Access Array System for the Ion Torrent PGM Sequencing System

Transcription

1 PN E2 Access Array System for the Ion Torrent PGM Sequencing System USER GUIDE For Use Only with Access Array Reagents

2 For Research Use Only. Not for use in diagnostic procedures. Information in this publication is subject to change without notice. It is Fluidigm policy to improve products as new techniques and components become available. Therefore, Fluidigm reserves the right to change specifications at any time. Every effort has been made to avoid errors in the text, diagrams, illustrations, figures, and screen captures. However, Fluidigm assumes no responsibility for any errors or omissions. In no event shall Fluidigm be liable for any damages in connection with or arising from the use of this publication. Patent and Limited License Information Fluidigm products are covered by issued and pending patents in the United States and other countries. Patent and limited license information is available at fluidigm.com/legalnotices. Limited Use License to Perform Preamplification with Fluidigm IFCs A license to use Thermo Fisher Scientific's patented preamplification method workflows involving a Fluidigm integrated fluidic circuit (IFC) can be obtained (i) with purchase of a Fluidigm IFC from Fluidigm Corporation or (ii) by a separate license from Thermo Fisher Scientific. For licensing information, contact outlicensing@lifetech.com. Limited Digital PCR License A license to use Thermo Fisher Scientific's patented digital PCR method in all fields other than in the Sequencing Field, the Mass Spectrometry Field, and the Prenatal Field in workflows involving a Fluidigm IFC can be obtained (i) with purchase of a Fluidigm IFC from Fluidigm Corporation or (ii) by a separate license from Thermo Fisher Scientific. For licensing information, contact outlicensing@lifetech.com. Trademarks Fluidigm, the Fluidigm logo, Access Array, Advanta, D3, and FC1 are trademarks or registered trademarks of Fluidigm Corporation in the United States and/or other countries. All other trademarks are the sole property of their respective owners. For EU's WEEE directive information, go to fluidigm.com/ compliance Fluidigm Corporation. All rights reserved. 06/2018 For technical support visit fluidigm.com/support. North America Toll-free (US/CAN): techsupport@fluidigm.com Latin America techsupportlatam@fluidigm.com Europe/Middle East/Africa/Russia techsupporteurope@fluidigm.com Japan techsupportjapan@fluidigm.com China (excluding Hong Kong) techsupportchina@fluidigm.com All other Asian countries/india/australia techsupportasia@fluidigm.com 2

3 Contents About This Guide 5 Safety Alert Conventions 5 Safety Data Sheets 6 Chapter 1: Access Array System Overview 7 Access Array System Components 10 Access Array IFCs 11 Specifications 11 Access Array System Workflow 12 Materials 12 Required Reagents 12 Required Consumables 13 Required Equipment 14 Example Sample and Primer Layout in 96-Well Plates 14 Before You Begin 15 Chapter 2: Designing Targeted Sequencing Primers 16 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC 17 Reference Documents 17 Materials 17 Required Reagents 17 Prepare Primer Validation Reactions 18 Set Up the PCR Reactions in a 384-Well PCR Plate 20 Run the PCR Reactions 20 Check PCR Products on the Agilent 2100 Bioanalyzer 21 Chapter 4: Sample Quantitation and Normalization 22 Reference Documents 22 Materials 22 Required Reagents 22 Required Equipment 22 Sample Quantitation 23 Sample Normalization 23 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC 24 Reference Documents 25 Materials 25 Required Reagents 25 Prime the IFC 26 Prepare the 20X Primer Solutions 28 Prepare Sample Pre-Mix and Samples 29 Prepare the Sample Pre-Mix Solution 29 Prepare the Sample Mix Solutions 29 Load the IFC 30 Thermal-Cycle the IFC 31 Harvest the IFC 31 Attach Sequence Tags and Sample Barcodes 33 Prepare the Sample Pre-Mix Solution 33 Prepare a 100-Fold Dilution of the Harvested PCR Products 33 Prepare the Sample Mix Solutions 33 Thermal-Cycle the 96-Well PCR Plate 34 Check PCR Products on the Agilent 2100 Bioanalyzer 35 Next Step 35 Chapter 6: Post-PCR Amplicon Purification and Quantitation 36 Reference Documents 36 Materials 36 Required Equipment 36 Required Reagents 36 Quantitate PCR Products 37 Purify Harvested PCR Products 37 PCR Product Library Quantitation Procedure 38 Agilent 2100 Bioanalyzer Quantification 38 PicoGreen Fluorimetry Quantification 39 Pool the Products from Multiple Access Array IFCs 39 3

4 Contents Appendix A: Electropherogram Examples 41 Appendix B: Access Array Barcode Library for the Ion Torrent PGM Sequencer Appendix C: Related Documents 47 Appendix D: Safety 48 General Safety 48 Instrument Safety 48 Symbols on the Instrument 49 Electrical Safety 50 Chemical Safety 50 4

5 About This Guide IMPORTANT Before using the instrument, read and understand the safety guidelines in this document. Failure to follow these guidelines may result in undesirable effects, injury to personnel, and/or damage to the instrument or to property. This guide is for preparing sequencing libraries with Access Array reagents. To prepare targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the Advanta NGS Library Preparation with Access Array Protocol (PN ). Safety Alert Conventions Fluidigm documentation uses specific conventions for presenting information that may require your attention. Refer to the following safety alert conventions. Safety Alerts for Chemicals For hazards associated with chemicals, this document follows the United Nations Globally Harmonized System of Classification and Labelling of Chemicals (GHS) and uses indicators that include a pictogram and a signal word that indicates the severity level: Indicator DANGER WARNING Description Pictogram (see example) consisting of a symbol on a white background within a red diamond-shaped frame. Refer to the individual safety data sheet (SDS) for the applicable pictograms and hazards pertaining to the chemicals being used. Signal word that indicates more severe hazards. Signal word that indicates less severe hazards. Safety Alerts for Instruments For hazards associated with instruments, this document uses indicators that include a pictogram and signal words that indicate the severity level: Indicator DANGER WARNING CAUTION IMPORTANT Description Pictogram (see example) consisting of a symbol on a white background within a black triangle-shaped frame. Refer to the instrument user guide for the applicable pictograms and hazards pertaining to instrument usage. Signal word that indicates an imminent hazard that will result in severe injury or death if not avoided. Signal word that indicates a potentially hazardous situation that could result in serious injury or death if not avoided. Signal word that indicates a potentially hazardous situation that could result in minor or moderate personal injury if not avoided. Signal word that indicates information necessary for proper use of products or successful outcome of experiments. 5

