid production from biomass resources. ACKNOWLEDGMENTS We are grateful to Emmanuelle Maguin for splying the E. coli VE7108 and VE6838 (VE7108 containing the pg host9 plasmid) strains. This work was sported in part by the New Energy and Industrial Technology Development Organization (NEDO), by a grant-in-aid for JSPS Fellows ( ), Tokyo, and by Special Coordination Funds for Promoting Science and Technology, Creation of Innovation Centers for Advanced Interdisciplinary Research Areas (Innovative Bioproduction Kobe), MEXT, Japan. REFERENCES 1. Biswas, I., A. Gruss, S. D. Ehrlich, and E. Maguin High-efficiency gene inactivation and replacement system for gram-positive bacteria. J. Bacteriol. 175: Christiaens, H., R. J. Leer, P. H. Pouwels, and W. Verstraete Cloning and expression of a conjugated bile acid hydrolase gene from Lactobacillus plantarum by using a direct plate assay. Appl. Environ. Microbiol. 58: Dubois, M., K. A. Gilles, J. K. Hamilton, P. A. Rebers, and F. Smith Colorimetric method for determination of sugars and related substances. Anal. Chem. 28: Ferain, T., D. Garmyn, N. Bernard, P. Hols, and J. Delcour Lactobacillus plantarum ldhl gene: overexpression and deletion. J. Bacteriol. 176: Fukushima, K., K. Sogo, S. Miura, and Y. Kimura Production of D-lactic acid by bacterial fermentation of rice starch. Macromol. Biosci. 4: Giraud, E., A. Champailler, and M. Raimbault Degradation of raw starch by a wild amylolytic strain of Lactobacillus plantarum. Appl. Environ. Microbiol. 60: Hofvendahl, K., and B. Hahn-Hägerdal Factors affecting the fermentative lactic acid production from renewable resources. Enzyme Microb. Technol. 26: Ikada, Y., K. Jamshidi, H. Tsuji, and S.-H. Hyon Stereocomplex formation between enantiomeric poly(lactides). Macromolecules 20: Kleerebezem, M., J. Boekhorst, R. van Kranenburg, D. Molenaar, O. P. Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. E. J. Fiers, W. Stiekema, R. M. K. Lankhorst, P. A. Bron, S. M. Hoffer, M. N. N. Groot, R. Kerkhoven, M. de Vries, B. Ursing, W. M. de Vos, and R. J. Siezen Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA 100: Maguin, E., H. Prévost, S. D. Ehrlich, and A. Gruss Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178: Matsui, Y., S. Okada, T. Uchimura, A. Kondo, and E. Satoh Deter-

6 VOL. 75, 2009 D-LACTIC ACID PRODUCTION FROM RAW CORN STARCH 467 mination and analysis of the starch binding domain of Streptococcus bovis 148 raw-starch-hydrolyzing -amylase. J. Appl. Glycosci. 54: Mora, D., E. Maguin, M. Masiero, C. Parini, G. Ricci, P. L. Manachini, and D. Daffonchio Characterization of urease genes cluster of Streptococcus thermophilus. J. Appl. Microbiol. 96: Narita, J., S. Nakahara, H. Fukuda, and A. Kondo Efficient production of L-( )-lactic acid from raw starch by Streptococcus bovis 148. J. Biosci. Bioeng. 97: Narita, J., S. Ishida, K. Okano, S. Kimura, H. Fukuda, and A. Kondo Improvement of protein production in lactic acid bacteria using 5 -untranslated leader sequence of slpa from Lactobacillus acidophilus. Appl. Microbiol. Biotechnol. 73: Narita, J., K. Okano, T. Kitao, S. Ishida, T. Sewaki, M.-H. Sung, H. Fukuda, and A. Kondo Display of -amylase on the surface of Lactobacillus casei cells by use of the PgsA anchor protein, and production of lactic acid from starch. Appl. Environ. Microbiol. 72: Okano, K., S. Kimura, J. Narita, H. Fukuda, and A. Kondo Improvement in lactic acid production from starch using -amylase-secreting Lactococcus lactis cells adapted to maltose or starch. Appl. Microbiol. Biotechnol. 75: Oozeer, R., J. P. Furet, N. Goil-Feuillerat, J. Anba, J. Mengaud, and G. Corthier Differential activities of four Lactobacillus casei promoters during bacterial transit through gastrointestinal tracts of human-microbiotaassociated mice. Appl. Environ. Microbiol. 71: Pavan, S., P. Hols, J. Delcour, M.-C. Geoffroy, C. Grangette, M. Kleerebezem, and A. Mercenier Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Appl. Environ. Microbiol. 66: Rud, I., P. R. Jensen, K. Naterstad, and L. Axelsson A synthetic promoter library for constitutive gene expression in Lactobacillus plantarum. Microbiology 152: Satoh, E., Y. Niimura, T. Uchimura, M. Kozaki, and K. Komagata Molecular cloning and expression of two -amylase genes from Streptococcus bovis 148 in Escherichia coli. Appl. Environ. Microbiol. 59: Savijoki, K., and A. Palva Molecular genetic characterization of the L-lactate dehydrogenase gene (ldhl) of Lactobacillus helveticus and biochemical characterization of the enzyme. Appl. Environ. Microbiol. 63: Serror, P., T. Sasaki, S. D. Ehrlich, and E. Maguin Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with various plasmids. Appl. Environ. Microbiol. 68: Yáñez, R., A. B. Moldes, J. L. Alonso, and J. C. Parajó Production of D( )-lactic acid from cellulose by simultaneous saccharification and fermentation using Lactobacillus coryniformis subsp. torquens. Biotechnol. Lett. 25: Yumoto, I., and K. Ikeda Direct fermentation of starch to L-( )-lactic acid using Lactobacillus amylophilus. Biotechnol. Lett. 17: Zhang, D. X., and M. Cheryan Direct fermentation of starch to lactic acid by Lactobacillus amylovorus. Biotechnol. Lett. 13: Downloaded from on October 17, 2018 by guest