6 About This Guide Safety Data Sheets Read and understand the SDSs before handling chemicals. To obtain SDSs for chemicals ordered from Fluidigm, either alone or as part of this system, go to fluidigm.com/sds and search for the SDS using either the product name or the part number. Some chemicals referred to in this user guide may not have been provided with your system. Obtain the SDSs for chemicals provided by other manufacturers from those manufacturers. 6

7 Chapter 1: Access Array System Overview Amplicon tagging on the Access Array system significantly reduces the time required for enrichment of targeted sequences by combining amplicon generation with library preparation. The Access Array system workflow consists of five major phases: 1) designing and validating target-specific primers for targeted resequencing, 2) quantifying samples, 3) running an integrated fluidic circuit (IFC, either the LP IFC or the Access Array IFC), 4) attaching sequence tags and sample barcodes, and 5) qualifying and quantifying harvested PCR products for sequencing. The chapters in this user guide detail this workflow chronologically: Design PCR primers and add tags Qualify tagged primer sets Select best tagged primer sets Quantify samples Normalize sample concentrations Load samples and primers on Access Array IFC PCR amplify for 35 cycles Recover PCR products from Access Array IFC Attach sequence tags and sample barcodes Qualify/quantify PCR products Select and pool samples Clean up PCR product pool Quantify PCR product pool for emulsion PCR This Access Array target-specific PCR amplification scheme combines 48 target-specific (TS) forward and reverse primers with 48 samples to generate 2,304 PCR reactions. 7

8 Chapter 1: Access Array System Overview The following image shows a 3 x 3 grid of reaction wells containing the target-specific primers and samples before reagents are loaded into the LP IFC for library preparation prior to sequencing on the Ion Torrent PGM Sequencer - 96: First, TS forward and reverse primers are loaded into each column of the reaction wells on the LP IFC. 8

9 Chapter 1: Access Array System Overview Samples are then loaded into each row of reaction wells on the LP IFC: After loading the IFC, each reaction well contains a unique combination of TS primer pairs and samples: 9

10 Chapter 1: Access Array System Overview Access Array System Components The resulting PCR products of pooled amplicons are as follows: Access Array System Components The Access Array system consists of the following components: IFCs for Access Array: LP IFC Access Array IFC IFC Controller AX (2 quantity, for pre-pcr and post-pcr) FC1 cycler IFC Controller AX Pre-PCR FC1 cycler IFC Controller AX Post-PCR NOTE The stand-alone thermal cycler has been discontinued. It has been replaced by the FC1 cycler. 10

11 Chapter 1: Access Array System Overview Access Array IFCs Access Array IFCs Access Array reagents can be run on the: LP IFC (PN ) Access Array IFC (PN AA-M-48.48) Primer inlets Sample inlets H1 well H2 well Interface accumulator A1 Containment accumulator H3 well H4 well Control Line Fluid The high-throughput LP IFC (or Access Array IFC) enables target enrichment of 48 unique samples at the same time. Specifications Description Footprint dimensions Inlet spacing on input frame Parameter 128 x 85 x 14 mm 4.5 mm pitch Primer inlets 48 Sample inlets 48 Reaction chambers 2,304 Reaction volume Instrument compatibility 35 nl IFC Controller AX, FC1 cycler, and stand-alone thermal cycler 11

12 Chapter 1: Access Array System Overview Access Array System Workflow Access Array System Workflow The simplicity of running experiments is illustrated in the process below. The Access Array system workflow consists of five major steps: Workflow Step 1 Dispense Transfer samples and primers to the inlets on the LP IFC (or Access Array IFC) from a standard 96-well plate, using an 8-channel pipette. 2 Load Reaction mixtures are automatically loaded and assembled on the IFC using the pre-pcr IFC Controller AX. 3 Thermal-cycle Perform PCR amplification using the FC1 cycler. 4 Harvest PCR products from each sample are automatically pooled and harvested using the post-pcr IFC Controller AX. 5 Recover Recover the PCR products from each of the 48 sample inlets, using an 8-channel pipette. Quantify the sequencing library. Materials This section describes the materials required to perform an Access Array experiment including the supported reagents and consumables. Required Reagents IMPORTANT This guide is for preparing sequencing libraries with Access Array reagents. To prepare targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the Advanta NGS Library Preparation with Access Array Protocol (PN ). Store reagents according to manufacturer's storage recommendations as soon as they are received. 12

13 Chapter 1: Access Array System Overview Materials Reagents Supplied by Fluidigm Product Name Manufacturer Part Number Storage 20X Access Array Loading Reagent Fluidigm X Access Array Harvest Solution 1X Access Array Harvest Solution is not packaged for individual sale. It can be purchased in units of 10, under the name Access Array Harvest Pack, PN , or as a component in the Access Array Loading Reagent Kit, PN Access Array Hydration Reagent v2 IMPORTANT This reagent is only required when using the Access Array IFC, and it is not for use with the LP IFC. Access Array Barcode Library for Ion Torrent PGM Sequencer - 96 Fluidigm Fluidigm Fluidigm C Reagents from Other Suppliers Product Name Manufacturer Part Number FastStart High Fidelity PCR System, dntpack Sigma-Aldrich Agilent DNA 1000 Kit Agilent PCR Certified Water Teknova W3330 DNA Suspension Buffer (10 mm TRIS, ph 8.0, 0.1mM EDTA) Teknova T0221 Agencourt AMPure XP Reagent Beads Beckman Coulter A % ethanol Major laboratory supplier (MLS) Required Consumables Consumables Supplied by Fluidigm Product Name Manufacturer Part Number Storage LP IFC or Access Array IFC NOTE The Access Array IFC has been discontinued. It has been replaced by the LP IFC. LP Control Line Fluid or Control Line Fluid for IFCs Fluidigm AA-M Fluidigm Room temperature 13

14 Chapter 1: Access Array System Overview Example Sample and Primer Layout in 96-Well Plates Consumables from Other Suppliers Product Name Manufacturer Part Number Microcentrifuge tubes, 1.5 ml MLS 96- and 384-well PCR plates MLS Adhesive seals for PCR plates MLS P2-P1000 pipette tips Rainin Required Equipment Equipment Supplied by Fluidigm Product Name Manufacturer Part Number IFC Controller AX (2 quantity, pre-pcr and post-pcr) Fluidigm IFC-AX FC1 cycler NOTE The stand-alone thermal cycler has been discontinued. It has been replaced by the FC1 cycler. Fluidigm CYC-FC1 Equipment from Other Suppliers Product Name Manufacturer Part Number DynaMag -2 Magnet Thermo Fisher Scientific D Agilent 2100 Bioanalyzer Agilent G2939BA Microcentrifuge MLS Vortex mixer MLS Plate centrifuge MLS 96- and 384-well PCR thermal cycler MLS Single-channel P2-P1000 pipettes Rainin 8-channel P20 pipette Rainin Example Sample and Primer Layout in 96-Well Plates For ease of pipetting, fill the 96-well plates by columns, not rows. 14

15 Chapter 1: Access Array System Overview Before You Begin Before You Begin IMPORTANT Before using the Access Array system, read and understand the detailed instructions and safety guidelines in Appendix D. Use good laboratory practices to minimize contamination of samples: Use a new pipette tip for every new sample. Whenever possible, separate pre- and post-pcr activities. Dedicate laboratory materials to designated areas. Unless otherwise specified, thaw reagents at room temperature (15 30 C), and then use them at room temperature. Retrieve only the reagents required from each kit based on the number of IFCs you will run. Only use the reagents provided in the required kit. Do not swap reagents between kit lots. Mix and centrifuge reagents as directed. Avoid creating bubbles when transferring reagents to the IFC. This protocols in this document require the use of updated scripts for FC1 (v1.6 or later) and IFC Controller AX (v2.8 or later) that can be downloaded from fluidigm.com/software. 15

16 Chapter 2: Designing Targeted Sequencing Primers You can design your own Access Array target-specific primers using available online tools (for example, UCSC website at genome.ucsc.edu/cgi-bin/hggateway, Primer3 website at bioinfo.ut.ee/primer3/, and in silico PCR at genome.ucsc.edu/cgi-bin/ hgpcr?hgsid= ) or by using the D3 assay design service at Fluidigm. Our D3 assay design service provides Access Array target-specific primers for use in Illumina MiniSeq, MiSeq, NextSeq and HiSeq systems and in the Ion Torrent PGM system. They are designed to human genomic DNA. Uniplex primers are provided in nuclease-free water at a final volume of 100 μl per well in a single 96-well plate with mixed forward and reverse primers at a final concentration of 50 μm. Multiplex primer sets are provided in nuclease-free water at a final volume of 100 μl per well in six 96-well plates per set at a final concentration of 60 μm. If you are using primers provided by the D3 assay design service, refer to the order informatics packet for primer sequences. If you are designing your own primers, see Access Array Generate Tagged Primers Workbook (Fluidigm, PN ). This guide is for preparing sequencing libraries with Access Array reagents. To prepare targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the Advanta NGS Library Preparation with Access Array Protocol (PN ). 16

17 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC This chapter describes the validation procedure for the tagged TS primers designed in Chapter 2. IMPORTANT Access Array Barcode 1 primers for the Ion Torrent PGM Sequencer - 96 must be ordered prior to primer validation. See Table 1 for oligo sequences and order through an oligonucleotide vendor. Reference Documents Agilent DNA 1000 Kit Guide Materials Required Reagents IMPORTANT This guide is for preparing sequencing libraries with Access Array reagents. To prepare targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the Advanta NGS Library Preparation with Access Array Protocol (PN ). Store reagents according to manufacturer's storage recommendations as soon as they are received. Reagents Supplied by Fluidigm Product Name Manufacturer Part Number 20X Access Array Loading Reagent Fluidigm Access Array Barcode 1 primers for Ion Torrent with CS1/CS2 tags Fluidigm Target-specific primer pairs tagged with universal tags (CS1 forward tag, CS2 reverse tag) 50 μm CS1 tagged TS forward primer 50 μm CS2 tagged TS reverse primer Fluidigm 17

18 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC Prepare Primer Validation Reactions Reagents from Other Suppliers Product Name Manufacturer Part Number FastStart High Fidelity PCR System, dntpack Sigma-Aldrich Agilent DNA 1000 Kit Agilent PCR Certified Water Teknova W ng/μl genomic DNA (optional) Coriell NA17317 Prepare Primer Validation Reactions The primer validation protocol prepares enough reagents to perform 48 primer validation reactions. IMPORTANT It is essential to have Access Array Barcode 1 primers before proceeding with the primer validation. See Table 1 below for the oligo sequences. Table 1. Access Array Barcode 1 primers for Ion Torrent Name Sequence (5-3 ) Total Length A_BC1_CS1 forward primer P1_CS2 reverse primer CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTG CGTACACTGACGACATGGTTCTACA CCTCTCTATGGGCAGTCGGTGATTACGGTA GCAGAGACTTGGTCT 62 bp 45 bp 1 Prepare the 5X target-specific primer solution for 48 individual primer pairs as shown in the table below. Table 2. 5X target-specific primer solution preparation Component Volume (μl) Final Concentration* (nm) 50 μm CS1-tagged TS forward primer μm CS2-tagged TS reverse primer PCR Certified Water (Teknova) 198 Total 200 * The final concentration in this table refers to the amount of each listed component in 5 μl of the final primer solution. 2 Vortex the 5X target-specific primer solution for a minimum of 20 seconds and centrifuge for 30 seconds. NOTE The final tagged TS forward and reverse primer concentrations are 250 nm in the 5X primer solution. The final TS forward and reverse primer concentrations in the PCR reaction are 50 nm. 3 Prepare 2 μm Access Array Barcode 1 primer solution. 18

19 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC Prepare Primer Validation Reactions Table 3. The 2 μm Access Array Barcode 1 primers for Ion Torrent Component Volume (μl) Final Concentration (μm) 100 μm A_BC1_CS1 forward primer μm P1_CS2 reverse primer PCR Certified Water (Teknova) 96.0 Total Prepare the primer validation reaction components. IMPORTANT Warm the 20X Access Array Loading Reagent to room temperature before use. Table 4. 4-primer amplicon tagging primer validation reaction preparation Component Volume (μl) Volume for 60 (μl) Final Concentration* 10X FastStart High Fidelity Reaction Buffer without MgCl 2 (Roche ) X 25 mm MgCl 2 (Roche) mm DMSO (Roche) % 10 mm PCR Grade Nucleotide Mix (Roche) μm each 5 U/μL FastStart High Fidelity Enzyme Blend (Roche) 20X Access Array Loading Reagent (Fluidigm) 2 μm Access Array Barcode 1 primers for Ion Torrent (from step 3) 60 ng/μl genomic DNA (Coriell) U/μL X nm ng/μl PCR Certified Water (Teknova) Total * The final concentration in this reaction mix table refers to the amount of each listed component in 5 μl of the final reaction mix. 5 Vortex the primer validation reaction mix for a minimum of 20 seconds and centrifuge for 30 seconds. NOTE Table 4 displays the volumes required to prepare 48 reactions with a 25% overage to evaluate 48 target-specific primer pairs. Scale up appropriately if a higher number of primer pairs are to be evaluated. 19

20 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC Set Up the PCR Reactions in a 384-Well PCR Plate Set Up the PCR Reactions in a 384-Well PCR Plate 1 Prepare the primer validation PCR reactions: a b Add 4 μl of primer validation reaction mix to each of the 48 wells. Add 1 μl of the 5X target-specific primer solution. The total PCR reaction volume is 5 μl. 2 Vortex the 384-well PCR reaction plate for a minimum of 20 seconds and centrifuge for 30 seconds. Run the PCR Reactions 1 Load the 384-well plate onto the PCR thermal cycler. 2 Run 35 cycles of PCR using the protocol described below: Table 5. PCR protocol PCR Stages Cycle 50 ºC 2 min 1 70 ºC 20 min 1 95 ºC 10 min 1 95 ºC 15 sec 60 ºC 30 sec ºC 1 min 95 ºC 15 sec 80 ºC 30 sec 2 60 ºC 30 sec 72 ºC 1 min 95 ºC 15 sec 60 ºC 30 sec 72º 1 min 95 ºC 15 sec 80 ºC 30 sec 60 ºC 30 sec 72 ºC 1 min 95 ºC 15 sec 60 ºC 30 sec 72 ºC 1 min 95 ºC 15 sec 80 ºC 30 sec 60 ºC 30 sec 72 ºC 1 min

21 Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP IFC Check PCR Products on the Agilent 2100 Bioanalyzer Check PCR Products on the Agilent 2100 Bioanalyzer Use the Agilent DNA 1000 chips from the Agilent DNA 1000 Kit to check 1 μl of PCR product from each of the PCR reactions described above. Follow the Agilent DNA 1000 Kit Guide for details. On-target products should account for a minimum of 50% of the total yield (by mass) produced for a particular primer pair. If on-target products comprise <50% of total yield, primers may have to be redesigned. NOTE The product size should be the sum of the target region and the length of the Access Array Barcode 1 primers for Ion Torrent (103 bp). Figure 1. Example of 48 primer pairs checked on an Agilent chip. The red-labeled PCR reactions generated multiple or incorrectly sized primers, which need to be redesigned and validated before continuing. 21

22 Chapter 4: Sample Quantitation and Normalization This chapter provides a standard procedure to determine sample concentration using fluorimetry. Sample concentrations need to be normalized before proceeding with the LP IFC protocol for Access Array. The Quant-iT PicoGreen fluorescent assay requires 1 μl of sample DNA to determine sample concentration. Reference Documents Quant-iT PicoGreen User Guide Materials Required Reagents IMPORTANT Store reagents according to manufacturer's storage recommendations as soon as they are received. Product Name Manufacturer Part Number Quant-iT PicoGreen dsdna Assay Kit Thermo Fisher Scientific P11496 Required Equipment Product Name Manufacturer Part Number Fluorimeter-compatible 96- or 384-well microtiter plates Major laboratory supplier (MLS) 22

23 Chapter 4: Sample Quantitation and Normalization Sample Quantitation Sample Quantitation Quantitate the samples by fluorimetry, using the Quant-iT PicoGreen dsdna Assay Kit. Follow the manufacturer s instructions. Sample Normalization The following recommendations apply to human genomic DNA samples. For other samples, the recommendations on sample concentrations may be different. Contact Technical Support for assistance in this case. If the sample concentration is 50 ng/μl gdna input (a total of 50 ng gdna), the sample is ready for amplification on the LP IFC. For germline mutation, you might be able to use as little as 525ng/μL. If the sample concentration is below 50 ng/μl gdna, we recommend concentrating the sample before amplification takes place on the Access Array. If the sample concentration is above 50 ng/μl, we recommend diluting the sample to 50 ng/μl using DNA Suspension Buffer before proceeding. Use the following formula to determine the correct volume of DNA Suspension Buffer required to dilute each sample to 50 ng/μl: Y = X (B/50 1) Where X is the volume of the original sample (μl) to be used in the dilution Y is the DNA Suspension Buffer volume (μl) needed to dilute X μl of the original sample to 50 ng/μl B is the sample concentration (ng/μl) measured by fluorimetry 50 is the desired sample concentration (ng/μl) For example: If a 10 μl sample (X = 10 μl) has a concentration of 200 ng/μl (B = 200 ng/μl): Y = 10 μl * ((200 ng/μl)/(50 ng/μl) 1) Y = 30 μl Therefore: Dilute 10 μl of the 200 ng/μl sample in 30 μl of DNA Suspension Buffer to obtain a 50 ng/μl sample concentration. Normalize all sample concentrations to 50 ng/μl. Samples are now ready for amplification using the LP IFC. 23

24 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC This protocol outlines the bidirectional amplicon tagging strategy for the Ion Torrent PGM Sequencer - 96 for amplicon libraries that have been generated on the Access Array system. The goal of this protocol is to sequence both ends of an amplicon with a single-read sequencing run. In the bidirectional amplicon tagging approach, tagged target-specific primer pairs are combined with two sets of sample-specific barcode primer pairs. The sample-specific barcode primer pairs are comprised of common sequence tags CS1 or CS2, appended with the Ion Torrent adapter sequences (A and P1, Table 6). This approach requires only one set of target-specific primer pairs, while the sample-specific barcode primers are universal and can be used in multiple experiments. In the figure that follows, you can see that bidirectional amplicon tagging generates two types of PCR products per target region: one PCR product that allows for sequencing of the 5' end of the target region (Set A) and one PCR product that allows for sequencing of the 3' end of the target region (Set B). Because both PCR products are clonally amplified onto the Ion Sphere Particle (ISP) at the same time, one single-read sequencing run will yield sequence information for both ends of the target region. Bidirectional sequencing will produce high quality reads from both ends and across the full length of the amplicons. Table 6. PCR products generated from bidirectional amplicon tagging Primer A_BC_CS1 P1_CS2 A_BC_CS2 P1_CS1 Sequence 5'-CCATCTCATCCCTGCGTGTCTCCGACTCAG-[BC]-ACACTGACGACATGGTTCTACA-3' 5'-CCTCTCTATGGGCAGTCGGTGATTACGGTAGCAGAGACTTGGTCT-3' 5'-CCATCTCATCCCTGCGTGTCTCCGACTCAG-[BC]-TACGGTAGCAGAGACTTGGTCT-3' 5'-CCTCTCTATGGGCAGTCGGTGATACACTGACGACATGGTTCTACA-3' This strategy uses a two-step PCR approach: (1) The first PCR is run on the IFC in the presence of tagged, target-specific primers. (2) The harvested PCR product pools are then split into two subsequent PCR reactions with two sets of sample-specific barcode primers, Set A and Set B. Each is run on an independent 96-well plate. In Set A, the PCR reaction products that are generated allow for sequencing of the 5' end of the target region and utilize the A_BC_CS1 and P1_CS2 barcode primer combination. In Set B, the PCR reaction products that are generated allow for sequencing of the 3' end of the target region and utilize the A_BC_CS2 and P1_CS1 barcode primer combination. 24

25 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC Reference Documents Reference Documents IFC Controller AX User Guide (PN ) Control Line Fluid Loading Procedure Quick Reference (PN ) Agilent DNA 1000 Kit Guide Materials Required Reagents Stored at 20 ºC FastStart High Fidelity PCR System, dntpack (Sigma-Aldrich, PN ) 20X Access Array Loading Reagent (Fluidigm, PN ) 1X Access Array Harvest Solution (Fluidigm, PN ) NOTE 1X Access Array Harvest Solution (Fluidigm, PN ) is not packaged for individual sale. It can be purchased in units of 10, under the name Access Array Harvest Pack, PN , or as a component in the Access Array Loading Reagent Kit, PN

26 Chapter5:Bidirectional Amplicon Tagging on the LP IFC Prime the IFC 1X Access Array Hydration Reagent v2 (Fluidigm, PN ) IMPORTANT This reagent is not required, but it ensures uniform harvest volumes if used during the priming step when using the Access Array IFC. (It is not for use with the LP IFC.) Access Array Barcode Library for Ion Torrent PGM Sequencer - 96 (Fluidigm, PN ) Target-specific primer pair with universal tags (CS1 forward, CS2 reverse), supplied in separate forward and reverse primer pools in 96-well plates at the following stock concentrations: 50 μm CS1-tagged TS forward primer 50 μm CS2-tagged TS reverse primer Template DNA at 50ng/μL Stored at 4 ºC Agilent DNA 1000 Kit Reagents (Agilent, PN ) Stored at Room Temperature PCR Certified Water (Teknova, PN W3330) Prime the IFC Accumulators H1 H2 Sample inlets H3 H4 Primer inlets NOTE The location of the sample inlets is different from Gene Expression or Genotyping IFCs. 26

27 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC Prime the IFC IMPORTANT Use the LP IFC (or the Access Array IFC) within 24 hours of opening the package. Due to different accumulator volumes, use only syringes with 300 μl of control line fluid (PN ). Control line fluid on the IFC or in the inlets makes the IFC unusable. Load the IFC within 60 minutes of priming. Be certain that the reagents 1X Access Array Harvest Solution and 1X Access Array Hydration Reagent v2 are thawed completely to room temperature and mixed thoroughly prior to use. 1 Inject Control Line Fluid into each accumulator on the IFC. 2 Add 500 μl of 1X Access Array Harvest Solution (Fluidigm, PN ) into the H1 H4 wells on the IFC. CONTAINMENT ACCUMULATOR H1 H3 H2 H INTERFACE ACCUMULATOR SAMPLE INLETS PRIMER INLETS NOTE If you are working with the Access Array IFC, use 500 μl of 1X Access Array Hydration Reagent v2 (blue cap, Fluidigm, PN ) instead of 1X Access Array Harvest Solution in the H4 well. Hydration Reagent v2 ensures uniform harvest volumes when working with the Access Array IFC, but it is not needed when working with the LP IFC. 3 Remove and discard the blue protective film from the bottom of the AA IFC. 4 Load the IFC into the pre-pcr IFC Controller AX located in the pre-pcr lab. 5 Press Eject to move the tray out of the IFC Controller AX. 6 Place the IFC onto the tray by aligning the notched corner of the IFC to the A1 mark. 7 Press Load Chip to register the barcode of the IFC and activate the script selection. 8 Prime the LP IFC for Access Array. Select Prime (155x) and Run Script. NOTE For Access Array IFCs, select Prime (151x) and Run Script. 9 Once the script is complete, press Eject to remove the IFC. 27

28 Chapter5:Bidirectional Amplicon Tagging on the LP IFC Prepare the 20X Primer Solutions CONTAINMENT ACCUMULATOR H1 H3 H2 H INTERFACE ACCUMULATOR SAMPLE INLETS PRIMER INLETS Prepare the 20X Primer Solutions NOTE If you are using primers provided by the Fluidigm Assay Design Group, refer to the order informatics packet for correct primer concentrations. 1 Prepare the 20X primer solutions for 48 individual primer pairs as shown in the table below. These will be loaded into the primer inlets of an IFC. IMPORTANT Warm the 20X Access Array Loading Reagent to room temperature before use. Table 7. Example for ASY-AA product (Fluidigm): Dilution of target-specific primers Component Volume (μl) Final Concentration* 50 μm CS1-tagged TS forward primer/50 μm CS2-tagged TS reverse primer μm 20X Access Array Loading Reagent (Fluidigm) 5.0 1X PCR Certified Water (Teknova) 87.0 Total 100 * The final concentration in this table refers to the amount of each listed component in 5 μl of the final primer mix. 2 Vortex the 20X primer solutions for a minimum of 20 seconds and centrifuge for 30 seconds. NOTE The final tagged TS forward and reverse primer concentrations are 4 μm in the 20X primer solution. The final TS forward and reverse primer concentrations in the Access Array reaction chamber are 200 nm. 28

29 Prepare Sample Pre-Mix and Samples Chapter 5: Bidirectional Amplicon Tagging on the LP IFC All DNA samples need to be added into the sample pre-mix individually, prior to loading the sample mix solutions into the sample inlets of an IFC. Prepare Sample Pre-Mix and Samples Prepare the Sample Pre-Mix Solution 1 Working in a DNA-free hood, combine the components listed in the table below. This protocol prepares enough sample pre-mix for 60 reactions. This is enough reagent to load one IFC with 12 additional reactions to compensate for dead volume and pipetting error. Table 8. Sample pre-mix solution Component Volume (μl) Volume for 60 (μl) Final Concentration* 10X FastStart High Fidelity Reaction Buffer without MgCl 2 (Roche) X 25 mm MgCl 2 (Roche) mm DMSO (Roche) % 10 mm PCR Grade Nucleotide Mix (Roche) μm each 5 U/μL FastStart High Fidelity Enzyme Blend (Roche) 20X Access Array Loading Reagent (Fluidigm) U/μL X PCR Certified Water (Teknova) Total * The final concentration in this sample pre-mix table refers to the amount of each listed component in 5 μl of the final sample mix. 2 Vortex the sample pre-mix for a minimum of 20 seconds and centrifuge for 30 seconds. Prepare the Sample Mix Solutions 1 Combine the components listed below in a 96-well plate to prepare 48 individual sample mix solutions. Table 9. Sample mix solution Component Volume (μl) Final Concentration Sample pre-mix 4.0 genomic DNA (50 ng/μl) ng/μl Total

30 Chapter5:Bidirectional Amplicon Tagging on the LP IFC Load the IFC 2 Vortex the sample mix solution for a minimum of 20 seconds and centrifuge for 30 seconds. IMPORTANT It is essential to vortex all components to ensure complete mixing. Load the IFC 1 Pipet 4 μl of 20X primer solution into each of the primer inlets. 2 Pipet 4 μl of sample mix solution into each of the sample inlets. IMPORTANT While pipetting, do not go past the first stop on the pipette. Doing so may introduce air bubbles into the inlets. NOTE An 8-channel pipette is recommended to load the sample mix and 20X primer solutions. The recommended pipetting order is shown below. Step 1 Step 2 Step 3 Step 4 Step 5 Step Load the IFC into the pre-pcr IFC Controller AX in the pre-pcr lab. 4 Press Eject to move the tray out of the IFC Controller AX. 5 Place the IFC onto the tray by aligning the notched corner of the IFC to the A1 mark. 6 Press Load Chip to register the barcode of the IFC and activate the script selection. 7 Load the LP IFC for Access Array. Select Load Mix (155x) and Run Script. NOTE For Access Array IFCs, select Load Mix v7 (151x) and Run Script. Load Mix v7 (151x) is a script update from Load Mix (151x) for Access Array IFCs and can be downloaded from fluidigm.com/software. Contact Technical Support for assistance. 8 Once the script is complete, press Eject to remove the IFC. 30

31 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC Thermal-Cycle the IFC Thermal-Cycle the IFC IMPORTANT If you are using the Access Array reagents with the LP IFC, use only the AA 48x48 Standard v1 or AA48v1 thermal protocols specified in step 8. Do not use the LP- 48x48 protocol with Access Array reagents. Place the IFC onto the FC1 cycler and start PCR by selecting the protocol AA 48x48 Standard v1. Refer to the FC1 Cycler User Guide (PN ). For stand-alone thermal cycler, select protocol AA48v1. NOTE The protocol as programmed into the Fluidigm stand-alone thermal cycler takes undershooting and overshooting of target temperatures into consideration and is therefore not identical to the PCR protocol for the FC1 cycler. Contact Technical Support if you need assistance in programming your cycler. Harvest the IFC 1 After the PCR has finished, move the IFC into the Post-PCR lab for harvesting. 2 Remove the remaining fluids from the H1 H4 wells. 3 Pipet 600 μl of fresh 1X Access Array Harvest Solution into each of the H1 H4 wells. (Do not use Hydration Reagent v2 here.) NOTE If you are working with the LP IFC or the Access Array IFC, use 1X Access Array Harvest Solution in all four wells (H1-H4). 4 Pipet 2 μl of 1X Access Array Harvest Solution into each of the sample inlets on the IFC. 5 Load the IFC into the Post-PCR IFC Controller AX located in the Post-PCR lab. 6 Press Eject to move the tray out of the IFC Controller AX. 7 Place the IFC onto the tray by aligning the notched corner of the IFC to the A1 mark. 8 Press Load Chip to register the barcode of the IFC and activate the script selection. 9 Harvest the LP IFC for Access Array. Select Harvest (155x) and Run Script. NOTE For Access Array IFCs, select Harvest v7 (151x) and Run Script. Harvest v7 (151x) is a script update from Harvest v5 (151x) for Access Array IFCs and can be downloaded from fluidigm.com/software. Contact Technical Support for assistance. 10 Once the script is complete, press Eject to remove the IFC. 11 Label a 96-well plate with the IFC barcode. 12 Carefully transfer 10 μl of harvested PCR products from each of the sample inlets into columns 1 6 of a 96-well PCR plate, using an 8-channel pipette. IMPORTANT Transfer PCR products from the IFC to the 96-well plate in the same order as the IFC was loaded. 31

32 Chapter5:Bidirectional Amplicon Tagging on the LP IFC Harvest the IFC CONTAINMENT ACCUMULATOR H1 H3 H2 H INTERFACE ACCUMULATOR Sample inlets with harvested samples DO NOT USE The following image displays a map of the PCR products when transferred from the IFC to the 96-well plate: 32

33 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC Attach Sequence Tags and Sample Barcodes Attach Sequence Tags and Sample Barcodes NOTE All subsequent steps need to be carried out in a post-pcr lab to avoid contamination. Prepare the Sample Pre-Mix Solution 1 Working in a DNA-free hood, combine the components listed in the table below. This protocol prepares enough sample pre-mix for 120 reactions. This is enough reagent to amplify the 48 PCR product pools harvested from one IFC for Set A and Set B bidirectional barcoding with 24 additional reactions to compensate for dead volume and pipetting error. Table 10. Sample pre-mix solution Component Volume (μl) Volume for 120 (μl) Final Concentration* 10X FastStart High Fidelity Reaction Buffer without MgCl 2 (Roche) X 25 mm MgCl 2 (Roche) mm DMSO (Roche) % 10 mm PCR Grade Nucleotide Mix (Roche) μm each 5 U/μL FastStart High Fidelity Enzyme Blend (Roche) U/μL PCR Certified Water (Teknova) Total ,800.0 * The final concentration in this sample pre-mix table refers to the amount of each listed component in 5 μl of the final sample mix. 2 Vortex the sample pre-mix for a minimum of 20 seconds and centrifuge for 30 seconds. Prepare a 100-Fold Dilution of the Harvested PCR Products 1 In a 96-well plate pipet 99 μl PCR Certified Water into 48 wells. 2 Add 1 μl of PCR product from each sample harvested from the IFC to a separate well in the 96-well plate as described in the section Harvest the IFC on page Vortex the PCR product dilutions for a minimum of 20 seconds and centrifuge for 30 seconds. Prepare the Sample Mix Solutions 1 Combine the components listed below in two 96-well plates to prepare two sets of 48 individual sample mix solutions. 33

34 Chapter5:Bidirectional Amplicon Tagging on the LP IFC Attach Sequence Tags and Sample Barcodes Table 11. Sample mix solution - SET A Component Volume (μl) Sample pre-mix 15.0 Access Array Barcode Library for Ion Torrent PGM Sequencer Plate A1 4.0 Diluted Harvested PCR Product Pool 1.0 Total 20.0 Table 12. Sample mix solution - SET B Component Volume (μl) Sample pre-mix 15.0 Access Array Barcode Library for Ion Torrent PGM Sequencer Plate B1 4.0 Diluted Harvested PCR Product Pool 1.0 Total 20.0 IMPORTANT It is essential to vortex all components to ensure complete mixing. NOTE The final concentrations of the forward and reverse barcode primers are 400 nm per well. Each well should receive a unique barcode primer pair. 2 Vortex the sample mix solutions for a minimum of 20 seconds and centrifuge for 30 seconds. Thermal-Cycle the 96-Well PCR Plate Place the PCR plates on two PCR thermal cyclers and run the following PCR protocol: Table 13. PCR protocol for attaching sequence tags and sample barcodes PCR Stages Cycle 95 C 10 min 1 95 C 15 sec 60 C 30 sec C 1 min 72 C 3 min 1 34

35 Chapter 5: Bidirectional Amplicon Tagging on the LP IFC Check PCR Products on the Agilent 2100 Bioanalyzer Check PCR Products on the Agilent 2100 Bioanalyzer 1 Use the Agilent DNA 1000 chips from the Agilent DNA 1000 Kit to check 1 μl of PCR product from each of the PCR reactions described above. Follow the Agilent DNA 1000 Kit Guide for details. 2 Check the results of the chip to determine if the PCR product pool has the expected size. Depending on the expected sizes of the PCR products, a smear may be visible. Comparison of the electropherogram to a histogram of the expected sizes indicates correctness of the product size range. The PCR products of the barcoding step should exhibit a band shift of +63 bp when compared to Harvest Pool Products. 3 Store the PCR products at 20 ºC. Next Step Continue with your library preparation as described in Post-PCR Amplicon Purification and Quantitation on page

36 Chapter 6: Post-PCR Amplicon Purification and Quantitation This chapter describes a standard Access Array procedure for the analysis of PCR products harvested from an LP IFC. The quality of the PCR products prepared on an LP IFC (or a Access Array IFC) is critical for successful amplicon sequencing. Any contamination of primers or primer dimers in the PCR products will be directly reflected in the quality of sequencing reads. Therefore, the PCR products generated on an IFC should to be qualified and purified before sequencing. The PCR products generated on the IFC are first analyzed using an Agilent 2100 Bioanalyzer to check for quality. Next, the PCR products are pooled together in equal volume to create one PCR product library. The PCR product library is then purified using AMPure XP beads, and quantified before proceeding to sequencing. It is recommended to use the Quant-iT PicoGreen dsdna assay kit for quantification of the final (cleaned-up) library prior to sequencing. Reference Documents Agilent DNA 1000 Kit Guide Quant-iT PicoGreen User Guide Materials Required Equipment SPRIPlate 96R Magnet Plate (Agencourt, PN ) or DynaMag -2 magnet (Invitrogen, PN D) Agilent 2100 Bioanalyzer and DNA 1000 Kit (Agilent, PN ) Fluorimeter-compatible 96- or 384-well microtiter plates Required Reagents Stored at 4 C Agencourt AMPure XP Reagent beads (Beckman Coulter Genomics, PN A63880) Quant-iT PicoGreen dsdna Assay Kit (Invitrogen, P11496) 36

37 Chapter 6: Post-PCR Amplicon Purification and Quantitation Quantitate PCR Products Stored at Room Temperature DNA suspension buffer (10 mm TRIS, ph 8.0, 0.1 mm EDTA) (Teknova, PN T0221) 100% Ethanol PCR Certified Water (Teknova, PN W3330) Quantitate PCR Products The PCR product library can be quantified using an Agilent 2100 Bioanalyzer with DNA 1000 Chips. 1 Run 1 μl of the 48 pooled PCR products from each sample on a Bioanalyzer DNA 1000 Chip following the manufacturer s instructions. a b Ensure that amplicon sizes and distribution are within the expected range (±5% for amplicons in the range of bp including tags). Ensure that primer-dimer contamination in the PCR product pool (in the range of bp) is less than 25%, based on the Bioanalyzer quantification shown in Appendix A: Electropherogram Examples. 2 Continue with the purification procedure below for all of the pooled PCR products that contain less than 25% primer dimers. Purify Harvested PCR Products 1 Remove AMPure XP beads from refrigerator and warm to room temperature for 30 minutes. 2 Prepare 70% ethanol solution: a To a 15 ml tube, add 3 ml of PCR-Certified Water and 7 ml of 100% ethanol. b Vortex for 5 seconds. 3 Pool 1 μl of each barcoded sample PCR product (see Attach Sequence Tags and Sample Barcodes on page 33) into a new microcentrifuge tube. 4 Vortex AMPure XP beads for 10 seconds to resuspend. Bead solution should appear homogeneous and consistent in color. 5 Pipet the barcoded sample pool, DNA suspension buffer, and AMPure XP beads into a 1.5 ml microtube according to the table below: Component Volume (μl) Barcoded sample pool 12.0 DNA suspension buffer 24.0 AMPure XP Beads 36.0 Total

38 Chapter 6: Post-PCR Amplicon Purification and Quantitation PCR Product Library Quantitation Procedure 6 Vortex the tube and incubate at room temperature for 10 minutes. 7 Place the microtube onto a magnetic separator and allow it to sit for 1 minute. 8 Carefully pipet out the supernatant without disturbing the beads (remove as much liquid as possible). 9 Add 180 μl of 70% ethanol and vortex for 10 seconds. 10 Place the microtube onto a magnetic separator and allow it to set for 1 minute. 11 Carefully pipet the supernatant without disturbing the beads. 12 Add 180 μl of 70% ethanol and vortex for 10 seconds. 13 Place the microtube onto a magnetic separator and allow it to set for 1 minute. 14 Carefully pipet out the supernatant without disturbing the beads. 15 Allow the beads to air dry for approximately 10 minutes by leaving the tube on the bench. Make sure the tube is completely dry before proceeding. 16 Add 40 μl of DNA suspension buffer to the microtube and vortex for 5 seconds. 17 Place the microtube onto a magnetic separator and allow it to set for one minute. 18 Carefully transfer the supernatant to a new 1.5 ml microtube. PCR Product Library Quantitation Procedure Use one of the following quantitation methods to quantify the PCR product library. IMPORTANT The Ion Library Quantification Kit (Ion Torrent, PN ) is not compatible with the library generated with Access Array Barcode Library for Ion Torrent PGM Sequencer - 96 (Fluidigm, PN ). Agilent 2100 Bioanalyzer Quantification 1 Run 1 μl of the PCR product library on a Bioanalyzer DNA 1000 Chip following the manufacturer s instructions. 2 Define a region of interest in the electropherogram to determine the PCR product library concentration. a b Select the Region Table subtab on the bottom panel of the Electropherogram tab. Right-click the electropherogram and select Add region. Define the region to cover all of the PCR product library peaks. 38

39 Chapter 6: Post-PCR Amplicon Purification and Quantitation PCR Product Library Quantitation Procedure c The Region Table listed below the electropherogram will show the concentration of the Region containing the PCR product library. Refer to the Agilent 2100 Bioanalyzer User Guide for additional information on Regions. PicoGreen Fluorimetry Quantification Quantitate the PCR product library by fluorimetry, using the Quant-iT PicoGreen dsdna Assay Kit, following the manufacturer s instructions. Independent IFC libraries should be quantitated separately. After quantitation, libraries must be normalized and volumetrically combined into a single final library for sequencing. The final library concentration based on Quant-iT is then used for the downstream sequencing preparation. Pool the Products from Multiple Access Array IFCs To pool amplicons from more than one Access Array IFC, pool and purify each Access Array IFC separately. 1 Follow the steps outlined in this chapter under Purify Harvested PCR Products on page 37 for each Access Array IFC. 2 For bidirectional amplicon tagged libraries (generated in Chapter 5), pool products A and B from the same Access Array IFC (up to 48 samples) together for purification. 39

40 Chapter 6: Post-PCR Amplicon Purification and Quantitation PCR Product Library Quantitation Procedure 3 Continue to quantify the pooled, purified library by calculating the PCR Product Library Concentration outlined later in this chapter. 4 Once each IFC Library has been purified and quantified, normalize the concentration of each IFC Library and pool libraries volumetrically by adding an equal volume of each library to a new microcentrifuge tube. The pooled Access Array IFC library is now ready for sequencing. 40

41 Appendix A: Electropherogram Examples The figures in this section are examples from an Agilent 2100 Bioanalyzer electropherogram of a harvested PCR product pool. The first two figures show a DNA 1000 Chip electropherogram of a pooled PCR product with 48 amplicons ranging between bp. Figure A shows the harvested PCR product pool from a Access Array IFC, and Figure B shows the same harvested PCR product pool after SPRI cleanup: 41

42 Appendix A: Electropherogram Examples The following figure shows a DNA 1000 Chip electropherogram overlay of an unpurified pooled PCR product library and the same purified pooled PCR product library after AMPure XP cleanup: 42